Cancer Genomics Practice and Procedure HandbookHave patient or collector fill out patient...

Cancer GenomicsPractice and

ProcedureHandbook

Table of ContentsCGx Welcome Letter .......................................................................................................................3

CGx Order Form Protocol ................................................................................................................4

Form and Buccal Swab Collection Instructions ...............................................................................5

CGx ICD-10 Codes ........................................................................................................................10

Laboratory Request Form .............................................................................................................12

Medical Necessity Form ................................................................................................................15

Panels ...........................................................................................................................................17

CGx Sample Report .......................................................................................................................19

Contact Information ......................................................................................................................23

2225 Centennial Drive, Gainesville, GA 30504 ~ P: 888.661.0255 ~ F: 678.971.4830 ~ aeonglobalhealth.com

Dear New Client,

As Chairman of Aeon Global Health, I’d like to personally thank you for choosing Aeon for your testing needs. We pride ourselves in being client focused and highly customizable. As such, we’re confident you’ll be very pleased with the services offered by our company.

This Client Handbook provides you with a complete guide on how to use the cancer genomics services provided by Aeon (Us). Enclosed you will find:

1. Instruction on filling out requisition form A. A list of genetic testing panels B. A list of the commonly used ICD-10 codes

2. Specimen shipping and collection protocols for oral samples 3. Instruction on how to access the web portal for result viewing 4. A sample genetics report 5. Contact information

If you have any questions, please feel free to contact us at any time. Thanks again for choosingAeon Global Health. We’re excited to welcome you to the Aeon Team.

Warmest Regards,

Sonny Roshan

GeNetIC Order FOrm PrOt�COl

1. Account InformationThe account information including address and provider information will be pre-populated. Please check the slot by name of provider ordering test.

2. Patient InformationHave patient or collector fill out patient information. This includes the first and lastname, address, phone, sex and date of birth. Also check the type of insurance the patienthas. Also fill out the patient name, date of birth and collector name on the duplicatelabels that will be applied to the buccal swab collection tubes. Finally, have the patientsign the Patient Signature line.

3. ICd-10 diagnosis Code(s)Please enter the relevant ICD-10 diagnosis code or codes.

4. tests requestedPlease check off the pharmacogenetic test profile requested. Description of the genestested in each panel are available on a separate sheet.

5. Collection InformationFill in the time collected, date collected and name of collector. The buccal swab sampletype is premarked.

6. Physician SignaturePlease have provider sign and date the order form. If the provider signature is on filewith Aeon Global Health, there is no need to sign the form.

CGx Order FOrm PrOtOCOl

CGx COLLECTION AND ORDER FORM INSTRUCTIONS

Please complete lab request form in its entirety.Fill out genetic lab order form following these instructions:

Aeon%Clinical%Laboratories Cancer%Genomics 1 %

%%

%%

Peachstate(Health(Management,(LLC(

AEON(Clinical(Laboratories(

2225%Centennial%Drive%%•%%Gainesville,%GA%30504%Phone:%(678)%276 8412%%•%%Fax:%(678)%971 4830Email:%[email protected]%%Director:%Dr.%Richard%E.%Mullins,%Ph.D.,%D.A.B.C.C.%

Cancer%Test%Requisition%

PATIENT(INFORMATION% Patient%Status:% Inpatient% Outpatient% NonDhospital% Other%Last%Name% First%Name%% Middle%Initial%% % DOB%(MM/DD/YY)%%______________________________________%%____________________________%______________________________________% ______________________________________________%Street% % Address%% City% State%% % Zip%__________________% _______________________________________________% ____________________________% ____________________________% __________________________%Preferred%Contact%Phone%Number%% Gender% Ethnicity% African%American %

Asian%Hispanic%

%%%%%%%%%F% %M%_______________________________________________% %%%%%%%%%%%%N/A% Jewish%(Ashkenzai)% Portuguese%Ancestry% Other%

SPECIMEN(INFORMATION(

Collection%Date% % Specimen%ID% MRN%

_______________________________________________% _______________________________________________% _______________________________________________________INDICATIONS(FOR(TESTING((CHECK(ALL(THAT(APPLY)(

Diagnostic% Family%history%of%cancer% Other%_______________________________________________(

ORDERING(PHYSICIAN(AND/OR(OTHER(LICENSED(MEDICAL(PROFESSIONAL(

By%ordering%testing,%the%undersigned%person%represents%that%he/she%is%a%licensed%medical%professional%authorized%to%order%genetic%testing%OR%is%a%representative%of%a%licensed%medical%professional%authorized%to%order%genetic%testing;%acknowledges%the%patient%has%been%supplied%information%regarding%genetic%testing%and%the%patient%has%given%consent%for%genetic%testing%to%be%performed%and%the%signed%consent%form%is%on%file.%I%confirm%that%this%is%medically%necessary%for%the%diagnosis%or%detection%of%a%disease,%illness,%impairment,%syndrome%or%disorder,%and%that%these%results%will%be%used%in%the%medical%management%and%treatment%decisions%for%this%patient.%My%signature%here%applies%to%the%attached%letter%of%medical%necessity%(if%applicable).%Furthermore,%additional%results%recipients%information%is%true%and%correct%to%the%best%of%my%knowledge.%

Medical%Professional%Signature:%_____________________________________________________________________%%Date:%_______________________________________%

INSURANCE(BILLING((INCLUDE(COPY(OF(BOTH(SIDES(OF(INSURANCE(CARD)(

Patient%Relation%to%Policy%Holder%Self% Spouse% % Child%

Insurance%Company%_______________________________________________%

Policy%#%_____________________________%

%Authorization%#%_______________________________%

PATIENT(PAYMENT(

Check% Visa% MasterCard% American%Express% Discover%Card%Number% % Expiration%Date% % CVC%#%_____________________________________% _____________________________________% ___________________________________________________________________________%

Patient(Acknowledgement:%I%acknowledge%that%the%information%provided%by%me%is%true%to%the%best%of%my%knowledge.%For%direct%insurance/3rd%party%billing:%I%hereby%authorize%my%insurance%benefits%%to%be%paid%directly%to%Aeon%Clinical%Laboratories%and%authorize%them%to%release%medical%information%concerning%my%testing%to%my%insurer.%If%applicable,%I%authorize%Aeon%Clinical%Laboratories%to%%be%my%Designated%Representative%for%purposes%of%appealing%any%denial%of%benefits.%I%understand%that%I%am%financially%responsible%for%any%amounts%not%covered%by%my%insurer%for%this%test%order.%%

I(also(fully(understand(that(I(am(legally(responsible(for(sending(Aeon(Clinical(Laboratories(any(money(received(from(my(health(insurance(company(for(

performance(of(this(genetic(test.((

For%patient%payment%by%credit%card:%I%hereby%authorize%Aeon%Clinical%Laboratories%to%bill%my%credit%card%as%indicated%above.%

Patient%Signature:%_____________________________________________________________________________________%%Date:%_______________________________________%

LABORATORY(

REQUEST(

%#%_____________________________%

Aeon Global Health

Aeon Global Health

Patient Acknowledgment: I acknowledge that the information provided by me is true to the best of my knowledge. For direct insurance/3rd party billing: I hereby authorize my insurance benefits to be paid directly to Aeon Global Health and authorize them to release medical information concerning my testing to my insurer. If applicable, I authorize Aeon Global Health to be my Designated Representative for purposes of appealing any denial of benefits. I understand that I am financially responsible for any amounts not covered by my insurer for this test order.

I also fully understand that I am legally responsible for sending Aeon Global Health any money received from my health insurance company for performance of this genetic test. For patient payment by credit card: I hereby authorize Aeon Global Health to bill my credit card as indicated above.

