BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf ·...
Transcript of BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf ·...
![Page 1: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/1.jpg)
TitleMECHANISMS OF PHAGE INACTIVATION AND DNASTRAND SCISSION BY MITOMYCIN C( Dissertation_全文)
Author(s) Ueda, Kazumitsu
Citation Kyoto University (京都大学)
Issue Date 1984-03-23
URL https://doi.org/10.14989/doctor.r5265
Right
Type Thesis or Dissertation
Textversion author
Kyoto University
![Page 2: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/2.jpg)
illlllllll
E.:. JiÅq 5{t eq
MECHANISMS OF PHAGE INACTIVATION
AND DNA STRAND SCISSION
BY MITOMYCIN C
KAZUMITSU UEDA
19-84
![Page 3: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/3.jpg)
MECHANISMS OF PHAGE INACTIVATION
AND DNA STRAND SCISSION
BY MITOMYCIN C
KAZUMITSU UEDA
1984
![Page 4: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/4.jpg)
To my family and to Etsuko
![Page 5: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/5.jpg)
ACKNOWLED(l;EIY[ENT
The author wishes to express his sincere thanks to Professor
Tohru Komano, Kyoto university, for his kind guidance and
continuous encouragement through the course of this study.
The author wishes to express his grateful acknowledgement to
Dr. Junji Morita, Doshisha Women's College of Liberal Arts, for
his valuable suggestion and discussion.
The author is grateful to Mr. Kazuhiro Yamashita for his
important contributions to this study. Th6 author is also
grateful to Mr. Kouichi Kadowaki for his kind technical assistance
and helpful suggestion.
Acknowledgement is made to Drs. Michio Himeno, Kanji Ohyama,
Hiroshi Sakai, Isao Saito and Mr. Hiroshi Sugiyama for their
valuable suggestion and discussion.
Finally, thanks are due to the members of the Laboratory of
Biochemistry, Department of Agricultural Chemistry, Kyoto
University for their helpful suggestion and discussion.
![Page 6: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/6.jpg)
ABBREiVIA[rlONS
AET
ccc
DABCODE[I]APAC
EDTA
m.o.i.
oc
P.f.u.
RF
ss
Tris
2-aminoethylisothiuronium bromide HBr
covalently closed circular
l,4-diazabicyclo[2,2,2]octane
diethylenetriaminepentaacetic acid
ethylenediaminetetraacetic acid
multiplicity of infection
open circular
plaque-forming unit
replicative form
single---stranded
Tris(hydroxymethyl)aminomethane
![Page 7: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/7.jpg)
CONTENTS
IN[['RODUCTION
CHAPTER I Inactivation of Bacteriophage diX174
by Chemically Reduced Mitomycin C
CHAPTER II Induction of Strand Scission in Single-
and Double-Stranded DNAs by Mttomycin C
CHAPTER III Phage Inactivation and DNA Strand Scission
Activities of Mitomycin Derivatives
CHAPTER IV Sequence Specificity of Heat-Labile Sites in DNA Induced by Mitomycih C
SUMMARY
REFERENCES
LIST OF PUBLICATIONS
1
4
--- 21
--- 32
47
66
71
77
![Page 8: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/8.jpg)
INTRODUCTION
Mitomycin C is an anticarclnogenic antibiotic that has
demonstrated activity against a number of human malignancies.
rvlitomycin C is isolated from RSJi!s}]2!igg!zgslEt t caes itosus as blue
violdt crystals by Wakaki et al. in 1958 (1). Mitomycin C has an
unique structure which has three biolpgtcally active moieties,
e.g. the aziridine ring, carbamate and aminoquinone moieties, in a
small configuration (2)(Fig. 1). The structure suggests that the
main target in the cell is DNA. It actually inhibits cellular DNA
synthesis selectively (3). Mitomycin C interacts directly with
DNA by binding covalently to the i.ndividual strands (monofunctional
binding)(4), as well as forming covalent cross-links between the
complementary strands (5,6). 'These DNA.modifications, in which
the former is .predominant to 10 to 2Q-fold over the latter (4),
are believed to be.essential for the cytotoxicit,y of mitomycin C
r"IitornycinCmust be activated O -Oprior to alkylate DNA.- It was NH2 II .CH20CNH2
clearly indicated by the in vitro CH3observation. The interaction of omitomycin C with DNA can be observed Fig. 1'. Structure ofin vitro only when a reductive mitomycin Cacttvation agent is added in situ,
such as NADPH-dependent bacterial lysates (6), some chemical
reducing agents (6,11), or rat liver microsomal preparations (12).
