Caccia al gene della Fibrosi Cistica - unimi.it Scheda: la Fibrosi Cistica (CF) La...

download Caccia al gene della Fibrosi Cistica - unimi.it Scheda: la Fibrosi Cistica (CF) La ¯¬¾brosi cistica

If you can't read please download the document

  • date post

    02-Oct-2020
  • Category

    Documents

  • view

    0
  • download

    0

Embed Size (px)

Transcript of Caccia al gene della Fibrosi Cistica - unimi.it Scheda: la Fibrosi Cistica (CF) La...

  • 1

    Caccia al gene della Fibrosi Cistica

    Scenario e simulazione di consulenza genetica

    Siete un genetista medico e lavorate in un consultorio genetico. Si presenta da voi una coppia che richiede consulenza genetica. In base al racconto della storia familiare, costruite il pedigree della famiglia e impostate l’analisi del DNA da richiedere al laboratorio per rispondere alle domande poste dalla coppia.

    In consultorio si presenta una giovane coppia (Davide e Sofia). Hanno 2 figli, Pietro di 6 anni sano, e Maria, di 4 anni, che soffre spesso di tosse, raffreddore e infezioni polmonari. Sofia racconta che una sua sorella maggiore è morta giovane di fibrosi cistica (FC), mentre nella famiglia di Davide non ci sono casi di malattia. Sofia è in attesa di un terzo figlio (è alla fine della sesta settimana di gravidanza) e vorrebbe informazioni sul rischio di avere un figlio affettto da FC. Viene suggerito alla coppia di sottoporre Maria al test del sudore per stabilire il livello di ioni Na+ e Cl-, un test semplice di valore diagnostico per la FC, e di ritornare con i risultati delle analisi.

    Con i dati a vostra disposizione in questo momento costruite l’albero genealogico di questa famiglia e rispondete alle seguenti domande:

    !

    Il test del sudore conferma la diagnosi di fibrosi cistica (livello di Na+ di 87 nmol/l, molto superiore al valore normale di 60 nmol/l). In base a questa nuova informazione, rispondete nuovamente alle domande:

    !

    La FC è sempre causata da mutazioni del gene CFTR sul cromosoma 7. La malattia è recessiva e quindi se Maria è malata, devono essere mutate entrambe le copie del suo gene CFTR. NB: Le due mutazioni possono essere uguali o diverse. A questo punto il genetista suggerisce di accertare, mediante analisi del DNA, quali sono le mutazioni presenti in Maria e nei suoi genitori. Sofia deve inoltre sottoporsi ad

    • quale è il rischio che Sofia sia portatrice di FC? • quale è il rischio che Davide sia portatore di FC? • quale è il rischio che il nascituro sia affetto da FC? • che probabilità ha il nascituro di essere sano? Di essere portatore?

    • quale è il rischio che Sofia sia portatrice di FC? • quale è il rischio che Davide sia portatore di FC? • quale è il rischio che il nascituro sia affetto da FC? • che probabilità ha il nascituro di essere sano? Di essere portatore?

  • 2

    amniocentesi, per determinare, attraverso l’analisi del DNA, il genotipo del nascituro.

    In prima battuta, per la diagnosi genetica di fibrosi cistica si usano le tecniche che ricercano le mutazioni più frequenti del gene CFTR (vedi tabella). Soluzioni di DNA, estratto dalle cellule del paziente, sono messe su un filtro in punti definiti (dots) e, una volta denaturate, sono ibridizzate con sonde specifiche per le mutazioni frequenti, opportunamente marcate. Dopo lavaggio, per eliminare la sonda in eccesso non legata,

    si procede alla rilevazione per identificare quale delle sonde si è ibridata con il DNA in esame.

    Risultati del Dot Blot. I tre campioni di DNA (dei genitori e di Maria) ibridano con la stessa sonda; Il DNA dei genitori ibrida anche con la sonda di controllo (gene wild type); Il DNA di Maria non ibrida con la sonda di controllo;

    Il DNA del feto (ottenuto in seguito ad amniocentesi) ibrida con una sonda specifica (la stessa dei genitori e di Maria) e con la sonda di controllo.

    !

    Tab.1 Mutazioni più frequenti nel gene CFTR; p e c indicano rispettivamente che la mutazione è descritta nella proteina o nel cDNA; > significa “cambia in”, X significa un codone di stop; +1 significa che è coinvolto il primo nucleotide dell’introne successivo all’esone che termina con il nucleotide indicato dal numero che precede il segno +.

    • Quale è il genotipo dei genitori? • Quale è il genotipo di Maria? • Quale è il genotipo del feto?

  • 3

    Scheda: la Fibrosi Cistica (CF) La fibrosi cistica è una malattia ereditaria, autosomica recessiva che interessa molteplici funzioni, dalla respirazione, alla funzione digestiva, a quella riproduttiva; interessa sia maschi che femmine ed è caratterizzata da un’anomala regolazione del trasporto degli elettroliti da parte degli epiteli e quindi da una conseguente alterazione della secrezione delle ghiandole esocrine. È la malattia ereditaria più comune nella popolazione caucasica di razza bianca con una incidenza di circa 1/2500-3500 individui. La frequenza dell’eterozigote è di 1/25-30. È causata da mutazioni nel gene che codifica per una proteina chiamata: cystic fibrosis transmembrane regulator (CFTR), che regola la secrezione di cloro, sodio, bicarbonato nei tessuti epiteliali (spesso nella fibrosi cistica si ha la completa perdita di funzione del canale del cloro che causa la presenza di secrezioni disidratate). Questo porta alla presenza di muco denso nei bronchi, all’ispessimento del succo pancreatico e ai caratteristici elevati livelli di cloro nel sudore.