Step 2: Patient Information Have patient fill out patient information. This includes the first and last name, date of birth, address, phone, gender, and ethnicity.

Step 5: Reason for Testing Please select all that applies

Step 6: Ordering Physician Signature Please have provider sign and date the order form. If the provider signature is missing the test will not be processed.

Step 8: Patient Acknowledgment Have the patient read, sign, and date. The test will not be processed if the patient signature is missing.

Step 7: Insurance Information Check the type of insurance the patient has. If the patient is self pay please select the appropriate option and provide account information.

Step 4: Diagnostic Codes Please enter the relevant ICD– 10 diagnosis code or codes.

Step 1: Account Information

The account information including address and provider information will be populated. Please check the slot by name of provider ordering test.

Step 3: Collection InformationFill in the time collected, date collected and name of collector. The buccal swab sample type is premarked.

2225 CENTENNIAL DRIVE, GAINESVILLE, GA 30504P: 888.661.0225 • F: 678.971.4830 • [email protected]



%%

%%

%%

Cancer%Test%Requisition% Patient%Name:%_____________________________________________

PATIENT(CLINICAL(HISTORY No%personal%history%of%cancer%Personal%h/o%Breast%Cancer% Age%at%dx:%______% Bilateral%

Check&here&if&surgery&is&occurring&within&the&month&and&Genetic&results&will&impact&surgery.&IDC%(Invasive%ductal%carcinoma)% ER% (+)% (D)%ILC%(Invasive%lobular%carcinoma)% PR% (+)% (D)%DCIS%(Ductal%carcinoma%in%situ)% % HER2/neu% (+)% (D)%LCIS%(Lobular%carcinoma%in%situ)%

Personal%h/o%Ovarian%Cancer%% Age%at%dx:%_________%Personal%h/o%Pancreatic%Cancer% Age%at%dx:%_________%Personal%h/o%Other%Cancer,%Type%:%________________% %%Age%at%dx:%_________%Personal%h/o%allogenic%bone%marrow%or%peripheral%stem%cell%transplant%Current%diagnosis%of%heme%malignancy,%Type%:%_____________________%%Personal%h/o%Colon%Cancer% Age%at%dx:%_________%

RightDsided%(ascending)% LeftDsided%(descending)%Transverse% % Rectal% Unknown%

Personal%h/o%Endometrial%Cancer%% Age%at%dx:%_________%Tumor%testing%previously%performed%

Microsatellite%analysis:% Stable%(MSS)% Unstable%(MSIDH)%IHC%Analysis:% Normal% Absence%of:%_______________________%

Personal%h/o%Colon%Polyps%Adenomatous%polyps% Age%at%first%polyp:%_________%Other%polyps% Age%at%first%polyp:%_________% Type:%_____________________________%

Other%clinical%hx:%___________________________________________________________________________________________________________________________%

PATIENT(TESTING(HISTORY No%previous%genetic%testing%

Negative%BRCA1/2&gene%sequencing%only&Negative%BRCA1/2&gene%sequencing%and%large%rearrangement%Negative%Lynch%syndrome%genetic%testing% % Genes%analyzed:%________________________________________________%Negative%polyposis%genetic%testing% % Genes%analyzed:%________________________________________________%Other:%______________________________________________________________________________________________________________________%

FAMILY(HISTORY(

Maternal((mother’s(side)(family(history(of(cancer%yes% no% unknown%

Relation%to%patient% h/o%cancer/polyps% Dx%age%________________________________________________________% %%%%%_______________________________________________________% %__________________________________%________________________________________________________% %%%%%_______________________________________________________% %__________________________________%________________________________________________________% %%%%%_______________________________________________________% %__________________________________%

Paternal((father’s(side)(family(history(of(cancer(

yes% no% unknown%Relation%to%patient% h/o%cancer/polyps% Dx%age%

________________________________________________________% %%%%%_______________________________________________________% %__________________________________%________________________________________________________% %%%%%_______________________________________________________% %__________________________________%________________________________________________________% %%%%%_______________________________________________________% %__________________________________%

Other((siblings/children)(family(history(of(cancer(


________________________________________________________% %%%%%_______________________________________________________% %__________________________________%________________________________________________________% %%%%%_______________________________________________________% %__________________________________%________________________________________________________% %%%%%_______________________________________________________% %__________________________________

Aeon Global Health

Step 9: Patient HistorySelect all that applies to the patient. If patient does not have any personal history of cancer, please select the box provided.

Step 10: Patient Testing History If the patient had any previous test performed, select all that applies. If not, please indicate accordingly.

Step 11: Family History If patient’s family member has/is diagnosed, please indicate in appropriate section.



Aeon%Clinical%Laboratories Cancer%Genomics 3


CANCER(TEST(MENU((IF%MORE%THAN%1%TEST%IS%ORDERED,%THEY%WILL%BE%RUN%CONCURRENTLY%UNLESS%SEQUENTIAL%IS%INDICATED%IN%NOTES%SECTION)%

SPECIFIC(SITE/FULL(GENE(SEQUENCE(AND/OR(DEL/DUP(ANALYSIS(

Specific%Site%Analysis%Gene%Name:%________________________%% Mutation(s):%________________________%Patient%relationship%to%known%mutation%carrier%_________________________________%Please&include&a&copy&of&the&known&mutation&carrier’s&test&report&Positive%Control%Not%Available%Positive%Control%Sent/To%Be%Sent%Do% not% include%BRCA1/2% sequencing% results% for% this%multi gene% panel order% due% to% previous% negative% testing% for% this%patient%through%another%%diagnostic%laboratory.%PLEASE%NOTE:%a%copy%of%the%previous%negative%%BRCA1/2% report%MUST%be%included% with% the% test% requisition% form% for% % BRCA1/2% sequencing% results%to%be%excluded from%the final%Aeon%Clinical%Laboratories% report.% In% addition,%clinically%significant%BRCA1/2%variants%(i.e.%those%%classified%as%“pathogenic”%or%“likely%pathogenic”)%are%always%reported.%

Notes:%_____________________________________________________________________________________________________%_____________________________________________________________________________________________________________%_____________________________________________________________________________________________________________%

Hereditary%Breast%Cancer%BRCA1/2%gene%sequence%and%del/dup%analyses%%BRCA1/2%del/dup%analysis%