These results indicate that mitomycin C is converted to an active
form also in vivo by reductive metabolism.to interact with DNA.
The scheme of the reductive activation of mitomycin C is shown in
Fig. 2. The reductive activation produces the hydroquinone which
readily loses methanol to give "acttve form" of the antibiotic
(6). Iyer and Szybalski (6) suggested that the Cl position is the
most probable reactive site, thus is the first alkylating center
-1-
![Page 9: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/9.jpg)
H,N CH2ocNH2. H,N - CH2QCNH, H2N - CH2 DNAcH3 o NJ9fiIIHI 'Ei":bill"O" cH3 NoH N NH--'cH3 NoH N '"
NH2
Fig. 2. Reductive adtivatlon of mitomycin C. ' (indicated by the arrow 1 on Fig. 2). They also predicted the
activation of a second alkylating center at the CIO position
(arrow 2, Fig. 2), and the possibility of a third reactive site at
the C7 position (arrow 3, Fig. 2). The binding sites of mitomycin
C Å}n DNA are the O-6 posÅ}tion or the 2-amino group of guanÅ}ne
residues or the 6-amino group of adenine resÅ}dues (12,13).
However the adducts in which mitomycin C binds bifunctionally to'
DNA have not been isolated. The detai!s of the interaction of
mitomycin C with DNA have yet to be elucidated.
Mitomyctn C contains quÅ}none moiety besides aziridine and
carbamate. Reduction of mitomycin C, by chemical or enzymatic
methods, followed by exposure to air results in the generation of
superoxide anion and hydrogen peroxide (14,15). Oxygen radicals
were generated not only by free mitomycin C but also by mitomycin
C irreversibly bound to DNA (15). Oxygen radicals are well known
to be toxic for nucleic acids (16,!7). Lown et al. (18) reported
that chemically reduced mitomycin C Å}nduces strand scission in
phage PM2 double-stranded DNA. The DNA strand scission is considerea to involve the oxygen radicals. DNA cleavage via
mechanism involvtng oxygen radicals are reported for some anti-
tumor antibiotics such as bleomycin (19,20), streptonigrin (21,22)
and anthracycline antibiotics (23).
The author has intended to clarify the mechanism of action
of mitomycin C against DNA on the basis of biochemical and
-2-
![Page 10: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/10.jpg)
molecular biological methods using bacteriophages and their DNAs
as follows.
CHAPTER I; Mitomycin C, chemÅ}cally reduced in situ,inactivates bacteriophage ofX174 which was considered to beresistant to mitomycin C. The target molecule of mitomycin C isDNA.
CHAPTER II; Reduced mitomycin C induces single strandscissÅ}on in single-st-randed and double-stranded DNAs. The DNAstrand scission is considered to involve oxygen radicals.
CHAPTER III; Studies on the activities of mitomycinderivatives suggest that the Cl position of mitomycin C is the
alkylating center, and that the DNA strand scission activity ofmitomycins is possibly related to their antitumor activity.
CHAPTER IV; The sequence specificity of mitomycin C-DNAinteraction was directly determined by using DNA sequencingtechnique, and by using 3L or 5Lend labeled DNA fragments ofdefined sequence as substrates. Oxygen radicals such as sÅ}nglet
oxygen and hydroxyl radical are possibly involved in the actionof mitomycin C.
-3-
![Page 11: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/11.jpg)
CHAPTER I Inactivation of Bacteriophage 6X174 by Chemically Reduced Mitomycin c a,b)
Mitomycin C alkylates DNA monofunctionally and crosslinks
bifunctionally between the complementary strands of DNA, upon
activatlon by chemical or enzymatic methods (4,5,6). Its
cytotoxicity has been therefore supposed to be due to alkylation,
cross-linking and the succeeding degradatton of DNA (24).