    Il gene si trova sul cromosoma 7, nella posizione 7q31.2, è molto grande costituito da 27 esoni sparsi su 1888 kb del cromosoma 7 (Fig2). Le mutazioni che causano la fibrosi cistica sono più di 1000 e possono trovarsi in qualunque punto del gene; tutte le mutazioni sono cambiamenti di un singolo nucleotide o di un piccolo numero di nucleotidi adiacenti.

    Sebbene nei pazienti affetti da fibrosi cistica siano state descritte più di 1000 mutazioni nel gene CFTR, il numero delle mutazioni più comuni e diffuso nella popolazione è piuttosto basso. La mutazione p.F508del è la più comune nella popolazione nordeuropea e costituisce il 70/80% di tutte le mutazioni della fibrosi cistica in molte popolazioni. Come abbiamo detto, la malattia è autosomica recessiva e quindi un soggetto malato ha entrambe le copie del suo gene CFTR mutate. Le due mutazioni possono essere uguali o diverse.

    Le diverse mutazioni descritte nel gene CFTR provocano effetti diversi sul funzionamento della proteina. Alcune

    Fig.1. Il gene della CF; la proteina CFTR è localizzata nella membrana plasmatica della cellula e regola il movimento degli ioni cloro tra I due lati della membrana. Nella maggior parte dei casi di CF la proteina è priva della regione 1 di legame.

    Fig. 2. Posizione del gene CFTR sul cromosoma 7. Nucleotidi e amminoacidi coinvolti nella mutazione ΔF508 (F508 del)

  • 4

    bloccano prematuramente la sintesi della proteina, altre influiscono sul suo processamento, sulla regolazione o la funzionalità (Fig. 4). Per questo motivo, gli effetti della mutazione possono essere di gravità diversa. Sono allo studio strategie per modificare o attenuare gli effetti delle mutazioni più frequenti (dalle terapie più convenzionali alla terapia genica).

    Fig. 3. Gli apparati corporei colpiti dalla CF. In tutti gli individui colpiti, le ghiandole sudoripare producono un eccesso di sale. Il muco inspessito blocca il trasporto degli enzimi digestivi nel pancreas e il pancreas lentamente si distrugge. Il muco denso e vischioso congestiona i condotti respiratori rendendo difficile la respirazione. Nei maschi il muco blocca i dotti che portano lo sperma e solo il 2-3% dei maschi colpiti è fertile.

    Fig. 4. Alcune mutazioni e i loro effetti sulla funzionalità della proteina CFTR.

  • 5

    Identificazione della mutazione presente nella famiglia in esame

    Sequenza della sonda che ibrida con il DNA dei membri della famiglia esaminati:

    5’- CACCATTAAAGAAAATATCATCGGTGTTTCCTATGATGA -3’

    Iniziate la vostra ricerca al sito del National Center for Biotechnology Information (NCBI) http://www.ncbi.nlm.nih.gov/ Nella home page del sito della NCBI scegliete la voce BLAST (sulla barra verticale nella parte destra della pagina).

    BLAST (Basic Local Alignment Search Tool) è un programma euristico per la ricerca di omologie locali di sequenza, dove con euristica si intende “ogni principio o espediente che contribuisca a ridurre la quantità di ricerca media necessaria per la soluzione di un problema”. Il software BLAST in realtà è composto da diversi algoritmi che consentono di allineare non solo sequenze nucleotidiche con sequenze nucleotidiche, ma anche sequenze proteiche fra di loro, sequenze nucleotidiche con sequenze proteiche e viceversa, ovviamente utilizzando le regole del codice genetico per passare dalle sequenze nucleotidiche a quelle aminoacidiche.

    Nella pagina seguente, fra le opzioni Basic Blast, scegliete nucleotide blast.

    http://www.ncbi.nlm.nih.gov/ http://www.ncbi.nlm.nih.gov/

  • 6

    Vi apparirà una schermata con un campo vuoto (search) dove è possibile “incollare” la sequenza che si intende confrontare con la banca dati. Incollate nel campo “search” la sequenza della sonda che vi è stata data.

    In ”Choose search set, scegliete il Database “Human genomic + transcript”, per cercare un a l l ineamento so lo con le sequenze depositate umane. In molti casi potreste preferire il Database “Others” e le sequenze non ridondanti (nr) di tutti gli organismi; in realtà questa è solo una definizione “storica” in q u a n t o o g g i m o l t e d e l l e informazioni contenute nei Database sono ridondanti. Ognuna delle voci sottolineate è un hyperlink che vi rimanda ad

    una breve definizione del campo in questione. Potete quindi ottenere ulteriori spiegazioni cliccando le varie voci. Per semplicità utilizziamo un’analisi standard senza utilizzare le opzioni di ricerca avanzate. Una volta incollata la vostra sequenza, cliccate sul tasto “BL