Hereditary%Breast%and%Pancreatic%Cancer%PALB2%gene%sequence%and%del/dup%

Familial%Adenomatous%Polyposis%Syndrome%(FAP)%PC%gene%sequence%and%del/dup%

Von%Hippel%D%Lindau%Syndrome%VHL%gene%sequence%and%del/dup%

Hereditary%Cancer%Panels%RCADetect:%5%breast%cancer%gene%test%(BRCA1,&BRCA2,&CDH1,&PTEN,&TP53)%%GYNDetect:%9%ovarian/uterine%cancer%gene%test%(BRCA1,&BRCA2,&EPCAM,&MLH1,&MSH2,&MSH6,&PMS2,& TEN,&TP53)%BreastDetect:%1 %breast%cancer%gene%test%(ATM,&BRCA1,&BRCA2,&BRIP1,&CDH1,&&CHEK2,&MUTYH,&NBN,&NF1,&PALB2,&PTEN,&RAD51C,&RAD51D,&TP53)%%ColoDetect:%13%colon%cancer%gene%test%(APC,&BMPR1A,&CDH1,&CHEK2,&EPCAM,&&MLH1,&MSH2,&MSH6,&MUTYH,&PTEN,&PMS2,&STK11,&TP53)%OvaDetect:%20%ovarian/breast/uterine%cancer%gene%test%(ATM,&BRCA1,&BRCA2,&&BRIP1,&CDH1,&CHEK2,&EPCAM,&MLH1,&MSH2,&MSH6,&MUTYH,&NBN,&NF1,&PALB2,&&PMS2,& TEN,&RAD51C,&RAD51DS,&TK11,&TP53)%PancDetect:%13%pancreatic%cancer%gene%test%(APC,&ATM,&BRCA1,&BRCA2,&CDKN2A,&EPCAM,&MLH1,&MSH2,&MSH6,&PALB2,&PMS2,&STK11,&TP53)%%RenalDetect:%1 %renal%cancer%gene%test%(EPCAM,&FH,&FLCN,&MLH1,&MSH2,&&MSH6,&PMS2,&PTEN,&SDHB,&SDHC,&SDHD,&TP53,&TSC1,&TSC2,&VHL)%PGLDetect:%9%PGL/PCC%gene%test%(MAX,&NF1,&RET,&SDHB,&SDHC,&SDHD,&TMEM127,&VHL)%%CancerDetect:%25%gene%cancer%test%(APC,&ATM,&BRCA1,&BRCA2,&BRIP1,&BMPR1A,&&CDH1,&CHEK2,&CDK4,&CDKN2A,&EPCAM,&MLH1,&MSH2,&MSH6,&MUTYH,&NBN,&NF1,&&PALB2,&PMS2,&PTEN,&RAD51C,&RAD51D,&SMAD4,&STK11,&TP53)%CancerDetect(Extended:%3 gene%cancer%test%(APC,&ATM,&BRCA1,&BRCA2,&BRIP1,&&BMPR1A,&CDH1,&CHEK2,&CDK4,&CDKN2A,&EPCAM,&&FH,&FLCN,&MAX,&MLH1,&&MSH2,&MSH6,&MUTYH,&NBN,&NF1,&PALB2,&PMS2,&PTEN,&RAD51C,&RAD51D,&RET,&&SDHAF2,&SDHB,&SDHC,&SDHD,&SMAD4,&STK11,&TMEM127,&TP53,&TSC1,&TSC2,&VHL)%

Lynch%Syndrome%(HNPCC)%MLH1,&MSH2,&MSH6,&PSM2%gene%sequence%and%del/dup%+%EPCAM%del/dup%MSH6%gene%sequence%and%del/dup%%PMS2%gene%sequence%and%del/dup%%MLH1%gene%sequence%and%del/dup%MSH2%gene%sequence%and%del/dup%+%EPCAM%del/dup%%EPCAM%del/dup%

Cowden%Syndrome%PTEN%gene%sequence%and%del/dup%

Li%Fraumeni%Syndrome%TP53%gene%sequence%and%del/dup%

Juvenile%Polyposis%Syndrome%(JPS)%BMPR1A%and%SMAD4%gene%sequence%and%del/dup%SMAD4%gene%sequence%SMAD4%del/dup%BMPR1A%gene%sequence%BMPR1A%del/dup%BMPR1A%and%SMAD4%del/dup%

Paraganglioma%D%Pheochromocytoma%Syndrome%(PGL/PCC)%SDHB,&SDHC,&SDHD,&SDHAF2%gene%sequence%and%del/dup%with%MAX%and%TMEM127%gene%sequence%SDHB %SDHC,%SDHD,%and%SDHAF2%del/dup%SDHB%gene%sequence%%SDHC%gene%sequence%%SDHD%gene%sequence%%SDHAF2%gene%sequence%%TMEM127%gene%sequence%%MAX%gene%sequence%

Multiple%Endocrine%Neoplasia%Type%2%RET%gene%sequence%

BirtDHoggDDube'%Syndrome%FLCN%gene%sequence%and%del/dup%

Hereditary%Leiomyomatosis%and%Renal%Cell%Carcinoma%(HLRCC)%FH%gene%sequence%and%del/dup%

PeutzDJeghers%Syndrome%STK11%gene%sequence%and%del/dup%

Hereditary%Diffuse%Gastric%Cancer%CDH1%gene%sequence%and%del/dup%

Aeon Global Health

Step 12: Cancer Test Menu Please check off the Cancer test panel requested. Description of the genes tested in each panel are available on a separate sheet.



Fill Out Medical Necessity Form

Type of Cancer

1st degree relative & self

Age at diagnosis

2nd & 3rd degree relatives mother’s side

Age at diagnosis

2nd & 3rd degree relatives father’s side

Age at diagnosis

Breast Cancer

Colorectal Cancer

Endocrine Cancer

Kidney/Renal Cancer

Melanoma

Ovarian Cancer

Pancreatic Cancer

Prostate Cancer

Stomach Cancer

Uterine Cancer

Other Cancer:

Other Cancer

Family History Questionnaire This is a screening tool to help your healthcare provider determine if you would benefit from hereditary cancer genetic testing.

Patient Name: ______________________________________________

Please only consider first, second and third degree family members related to you by blood.

First degree relatives: parents, sisters, brothers and children

Second degree relatives: grandparents, uncles, aunts, nephews, nieces, and grandchildren.

Third degree relatives: great-grandparents, great-uncles, great-aunts, great grandchildren and first cousins.

*Please note that completing this questionnaire does not guarantee insurance will cover the cost of this test.

Genetic testing for hereditary cancer does not diagnose cancer or determine if you will develop cancer in your lifetime.

2225 Centennial Drive, Gainesville, GA 30504 www.aeonclinical.com

For office use onlyPatient appropriate for further risk assessment or genetic testing? Yes No Patient offered genetic testing? Accepted Declined Patient offered genetic counseling? Accepted Declined

Physicians Signature:_________________________________________________________Date:_______________________

2225 Centennial Drive , Gainesville, GA 30504Phone: 1-(888)-661-0225 • aeonglobalhealth.com



1. Provide Two Buccal Swabs to PatientPlease give patient two buccal swabs (Puritan 25- 3606-U BT, flocked swab collection device). Open buccal swab packages and apply one label to each swab collection tube. **Note** Have patient gently rinse mouth with water for 30 seconds prior to sample collection.

2. Swab MouthAsk patient to remove the swab from the collection tube by unscrewing the cap. The swab is attached to the tube cap. Have patient scrub one side of the swab for 45 seconds in a circular motion on inside of cheek. After 30 seconds, have patient turn swab to other side and rub in circular motion for 45 seconds. Repeat this with second swab. Total of 1 minute and 30 seconds for EACH swab. Use moderately FIRM pressure on cheek.

3. Seal SwabAfter cells have been collected on swab, place swab in collection device with cap attached. Place both sealed swabs into specimen collection bag and close. Place white copy of genetic lab order form, medical necessity form, and patient insurance paperwork in outer pouch of specimen bag.


Commonly Used ICd-10 Codes for Cancer Genomics testing General Guidelines: All cancer genomics tests should be accompanied by the ICD-10 code(s)

describing the patient’s primary reason for being treated. Examples of potential ICD-10 codes are below.