Degradation of DNA by mitomycin C has been considered to be due
largely to the activation of intyacellular deoxyribonucleases
(24). Although aetivated (reduced) mitomycin C inactivates some
free extracellular viruses and •phages by cross--1,inking their DNA
(4,25), infectivitles of bacteriophage 6Xl74, its single-stranded
DNA and replicative form, of DNA are not affected by mthotmyicn C or
the reduced form of.mitomycin C (26). It is considered t,hat 6X174
sing-le-stranded DNA is too small to be alkylated or crosslinked by
mitomycin C (26). , • As mitomycin C contains quinone moiety, upon reduction of
the quinone and subsequent autoxidation of the reduced quinone,
oxygen radicals can posslbly be generated (14,15). Oxygen radicals
are reported to be toxic for nucle,ic acids (16,17), and the
inactivation of phage including 6X174 by ascorbic acid (27,28) or
some sugar phosphates (29) is caused by a process involving oxygen
radicals. In this chapter the author describes that dX174 is inacti-
vated when the phage is incubated with mitomycin C in the presence
of both sodium hydrosulfite (Na2S204) and cupric ion, or in the
presence of sodium borohydride (NaBH4). The inactivation of 6Xl74
is caused via DNA strand scission in the 6X174 virion by oxygen
radicals or mitomycin C semiquinone radical generated during .autoxidation of reduced mitomycin C.
-4-
![Page 12: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/12.jpg)
MATERIALS AND METHODS
/Dhag26 and Bactez-La phage diX174 and 14C-labeled diX174 am3 were prepared as
reported previously (30,31). Specific radioactivity of purified14c-labeled dixl74 am3 was about 4 Å~ 10-5 cpm/particle. diX174
single-stranded DNA was extracted from dX174 particles by the hot
phenol method (32). Escherichia coli CN was used as the indicator
bacteria 'for 6X174 and E.coli HF4714 for 6X174 am3. m 'C/}enz-LcaZ6
Mitomycin C was kindly supplied by Kyowa Hakko Co. Ltd.,
Tokyo, Japan. Superoxide dismutase (EC 1.15.1.1, bovine blood,
2900 Ulmg protein) and catalase (EC 1.11.1.6, bovine liver, 2500
U/mg protein) were purchased from Sigma Chemical Co. Other
chemicals were obtained from 'Nakarai Chemicals Co.
'
BaJlea SoZaLLon6
All buffer solutions were prepared with redistilled water to
minimize the effect of trace metals. ' '.[nacLLvaiSZon o7e 10hage /DaiLticZ26 ey R?Lt;iSonzycZn C
Purified phage diX174 was diluted in 50 mM Tris-HCI buffer (pH8.1) to 2 Å~ 108 plaque forming units (p.f.u.)/ml. The concent-
rated CuC12•2H20 solution (cupric ion solution) and the sodium
hydroSulfite (Na2S204) solution were freshly prepared with cold
redistilled water, and the concentrated mitomycin C solution withcold 50 mM Tris-HCI buffer (pH' 8.1) prior to each experiment. An
amount of O.1 ml of each cuprtc ion, sodium hydrosulftte, and
mitomycin C solutions and O.1 ml of the phage suspension were
mixed, and the total volume of reaction mixture was adjusted to 1
ml with 50 mM Tris-HCI buffer (pH 8.1). Zero time of incubation
-5-
![Page 13: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/13.jpg)
corresponded to the time of addition of the phage suspensÅ}on to
the reaction mixture as the last component. The reaction was
carried out for 120 min at 370C with gentle shaking. The reaction
was stopped by dilution with ice-cold 50 mM Tris-HCI buffer and
the survival of phage was assayed by the double agar layer
technique (33).
7it2abn2nt ofe 6X174 D/VA toth M;Ltomyofn C 14c-labeled dix174 DNA (equivalent to 4 Å~ 109 p.f.u.) was
incubated with 150,pM rnitomycin C in the presence of O.57 mM
sodium hydrosulfite and O.1 mM cupric ion for 120 min at 370C with
gentle shaking in 1.0 ml of 50 mM Tris-HCi buffer (pH 8.l). The
reaction was stopped by addition of 10 mrvl EDTA.
7wn6kction A66ay and AduoaRtton Stuctle6 The method of transfection assay was described earlier (30,32).Adsorption of l4C-labeled diX174 treated with mitomycin C in the
presence of sodium hydrosulfite and cupric ion to the host cells was
assayed essentially as descrÅ}bed by Nefribold and Sinsheimer (34).
IVeuthaZ Sucno6e Den6tty guaaet2rt2S im7eagation o,e 14C-Zae2Z2d
6X l 7 4 /Daizti c-ee6
The reaction mixture (O.25 ml) was layered on a 5-207o linear
neutral sucrose gradient (4.4 ml) in 50 mM Tris-HCI buffer (pH
7.5) containing O.5 M NaCl and 3 mTvl EDTA. The gradients were
centrifuged in a Hitachi RPS40T-2 rotor at 27,500 rev.lmin for 2.5
h at 40C. After fractionation, the radioactivity was assayed
using Triton X-IOO-toluene scintillation fluid in a Beckman liquid
scintillation counter.
-6-
![Page 14: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/14.jpg)
AZkaZine Sucno62 Den6-tRSy Siitadl2nt C2nbLZ7eugaUon o,e 14C-Za!leZ2d
6X174 DIVA 6X174 DNA extracted from 14C-labeled phage particles treated
with mitomycin C or 14C-labeled diX174 DNA which was directly
treated with mitomycin C was layered on a 5-20% linear alkaline
sucrose gradient containing O.5 .M NaOH, 3 mM EDTA, O.5 M NaCl and
O.1% N-lauroyl sarcosine sodium salt. The gradients were
centrifuged in a Hitachi RPS40T-2 rotor at 38,OOO rev.lmin for 7 h
at 40C. After fractionatton, the radioactivity was assayed as
described above.
/V2uiEnaZ Sueno62 Dan6Zty 9iLaaet2nt Cetvbz.t)eugation ol 74C-ZcztZeZed
' '6,)(174 DA!A
14C-labeled diX174 DNA which was directly treated with 'mitomycin C was layered on a 5-20% linear' neutral sucrose gradient
in 50 mM TrisTHCI, buffer (pH 7.5) containing O.5 M NaCl and 3 mTyl
EDTA. The gradients were centrifuged in a Hitaehi RPS40T-2 rotorat 38,OOO rev.lmin for 5 h at 40' C. After fractionation, the
radioactivity was assayed as descrÅ}bed above.
' ' RESULTS
lnacLtvcztion o7e /Dhag2 6?(174 Zy MzZomyofn C in the /O/Le6ence oJ
SocLtum /ly(lizo6uZ tt2 and CuRizxtc lon
Figure I-1 represents that diX174 was not affected by mitomycin
C or mitomycin C reduced with sodium hydrosulfite. As a promotive
effect of cupric ion is commonly observed in the phage inactivation
by oxygen radical-generating agents (27,28,29), The effect of cupric
ion on the reaction between 6X174 and mitomycin C was examined.
The infectivity decreased when the phage was incubated with
mttomycin C in the presence of sodium hydrosulfite and cupric ion.
The rate of inactivation was proportiona! to the concentration of
-7-
![Page 15: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/15.jpg)
g..e
..O.-
E
i.z
l=
ut
100
IO
1
O.l
O.Ol
O 30 60 90 I20 Time (min)
Fig. I-1. Inactivation of phage diX174 by mitomycin C in tfiepresence of sodium hydrosulfite and cupric ion. 6X174 (2 Å~ 107p.f.u./ml) was incubated with mitomycin C in 50 mM Tris-HCI bufferge",9'3,).Cft",ta,i'.".i,n,g.Og5,7.,M..X,.SO.d,Z'.".M..hi,d.r.O,S.].i.fi6t,e.a..n,d..O,'.i.MM,,C".CLIz,.,
zero; e e, 1.5 pM; A A, 15 pM; - -, O.15 mM;A A, O.75mM;V v, 1 mM. n Mrepresents drugLfree control and other fivereaction mixtures which contain O.1 mM CuC12 alone, O.57 mM sodiumhydrosulfite alone, O.15 mrvl mitomycin C alone, both mitomycin Cand CuC12, or both mitomycin C and sodium hydrosulfite, respectively.
mitomycin C and the length of incubation time. Cupric ion or
sodium hydrosulfite, itself, did not affect the infectivity of6X174 at the concentration used. Incubated with cupric ion and
sodidm hydrosulfite without mitomycin C, only a part of phage
particle was inactivated. These results indicate that both
reduction of mitomycin C and addition of cupric ion are essential
for'inactivation of 6X174.