Personal History Z85.3 Personal history of malignant neoplasm of breast Z86.010 Personal history of colonic polyps Z80.0 Family history of malignant neoplasm of digestive organs Z80.3 Family history of malignant neoplasm of breast Z80.41 Family history of malignant neoplasm of ovary Z84.81 Family history of carrier of genetic disease

Stomach C16.9 Malignant neoplasm of stomach, unspecified

ColonC18.9 Malignant neoplasm of colon, unspecified

BreastC50.919 Malignant neoplasm of unspecified site of unspecified female breast C50.911 Malignant neoplasm of unspecified site of right female breast C50.912 Malignant neoplasm of unspecified site of left female breast C50.929 Malignant neoplasm of unspecified site of unspecified male breast C50.121 Malignant neoplasm of central portion of right male breast C50.122 Malignant neoplasm of central portion of left male breast C50.129 Malignant neoplasm of central portion of unspecified male breast C50.221 Malignant neoplasm of upper-inner quadrant of right male breast C50.222 Malignant neoplasm of upper-inner quadrant of left male breast C50.229 Malignant neoplasm of upper-inner quadrant of unspecified male breast C50.321 Malignant neoplasm of lower-inner quadrant of right male breast C50.322 Malignant neoplasm of lower-inner quadrant of left male breast C50.329 Malignant neoplasm of lower-inner quadrant of unspecified male breast C50.421 Malignant neoplasm of upper-outer quadrant of right male breast C50.422 Malignant neoplasm of upper-outer quadrant of left male breast C50.429 Malignant neoplasm of upper-outer quadrant of unspecified male breast C50.521 Malignant neoplasm of lower-outer quadrant of right male breast C50.522 Malignant neoplasm of lower-outer quadrant of left male breast C50.529 Malignant neoplasm of lower-outer quadrant of unspecified male breast C50.621 Malignant neoplasm of axillary tail of right male breast C50.622 Malignant neoplasm of axillary tail of left male breast C50.629 Malignant neoplasm of axillary tail of unspecified male breast C50.821 Malignant neoplasm of overlapping sites of right male breast C50.822 Malignant neoplasm of overlapping sites of left male breast

C50.829 Malignant neoplasm of overlapping sites of unspecified male breast C50.921 Malignant neoplasm of unspecified site of right male breast C50.922 Malignant neoplasm of unspecified site of left male breast

OvaryC56.9 Malignant neoplasm of unspecified ovary C56.1 Malignant neoplasm of right ovary C56.2 Malignant neoplasm of left ovary

ColonD12.0 Benign neoplasm of cecum D12.1 Benign neoplasm of appendix D12.6 Benign neoplasm of colon, unspecified K63.5 Polyp of colon D12.2 Benign neoplasm of ascending colon D12.3 Benign neoplasm of transverse colon D12.4 Benign neoplasm of descending colon D12.5 Benign neoplasm of sigmoid colon

OtherD07.30 Carcinoma in situ of unspecified female genital organs


%%

%%

Peachstate(Health(Management,(LLC(

AEON(Clinical(Laboratories(

2225%Centennial%Drive%%•%%Gainesville,%GA%30504%Phone:%(678)%276 8412%%•%%Fax:%(678)%971 4830Email:%[email protected]%%Director:%Dr.%Richard%E.%Mullins,%Ph.D.,%D.A.B.C.C.%

Cancer%Test%Requisition%

PATIENT(INFORMATION% Patient%Status:% Inpatient% Outpatient% NonDhospital% Other%Last%Name% First%Name%% Middle%Initial%% % DOB%(MM/DD/YY)%%______________________________________%%____________________________%______________________________________% ______________________________________________%Street% % Address%% City% State%% % Zip%__________________% _______________________________________________% ____________________________% ____________________________% __________________________%Preferred%Contact%Phone%Number%% Gender% Ethnicity% African%American %

Asian%Hispanic%

%%%%%%%%%F% %M%_______________________________________________% %%%%%%%%%%%%N/A% Jewish%(Ashkenzai)% Portuguese%Ancestry% Other%

SPECIMEN(INFORMATION(

Collection%Date% % Specimen%ID% MRN%

_______________________________________________% _______________________________________________% _______________________________________________________INDICATIONS(FOR(TESTING((CHECK(ALL(THAT(APPLY)(

Diagnostic% Family%history%of%cancer% Other%_______________________________________________(

ORDERING(PHYSICIAN(AND/OR(OTHER(LICENSED(MEDICAL(PROFESSIONAL(

By%ordering%testing,%the%undersigned%person%represents%that%he/she%is%a%licensed%medical%professional%authorized%to%order%genetic%testing%OR%is%a%representative%of%a%licensed%medical%professional%authorized%to%order%genetic%testing;%acknowledges%the%patient%has%been%supplied%information%regarding%genetic%testing%and%the%patient%has%given%consent%for%genetic%testing%to%be%performed%and%the%signed%consent%form%is%on%file.%I%confirm%that%this%is%medically%necessary%for%the%diagnosis%or%detection%of%a%disease,%illness,%impairment,%syndrome%or%disorder,%and%that%these%results%will%be%used%in%the%medical%management%and%treatment%decisions%for%this%patient.%My%signature%here%applies%to%the%attached%letter%of%medical%necessity%(if%applicable).%Furthermore,%additional%results%recipients%information%is%true%and%correct%to%the%best%of%my%knowledge.%

Medical%Professional%Signature:%_____________________________________________________________________%%Date:%_______________________________________%

INSURANCE(BILLING((INCLUDE(COPY(OF(BOTH(SIDES(OF(INSURANCE(CARD)(

Patient%Relation%to%Policy%Holder%Self% Spouse% % Child%

Insurance%Company%_______________________________________________%

Policy%#%_____________________________%

%Authorization%#%_______________________________%

PATIENT(PAYMENT(

Check% Visa% MasterCard% American%Express% Discover%Card%Number% % Expiration%Date% % CVC%#%_____________________________________% _____________________________________% ___________________________________________________________________________%

Patient(Acknowledgement:%I%acknowledge%that%the%information%provided%by%me%is%true%to%the%best%of%my%knowledge.%For%direct%insurance/3rd%party%billing:%I%hereby%authorize%my%insurance%benefits%%to%be%paid%directly%to%Aeon%Clinical%Laboratories%and%authorize%them%to%release%medical%information%concerning%my%testing%to%my%insurer.%If%applicable,%I%authorize%Aeon%Clinical%Laboratories%to%%be%my%Designated%Representative%for%purposes%of%appealing%any%denial%of%benefits.%I%understand%that%I%am%financially%responsible%for%any%amounts%not%covered%by%my%insurer%for%this%test%order.%%

I(also(fully(understand(that(I(am(legally(responsible(for(sending(Aeon(Clinical(Laboratories(any(money(received(from(my(health(insurance(company(for(

performance(of(this(genetic(test.((

For%patient%payment%by%credit%card:%I%hereby%authorize%Aeon%Clinical%Laboratories%to%bill%my%credit%card%as%indicated%above.%

Patient%Signature:%_____________________________________________________________________________________%%Date:%_______________________________________%

LABORATORY(

REQUEST(

%#%_____________________________%

Aeon Global Health

Aeon Global Health

Patient Acknowledgment: I acknowledge that the information provided by me is true to the best of my knowledge. For direct insurance/3rd party billing: I hereby authorize my insurance benefits to be paid directly to Aeon Global Health and authorize them to release medical information concerning my testing to my insurer. If applicable, I authorize Aeon Global Health to be my Designated Representative for purposes of appealing any denial of benefits. I understand that I am financially responsible for any amounts not covered by my insurer for this test order.

I also fully understand that I am legally responsible for sending Aeon Global Health any money received from my health insurance company for performance of this genetic test. For patient payment by credit card: I hereby authorize Aeon Global Health to bill my credit card as indicated above.