EfeZect o7e /2eduofng Agent6 on lnactZvation ey M.cLtonzycZn C
The degree of inactivation of 6X174 by 150 pM mitomycin C
-8-
![Page 16: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/16.jpg)
loo x'{r=== pF 5: ::I: ;
- ."s s V 10 g
A .z .År 1 di
O.1 lo'5 la4 la3 Conc, of reducing agent (M)
:l.%.}-.i.h,Effe,c,t,,o,f,r,ed.uclsggp,e.n.t.zo:,g:ggei.'2a.c,t.l'ga,ti.'o..n,,by,.,,
mM mitomycin C in the presence of O.l mM CuC12 and the indicated ,concentration of sodium hydrosulfite (e e) or sodium borohydridee -) in 50 mM Tris.-HCI buffer (pH 8.1) at 370C for2h. Opensymbols, mitomycin C free. X--X shows the effect of sodiumbisulfite on the infectivity of 6X174 in the presence of O.1 mMcuC12.
increased with increasing the concentration of reducing agents in 'the presence of cupric ion at a concentration of O.1 mM (Fig. I-
2). However mitomycin C reduced with sodium borohydride did not
so effectively inactivate phage even in the presence of cupric ion
as mitomycin C reduced with sodium hydrosulfite did in the
presence of cupn'c ion. NADH and reducing agents containing thiol
group such as L--cysteine, 2-mercaptoethanol, glutathione, and
dithiothreitol were not also good substitutes for sodium hydro-
sulfitg in phage lnactivation reaction (data not shown).
It Å}s known that sodium bisulfite is a reagent to induce DNA
cleavage. This DNA cleava.ge is caused by sulfite anion radical
and oxygen radicals which are generated during autoxidation (35,36).
Sodium bisulfite can be generated as the intermediary of the
reduction and oxidation reaction of mitomycin C in our experiment.
But sodium bisulfite at the concentration below 1 mM did not
-9-
![Page 17: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/17.jpg)
100
:•
eR'X-
eg.o 50
a6.9
-e
:g's os
U).
N-:XiiKi
Å~ e -N-
Ol 10 100 Concentration ot mitomycin C(JiM)
R'gljE-.36.',hhZ,2Ctas"749fMfikt.O,M.YCth7C4r(e2d".CeSo7Wi.hf.:?lio"oMBOigO"..
reacted with the indicated concentration of mitomycin C in thepresence of O.5 mM sodium borohydride in 50 mlvl Tris-HCI buffer(e e pH 7.1; o---o, pH 8.1) at 370C for 60 min.
affect the infectivity of phage in the presence of cupric ion
(Fig. I-2). Furthermore mitomycin C-induced dX174 inactivation is
different from bisulfite-induced DNA inactivation in the pH depen-
dence and the degree of inhibition by catalae (37) as shown later.
Effect of bisulfite to the phage inactivation can be neglected in
our expenment. Among chemical reducing agents, sodium borohydride, sodium
hydrosulfite and hydrogen at atmospheric pressure in the presence
of palladium catalyst tire reported to activate mitomycin C in
buffered solutions (4,18). The author reinvestigated the action ofmitomycin C reduced with sodium borohydride on phage diX174 and
found that sodium borohydride is effective as a reducing agent in
the reaction of mitomycin C with phage diX174 at pH 7.1, although
it is ineffective at pH 8.l (Fig. I-3). The infectivity of 6X174
decreased in proportion to the concentration of mitomycin C above
10 pM at pH 7.1, but it was scarcely affected even by 500 pM
-1O-
![Page 18: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/18.jpg)
100
10
.o.i L
l 8
io-e io-7 lo-6 lo+5 io-` lo-3 4 s 6 7 8 9 10 Conc. of CuCE2 (M) pHFig. I-4. Effect of cupric ion on phage inactivation by mitomycinC. 6X174 was incubated with O.15 mM mitomycin C in 50 mM Tris-HCIbuffer (pH 8.1) containing O.57 mM sodium hydrosulfite and theindicated concentration of CuC12 at 370C for 2 h (e e).O O, mitomycin C free.