%%

%%

%%


PATIENT(CLINICAL(HISTORY No%personal%history%of%cancer%Personal%h/o%Breast%Cancer% Age%at%dx:%______% Bilateral%

Check&here&if&surgery&is&occurring&within&the&month&and&Genetic&results&will&impact&surgery.&IDC%(Invasive%ductal%carcinoma)% ER% (+)% (D)%ILC%(Invasive%lobular%carcinoma)% PR% (+)% (D)%DCIS%(Ductal%carcinoma%in%situ)% % HER2/neu% (+)% (D)%LCIS%(Lobular%carcinoma%in%situ)%

Personal%h/o%Ovarian%Cancer%% Age%at%dx:%_________%Personal%h/o%Pancreatic%Cancer% Age%at%dx:%_________%Personal%h/o%Other%Cancer,%Type%:%________________% %%Age%at%dx:%_________%Personal%h/o%allogenic%bone%marrow%or%peripheral%stem%cell%transplant%Current%diagnosis%of%heme%malignancy,%Type%:%_____________________%%Personal%h/o%Colon%Cancer% Age%at%dx:%_________%

RightDsided%(ascending)% LeftDsided%(descending)%Transverse% % Rectal% Unknown%

Personal%h/o%Endometrial%Cancer%% Age%at%dx:%_________%Tumor%testing%previously%performed%

Microsatellite%analysis:% Stable%(MSS)% Unstable%(MSIDH)%IHC%Analysis:% Normal% Absence%of:%_______________________%

Personal%h/o%Colon%Polyps%Adenomatous%polyps% Age%at%first%polyp:%_________%Other%polyps% Age%at%first%polyp:%_________% Type:%_____________________________%

Other%clinical%hx:%___________________________________________________________________________________________________________________________%

PATIENT(TESTING(HISTORY No%previous%genetic%testing%

Negative%BRCA1/2&gene%sequencing%only&Negative%BRCA1/2&gene%sequencing%and%large%rearrangement%Negative%Lynch%syndrome%genetic%testing% % Genes%analyzed:%________________________________________________%Negative%polyposis%genetic%testing% % Genes%analyzed:%________________________________________________%Other:%______________________________________________________________________________________________________________________%

FAMILY(HISTORY(

Maternal((mother’s(side)(family(history(of(cancer%yes% no% unknown%

Relation%to%patient% h/o%cancer/polyps% Dx%age%________________________________________________________% %%%%%_______________________________________________________% %__________________________________%________________________________________________________% %%%%%_______________________________________________________% %__________________________________%________________________________________________________% %%%%%_______________________________________________________% %__________________________________%

Paternal((father’s(side)(family(history(of(cancer(


________________________________________________________% %%%%%_______________________________________________________% %__________________________________%________________________________________________________% %%%%%_______________________________________________________% %__________________________________%________________________________________________________% %%%%%_______________________________________________________% %__________________________________%

Other((siblings/children)(family(history(of(cancer(


________________________________________________________% %%%%%_______________________________________________________% %__________________________________%________________________________________________________% %%%%%_______________________________________________________% %__________________________________%________________________________________________________% %%%%%_______________________________________________________% %__________________________________

Aeon Global Health

Aeon%Clinical%Laboratories Cancer%Genomics 3


CANCER(TEST(MENU((IF%MORE%THAN%1%TEST%IS%ORDERED,%THEY%WILL%BE%RUN%CONCURRENTLY%UNLESS%SEQUENTIAL%IS%INDICATED%IN%NOTES%SECTION)%

SPECIFIC(SITE/FULL(GENE(SEQUENCE(AND/OR(DEL/DUP(ANALYSIS(

Specific%Site%Analysis%Gene%Name:%________________________%% Mutation(s):%________________________%Patient%relationship%to%known%mutation%carrier%_________________________________%Please&include&a&copy&of&the&known&mutation&carrier’s&test&report&Positive%Control%Not%Available%Positive%Control%Sent/To%Be%Sent%Do% not% include%BRCA1/2% sequencing% results% for% this%multi gene% panel order% due% to% previous% negative% testing% for% this%patient%through%another%%diagnostic%laboratory.%PLEASE%NOTE:%a%copy%of%the%previous%negative%%BRCA1/2% report%MUST%be%included% with% the% test% requisition% form% for% % BRCA1/2% sequencing% results%to%be%excluded from%the final%Aeon%Clinical%Laboratories% report.% In% addition,%clinically%significant%BRCA1/2%variants%(i.e.%those%%classified%as%“pathogenic”%or%“likely%pathogenic”)%are%always%reported.%

Notes:%_____________________________________________________________________________________________________%_____________________________________________________________________________________________________________%_____________________________________________________________________________________________________________%

Hereditary%Breast%Cancer%BRCA1/2%gene%sequence%and%del/dup%analyses%%BRCA1/2%del/dup%analysis%

Hereditary%Breast%and%Pancreatic%Cancer%PALB2%gene%sequence%and%del/dup%

Familial%Adenomatous%Polyposis%Syndrome%(FAP)%PC%gene%sequence%and%del/dup%

Von%Hippel%D%Lindau%Syndrome%VHL%gene%sequence%and%del/dup%

Hereditary%Cancer%Panels%RCADetect:%5%breast%cancer%gene%test%(BRCA1,&BRCA2,&CDH1,&PTEN,&TP53)%%GYNDetect:%9%ovarian/uterine%cancer%gene%test%(BRCA1,&BRCA2,&EPCAM,&MLH1,&MSH2,&MSH6,&PMS2,& TEN,&TP53)%BreastDetect:%1 %breast%cancer%gene%test%(ATM,&BRCA1,&BRCA2,&BRIP1,&CDH1,&&CHEK2,&MUTYH,&NBN,&NF1,&PALB2,&PTEN,&RAD51C,&RAD51D,&TP53)%%ColoDetect:%13%colon%cancer%gene%test%(APC,&BMPR1A,&CDH1,&CHEK2,&EPCAM,&&MLH1,&MSH2,&MSH6,&MUTYH,&PTEN,&PMS2,&STK11,&TP53)%OvaDetect:%20%ovarian/breast/uterine%cancer%gene%test%(ATM,&BRCA1,&BRCA2,&&BRIP1,&CDH1,&CHEK2,&EPCAM,&MLH1,&MSH2,&MSH6,&MUTYH,&NBN,&NF1,&PALB2,&&PMS2,& TEN,&RAD51C,&RAD51DS,&TK11,&TP53)%PancDetect:%13%pancreatic%cancer%gene%test%(APC,&ATM,&BRCA1,&BRCA2,&CDKN2A,&EPCAM,&MLH1,&MSH2,&MSH6,&PALB2,&PMS2,&STK11,&TP53)%%RenalDetect:%1 %renal%cancer%gene%test%(EPCAM,&FH,&FLCN,&MLH1,&MSH2,&&MSH6,&PMS2,&PTEN,&SDHB,&SDHC,&SDHD,&TP53,&TSC1,&TSC2,&VHL)%PGLDetect:%9%PGL/PCC%gene%test%(MAX,&NF1,&RET,&SDHB,&SDHC,&SDHD,&TMEM127,&VHL)%%CancerDetect:%25%gene%cancer%test%(APC,&ATM,&BRCA1,&BRCA2,&BRIP1,&BMPR1A,&&CDH1,&CHEK2,&CDK4,&CDKN2A,&EPCAM,&MLH1,&MSH2,&MSH6,&MUTYH,&NBN,&NF1,&&PALB2,&PMS2,&PTEN,&RAD51C,&RAD51D,&SMAD4,&STK11,&TP53)%CancerDetect(Extended:%3 gene%cancer%test%(APC,&ATM,&BRCA1,&BRCA2,&BRIP1,&&BMPR1A,&CDH1,&CHEK2,&CDK4,&CDKN2A,&EPCAM,&&FH,&FLCN,&MAX,&MLH1,&&MSH2,&MSH6,&MUTYH,&NBN,&NF1,&PALB2,&PMS2,&PTEN,&RAD51C,&RAD51D,&RET,&&SDHAF2,&SDHB,&SDHC,&SDHD,&SMAD4,&STK11,&TMEM127,&TP53,&TSC1,&TSC2,&VHL)%

Lynch%Syndrome%(HNPCC)%MLH1,&MSH2,&MSH6,&PSM2%gene%sequence%and%del/dup%+%EPCAM%del/dup%MSH6%gene%sequence%and%del/dup%%PMS2%gene%sequence%and%del/dup%%MLH1%gene%sequence%and%del/dup%MSH2%gene%sequence%and%del/dup%+%EPCAM%del/dup%%EPCAM%del/dup%

Cowden%Syndrome%PTEN%gene%sequence%and%del/dup%

Li%Fraumeni%Syndrome%TP53%gene%sequence%and%del/dup%

Juvenile%Polyposis%Syndrome%(JPS)%BMPR1A%and%SMAD4%gene%sequence%and%del/dup%SMAD4%gene%sequence%SMAD4%del/dup%BMPR1A%gene%sequence%BMPR1A%del/dup%BMPR1A%and%SMAD4%del/dup%

Paraganglioma%D%Pheochromocytoma%Syndrome%(PGL/PCC)%SDHB,&SDHC,&SDHD,&SDHAF2%gene%sequence%and%del/dup%with%MAX%and%TMEM127%gene%sequence%SDHB %SDHC,%SDHD,%and%SDHAF2%del/dup%SDHB%gene%sequence%%SDHC%gene%sequence%%SDHD%gene%sequence%%SDHAF2%gene%sequence%%TMEM127%gene%sequence%%MAX%gene%sequence%

Multiple%Endocrine%Neoplasia%Type%2%RET%gene%sequence%

BirtDHoggDDube'%Syndrome%FLCN%gene%sequence%and%del/dup%

Hereditary%Leiomyomatosis%and%Renal%Cell%Carcinoma%(HLRCC)%FH%gene%sequence%and%del/dup%

PeutzDJeghers%Syndrome%STK11%gene%sequence%and%del/dup%

Hereditary%Diffuse%Gastric%Cancer%CDH1%gene%sequence%and%del/dup%

Aeon Global Health

Doctor Discussion Guide

Are you a Candidate for Hereditary Cancer Screening

Ask your health care provider about your eligibility for hereditary cancer screening today.

General Information

The genes we are born with may contribute to our risk of developing certain types of cancer, including breast, ovarian, colorectal, and prostate cancer. If you have a family history of cancer, a Hereditary Cancer Screening test can help you to understand your risk for disease.

Everyone has some risk of developing cancer, and in most cases the disease develops by chance. However, some people are genetically predisposed to developing certain types of cancer. These people have a higher risk of developing the disease than those in the general public.

DNA is present in almost every cell in our body and carries the basic instructions our cells and tissues need to function properly. DNA is packaged into structures called chromosomes. Most people’s cells contain 23 different chromosomes that come in two identical sets — one set from our mother, and one from our father — or 46 chromosomes in total.

Scattered across our chromosomes are approximately 25,000 genes, which are functional units of DNA. The cell uses genes to make proteins and other substances that are necessary for life. In some genes, changes in the DNA called mutations have been linked to cancer

Genes and Cancer

Cancer is usually caused by gene mutations that occur randomly in one or a few cells of the body. Such gene changes, called somatic mutations, may arise as a natural consequence of aging or when a cell’s DNA has been damaged. Acquired mutations are only present in some of the body’s cells, and they are not passed on from parents to their children.

However, in a small percentage of people with cancer, the disease is due to a different type of mutation called a hereditary mutation, or germline mutation. These mutations are usually inherited from one or both of the person’s parents, and are present in nearly every cell of the body. Because hereditary mutations are present in the DNA of sperm and egg cells, they can be passed down in families.

People who carry such hereditary mutations do not necessarily get cancer, but their risk of developing the disease at some point during their lifetime is higher than average.

In recent years, scientists have discovered a number of mutations that can contribute to a person’s risk of developing certain cancers, including breast, ovarian, colorectal, and prostate cancer, as well as some other, less common cancer types.

Genetic testing is now available for some hereditary cancers. If you have a family history of cancer, or if you would like to find out whether you or a family member has an increased likelihood of developing cancer, speak with your healthcare provider today to find out your options.

Prescribe w ith Confidence

Doctor Discussion Guide

Are you a Candidate for Hereditary Cancer Screening

Ask your health care provider about your eligibility for hereditary cancer screening today.

General Information

The genes we are born with may contribute to our risk of developing certain types of cancer, including breast, ovarian, colorectal, and prostate cancer. If you have a family history of cancer, a Hereditary Cancer Screening test can help you to understand your risk for disease.

Everyone has some risk of developing cancer, and in most cases the disease develops by chance. However, some people are genetically predisposed to developing certain types of cancer. These people have a higher risk of developing the disease than those in the general public.

DNA is present in almost every cell in our body and carries the basic instructions our cells and tissues need to function properly. DNA is packaged into structures called chromosomes. Most people’s cells contain 23 different chromosomes that come in two identical sets — one set from our mother, and one from our father — or 46 chromosomes in total.

Scattered across our chromosomes are approximately 25,000 genes, which are functional units of DNA. The cell uses genes to make proteins and other substances that are necessary for life. In some genes, changes in the DNA called mutations have been linked to cancer

Genes and Cancer

Cancer is usually caused by gene mutations that occur randomly in one or a few cells of the body. Such gene changes, called somatic mutations, may arise as a natural consequence of aging or when a cell’s DNA has been damaged. Acquired mutations are only present in some of the body’s cells, and they are not passed on from parents to their children.

However, in a small percentage of people with cancer, the disease is due to a different type of mutation called a hereditary mutation, or germline mutation. These mutations are usually inherited from one or both of the person’s parents, and are present in nearly every cell of the body. Because hereditary mutations are present in the DNA of sperm and egg cells, they can be passed down in families.

People who carry such hereditary mutations do not necessarily get cancer, but their risk of developing the disease at some point during their lifetime is higher than average.

In recent years, scientists have discovered a number of mutations that can contribute to a person’s risk of developing certain cancers, including breast, ovarian, colorectal, and prostate cancer, as well as some other, less common cancer types.

Genetic testing is now available for some hereditary cancers. If you have a family history of cancer, or if you would like to find out whether you or a family member has an increased likelihood of developing cancer, speak with your healthcare provider today to find out your options.

Prescribe w ith Confidence ®

Type of Cancer

1st degree relative & self

Age at diagnosis

2nd & 3rd degree relatives mother’s side

Age at diagnosis

2nd & 3rd degree relatives father’s side

Age at diagnosis

Breast Cancer

Colorectal Cancer

Endocrine Cancer

Kidney/Renal Cancer

Melanoma

Ovarian Cancer

Pancreatic Cancer

Prostate Cancer

Stomach Cancer

Uterine Cancer

Other Cancer:

Other Cancer

Family History Questionnaire This is a screening tool to help your healthcare provider determine if you would benefit from hereditary cancer genetic testing.

Patient Name: ______________________________________________

Please only consider first, second and third degree family members related to you by blood.

First degree relatives: parents, sisters, brothers and children

Second degree relatives: grandparents, uncles, aunts, nephews, nieces, and grandchildren.

Third degree relatives: great-grandparents, great-uncles, great-aunts, great grandchildren and first cousins.

*Please note that completing this questionnaire does not guarantee insurance will cover the cost of this test.

Genetic testing for hereditary cancer does not diagnose cancer or determine if you will develop cancer in your lifetime.

2225 Centennial Drive, Gainesville, GA 30504 www.aeonclinical.com

For office use onlyPatient appropriate for further risk assessment or genetic testing? Yes No Patient offered genetic testing? Accepted Declined Patient offered genetic counseling? Accepted Declined

Physicians Signature:_________________________________________________________Date:_______________________

2225 Centennial Drive , Gainesville, GA 30504Phone: 1-(888)-661-0225 • aeonglobalhealth.com

C A N C E R D E T E C T P R O F I L EAeon is the leader in the field of Cancer Genomics testing and is pleased to offer our hereditary CancerDetect Profile. This genetic testing profile provides information on the connection between a patient’s unique genetic makeup and their risk to develop certain prevalent cancers. For example, certainmutations in the BRCA1/BRCA2 genes can lead to a greater likelihood of breast cancer.

All Cancer Genomic patient samples are handled with the greatest care by highly trained scientists inour state-of-the-art facility. Our detailed but easy to read reports will ensure you treat your patientswith the most up to date information. Trust Aeon for your Cancer Genomic testing needs.

Genes Associated Cancers/TumorsAPC Colorectal, central nervous system, thyroid, liver, duodenal, pancreaticATM Breast, pancreaticNBN Breast, prostate, possibly ovarianBRCA1, BRCA2 Breast, ovarian, prostate,pancreatic, male breastBRIP1,RAD51C,RAD51D Breast, ovarianBMPR1A, SMAD4 Stomach,colorectal,pancreaticCDH1 Breast, colorectal, gastricCDK4 MelanomaCDKN2A Melanoma, pancreaticCHEK2 Breast, colorectalFH Kidney, leiomyomasFLCN KidneyMAX PheochromocytomaMET KidneyMLH1, MSH2, MSH6,PMS2, EPCAM

Ovarian, colorectal, uterine, stomach, small bowel, hepatobiliary, brain,pancreatic, sebaceous, urinarytract

MUTYH Breast, colorectalNF1 Optic glioma, gastrointestinal stromal tumor, central nervous system,

paraganglioma/pheochromocytoma,neurofibromas,breastPALB2 Breast, pancreaticPTEN Breast, uterine, thyroid, colorectal, kidneyRET Thyroid (medullary),pheochromocytomaSDHAF2, SDHB, SDHC,SDHD

Kidney, paraganglioma/pheochromocytoma, gastrointestinal stromal tumorTSC1,TSC2 Kidney,cardiac rhabdomyomas,centralnervoussystemSTK11 Colorectal, small bowel, pancreatic, breast, ovarianTMEM127 Paraganglioma/pheochromocytomaTP53 Brain, leukemia,breast,sarcoma,adrenocortical,gastrointestinal,genitourinaryVHL Kidney,pheochromocytoma, central nervous system

www.aeonclinical.com

P R O F I L E SHereditary Breast Cancer - BRCA1/2 gene sequence and del/dup

- BRCA1/2 del/dupanalysis

Hereditary Breast andPancreaticCancer

- PALB2 gene sequence and del/dup

LynchSyndrome(HNPCC) - MLH1, MSH2, MSH6, PSM2 gene sequence and del/dup + EPCAM del/dup- MSH6 gene sequence and del/dup- PMS2 gene sequence and del/dup- MLH1 gene sequence and del/dup- MSH2 gene sequence and del/dup + EPCAM del/dup- EPCAM del/dup

Familial Adenomateus Polyposis Syndrome (FAP)

- PCgenesequenceanddel/dup

Hereditary Cancer Panels -RCADetect:5 breast cancer gene test (BRCA1,BRCA2, CDHl, PTEN, TP53)-GYNDetect:9ovarian/uterinecancergenetest(BRCA1,BRCA2,EPCAM,MLH1,MSH2,MSH6, PMS2, PTEN,TP53)

-BreastDetect: 15 breast cancer gene test (ATM, BRCA1, BRCA2, BRIP1, CDHl, CHEK2,MUTYH, NBN, NF1, PALB2, PTEN, RAD50, RAD51C, RAD51D,TP53)

-ColoDetect:13 coloncancergene test (APC,BMPR1A,CDH1,CHEK2,EPCAM,MLH1,MSH2, MSH6, MUTYH, PTEN, PMS2, STK11, TP53)

-OvaDetect: 20 ovarian/breast/uterine cancer gene test (ATM, BRCA1, BRCA2, BRIP1,CDH1, CHEK2,EPCAM,MLH1,MSH2,MSH6,MUTYH,NBN,NF1,PALB2,PMS2,PTEN,RAD51C, RAD51D, STK11,TP53)

-PancDetect: 13 pancreatic cancer gene test (APC, ATM, BRCA1, BRCA2, CDKN2A,EPCAM, MLH1, MSH2, MSH6, PALB2, PMS2, STK11, TP53)

-RenalDetect: 16 renal cancer gene test (EPCAM, FH, FLCN, MET, MLH1, MSI MSH6,PMS2, PTEN, SDHB, SDHC, SDHD, TP53, TSC1, TSC2, VHL)

- PGLDetect: 9 PGL/PCC gene test (MAX, NF1, RET,SDHB, SDHC, SDHD,TMEM127, VHL)-CancerDetect:25genecancer test (APC,ATM,BRCA1,BRCA2,BRIP1,BMPR1A,CDHl,CHEK2, CDK4, CDKN2A, EPCAM, MLH1, MSH2, MSH6, MUTYH, NBN, NF1, PALB2,PMS2,PTEN, RAD51C, RAD51D,SMAD4, STK11,TP53)

-CancerDetectExtended:38genecancer test (APC,ATM,BRCA1,BRCA2,BRIP1,BMPR1A,CDH1, CHEK2, CDK4, CDKN2A, EPCAM,FH, FLCN,MAX, MET,MLH1, MSH2, MSH6, MUTYH,NBN, NF1, PALB2, PMS2, PTEN, RAD51C, RAD51D, RET, SDHAF2, SDHB, SDHC, SDHD,SMAD4, STK11,TMEM127, TP53, TSC1, TSC2, VHL)

Cowden Syndrome - PTENgenesequenceanddel/dup

Li Fraumeni Syndrome - TP53 gene sequence and del/dup

Juvenile Polyposis Syndrome(JPS)

- BMPR1A and SMAD4 gene sequence and del/dup- SMAD4 genesequence- SMAD4del/dup- BMPR1A genesequence- BMPR1A del/dup- BMPR1A and SMAD4del/dup

ParagangliomaPheomachromocytoma Syndrome(RGL/PCC)

- SDHB,SDHC,SDHD,SDHAF2genesequenceanddel/dupwithMAXandTMEM127genesequence- SDHB, SDHC, SDHD, SDHAF2 del/dup- SDHB genesequence- SDHC genesequence- SDHD genesequence- SDHAF2 genesequence- TMEM127 genesequence- MAX genesequence

Von Hippel-Lindau Syndrome - VHL gene sequence and del/dup

Multiple Endocrine Neoplasia Type2

-RETgenesequence

Birt-Hogg-Dube' Syndrome - FLCN gene sequence and del/dup

Hereditary Leiomyomatosis and Renal Cell Carcinoma(HLRCC)

- FH gene sequence and del/dup

Peutz-Jeghers Syndrome -STK11genesequenceanddel/dup

HereditaryDiffuseGastric Syndrome

-CDH1genesequenceanddel/dup

Electronically signed by Jessica Pack, MS, CGC, | [email protected] | (678) 276-8412 Page of 1 3

Peachstate Health Management, LLCAeon Global Health

2225 Centennial Drive. Gainesville, GA 30504Phone: (678) 276-8412 • Fax: (678) 9714830

Email: [email protected]: Dr. Richard E. Mullins, Ph.D., D.A.B.C.C.

PATIENT INFORMATION

Name: Accession Number: 1245628479Date of Birth: Client:

Gender:

DOE, JANE 04/18/1956

Female Ordering Physician: JOHN SMITH MD

Date Received: 04/14/2016 Date Accessioned: 04/14/2016

Date Collected: 04/14/2016 Date Reported: 04/19/2016

Review Status Final

TEST PERFORMED

BreastDetect Targeted next-generation sequencing was performed on this specimen. See under Test Details for moreinformation.

RESULT SUMMARY

Variants Detected ClassificationBRCA1p.E143* Pathogenic

TP53p.P33Rp.P72R

Variant of Uncertain Significance

NBNp.E103Qp.E185Q

Variant of Uncertain Significance

CLINICALLY RELEVANT RESULTS

BRCA1p.E143*Pathogenic

Interpretation: A nonsense mutation in BRCA1, p.E143*, was detected in a heterozygous state. This mutation is predicted to result in a non-functional BRCA1 protein product due to the introduction of a premature termination codon. This specific mutation has been previously reported in the medical literature and clinical databases and is considered pathogenic in nature. The BRCA1 p.E143* alteration is reported as a founder mutation within the Irish population and has also been documented in individuals of European descent (Janaviius R;Founder BRCA1/2 mutations in the Europe: implications for hereditary breast-ovarian cancer prevention and control.; EPMA J; 2010 Sep;1(3):397-412);(McVeigh TP, et al.; Familial breast cancer genetic testing in the West of Ireland.; Ir J Med Sci; 2014 Jun;183(2):199-206). Germline BRCA1 alterations are associated with Hereditary Breast and Ovarian Cancer syndrome, an autosomal dominant condition in which mutation carriers are at increased risk to develop cancers of the breast, ovary, pancreas and prostate, among others. (Foulkes WD; BRCA1 and BRCA2 - update and implications on the genetics of breast cancer: a clinical perspective.; Clin Genet; 2014 Jan;85(1):1-4).

DOE, JANE Accession #: 1245628479


TEST DETAILS

BreastDetect: Targeted next-generation sequencing was performed on this specimen.

BreastDetect: , , , , , , , , , , , , and ATM BRCA1 BRCA2 BRIP1 CDH1 CHEK2 MUTYH NBN NF1 PALB2 PTEN RAD51C RAD51D TP53were subjected to targeted next generation sequencing analysis.

Database Details: The version/release/build/date of the following databases were used to generate this report.

Genomic Build: GRCh37.p13Genomic Anotation Sources: NCBI RefSeq v105ExAC: v0.3dbSNP: 141ClinVar: 20150603NHLBI ESP: v.0.0.30dbNSFP: 3.0b2c

Coding Exon Coverage Metrics: 10x coverage for >90% of positions was not achieved for some targeted exons. If interested in viewingthese regions, please consult with a certified genetic counselor.

METHODOLOGY

Experimental Methodology: This test uses targeted next-generation sequencing (NGS) to analyze coding regions of the most inclusiveannotated RefSeq transcript for each of the targeted genes. Target exome enrichment was performed using probe based targeted captureusing Agilent HaloPlex HS Custom Panel. Sequencing of enriched libraries was performed in multiplex on the Illumina MiSeq.

Informatics Methodology: There are four informatics tools used and relevant parameters used for each tool are detailed as follows:

1. Trim GaloreVersion 0.4.0 (uses Cutadapt Version 1.8)Parameters: --path_to_cutadapt (path to Cutadapt) -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -a2AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT --paired --clip_R1 5 --clip_R2 5--three_prime_clip_R1 5 --three_prime_clip_R2 52. NovoalignVersion 3.02.07Parameters: -o SAM -r none --softclip 9999 -l 30 -e 100 -i 230 140 -t 300 -H3. samtoolsVersion 0.1.19Parameters: -B -d 1000000'

Version v0.9.21-19-gc003c1e4. FreebayesParameters: --use-duplicate-reads --min-alternate-count 10 --min-alternate-fraction 0.20 --min-coverage 10 --min-base-quality 20--min-mapping-quality 30 --min-supporting-allele-qsum 20 --min-supporting-mapping-qsum 30 --min-alternate-qsum 40--use-mapping-quality

Novoalign is an alignment tool. Freebayes is a variant caller used to identify substitutions, insertions, and deletions.

Note that it is possible that pathogenic variants may not be reported by one or more of the tools because of the parameters used. However,tool parameters were optimized to maximize specificity and sensitivity.

DOE, JANE Accession #: 1245628479


DISCLAIMER

This Report was generated using the materials and methods described above. Such materials and methods required the use of various reagents, protocols, instruments, software, databases, and other items, some of which were provided or made accessible to Aeon Global Health (“AEON”) by third parties. A defect or malfunction in any such reagents, protocols, instruments, software, databases, and/or other items may compromise the quality or accuracy of the Report.

The Report is based on, or incorporates by mention thereto, various scientific manuscripts, references, and other sources of information. Such may include without limitation manuscripts, references, and other sources of information that were prepared by third parties describing correlations between certain genetic mutations and particular diseases (and/or certain therapeutics that may be useful in ameliorating the effects of such diseases). Such information and correlations are subject to change over time in response to future scientific and medical findings. AEON makes no representation or warranty of any kind, expressed or implied, regarding the accuracy of the information contained in such manuscripts, references, and other sources of information. If any of the information provided by or contained in such manuscripts, references, and other sources is later determined to be inaccurate, the accuracy and quality of the Report may be adversely impacted. AEON is not obligated to notify you of any impact that future scientific or medical research findings may have on the Report.

The Report must always be interpreted and considered within the clinical context, and a physician should always consider the Report along with all other pertinent information and data that a physician would prudently consider prior to providing a diagnosis to a patient or developing and implementing a plan of care for a patient. The Report should never be considered or relied upon alone in making any diagnosis or prognosis. The manifestation of many diseases are caused by more than one gene variant, a single gene variant may be relevant to more than one disease, and certain relevant gene variants may not have been considered in the Report. In addition, many diseases are caused or influenced by modifier genes, epigenetic factors, environmental factors, and other variables that are not addressed by the Report (or that are otherwise unknown). As such, the relevance of the Report should be interpreted in the context of a patient's clinical manifestations. The Report provided by AEON is provided on an "AS IS" basis. AEON makes no representation or warranty of any kind, expressed or implied, regarding the Report. In no event shall AEON be liable for any actual damages, indirect damages, and/or special or consequential damages arising out of or in any way connected with the Report, your use of the Report, your reliance on the Report, or any defect or inaccurate information included within the Report.

Medical knowledge annotation is constantly updated and reflects the current knowledge at the time.

The test performance characteristics were determined by the Pierian DX. The Report was generated by Pierian DX as required by the CLIA 1988 regulations. The Report, and the tests used to generate the Report, have not been cleared or approved by the U.S. Food and Drug Administration (FDA). The FDA has determined that such clearance or approval is not necessary. The test results have been shown to be clinically useful. This laboratory is CLIA certified to perform high complexity testing.

Approved and verified by Aeon Global Health certified genetic counselors. Questions regarding results should be sent to [email protected] or can be addressed at (678) 276-8412.

Report Electronically reviewed and signed out by:

Jessica Pack, MS, CGC

Date Reported: 04/19/2016

Contact Information 2225 Centennial Drive Gainesville, GA 30504

��e� Se�vice�ain: �.888.661.0225

�a�: ��.��.��E-mail: [email protected]

Shipping and ReceivingE-mail: [email protected]

aeonglobalhealth.com

Cancer Genomics Practice and Procedure HandbookHave patient or collector fill out patient...

Documents

Transcript of Cancer Genomics Practice and Procedure HandbookHave patient or collector fill out patient...