Fig. I-5. Effect of pH on phage inactivation by mitomycin C.6X174 was incubated with O.15 mM mitomycin C, O.57 mM sodiumhydrosulfite and O.1 mM CuC12 in glycine-NaOH buffer (- 1), ris-HCI buffer (e e),50 mM T (o 50 mM buffer Tris-malate-NaOHO.l M sodium phosphate buffer (A A) or O.2 M sodium acetate-acetate buffer (A A) at 370C for 60 min.
o),
mitomycin C reduced with sodium borohydride at pH 8.1. No addi-
tiOnal cupric ion was needed in the reaction of mitomycin C
reduced with sodium borohydride.
EJkcZ o7e Cul?iz.tc lon and ED7A on fnaeUvaUon IZy R71tonzyofn C
As shown in Fig. I-1, cupric ion is essential for diX174
inactivation by reduced mitomycin C. The inactivation of 6X174
was dependent on the concentration of cupric ion below 50 pM, when
150 pM mitomycin C was reduced with O.57 mM sodium hydrosulfite
(Fig. I-4). At the concentration above 50 pM, no further stimula-
-11-
![Page 19: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/19.jpg)
tion, but a little inhibition,by cupric ion was observed. The
optimum concentration of cupric ion in this condition was observed
to be 50 pM to 100 plvl. Although diX174 was slightly inactivated
when incubated with cupric ion above the concentration of 1 pM and
sodium hydrosulfite, the infectivity of phage decreased more than
10-fold by addition of mitomycin C. EDTA inhibited the inactiva-
tion of phage by reduced mitomycin C in the presence of cupric ion
(data not shown). This inhibition was almost complete at the
concentration above 10 mM EDTA. 10 mM EDTA also inhibited the
phage inactivation by mitomycin C reduced with sodium borohydride(data not shown). other tranSition metals such as Fe2+, Fe3+,
'Mn2+, co2+ and zn2+ than cu2+ were of no effect at o.1 mM for the
inactivation of phage by reduced mitomycin C (data not shown).
EJteZ2ctS ojt{r 1?i`l on th2 /Dhage Z'nactivazE-Lon 1?eacJtS.ton
Figure I-5 shows the effect of pH on the inactivation rate of
phage by reduced mitomycin C in the presence of cupric ion. With
lowering pH, phage inactivation was stimulated, though an optimum
was observed in the pH range from 7.,5 to 8 in sodium phosphate
buffer and Tris-malate buffer. As indicated the inactivation rate
of phage by reduced mitomycin C in the presence of cupric ion is
strongly dependent on pH.
E)eZect o7e Enzynz26 and 1?acUcaZ ScavengeiL6 on lnactivcziSion o7e 6?(174
g-y R?.ttomycZn C Zn th2 fDite6ence o/ SoaeLtun hycliLo6aZ7eLUSe and CuRitaCc
lon
Lown et al. (19) have reported that the degradation of PM2
double-stranded DNA by reduced mitomycin C is largely due to the
free oxygen radicals. On the autoxidation of mitomycin C reduced
with sodium hydrosulfite, the semiqutnone intermediate seems to .generate oxygen radicals. And so we tested several known free
radical scavengers and enzymes for their abilities to inhibit the
-12-
![Page 20: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/20.jpg)
inactivation of 6X174 by mitomycin C in the presence of
hydrosulfite and cupric ion.
Table I-1. Effect of enzymes and radical scavengers oninactivation of 6X174 by mitomycin C in the presence ofhydrosulfite and cupric iona
sodÅ}um
sodium
Scavenger Concentration (mM) 9olnhibitionb
CatalaseSuperoxide dismutaseTironCysteamineAETSodium benzoateDimethylsulfoxideIsopropanolEthanolDABCO
o.oooo4 (lo pg/mo O.O03 1OO 1OO 10 1OO 1OO1OOOlOOO 100
(100 pg/ml)75.0 3.179.282.892.8 o o o o16.8
a6X174 (2 Å~ 107 p.f.u./ml) was incubated with O.15 mM mitomycin C,
O.1 mM CuC12 and O.57 mM sodium hydrosulfite in the presence of at 370C in 2h 50 enzymes or radical scavengers for mM Tris-HCIbpbUerf cf eenr tggPHe ?•fiAl•Bition of inactivation was computed from the ratio
of the percentage inactivation in the presence of scavengers to the percentage inactivation in the absence of scavenger (about 80%).
The results are shown in Table I-1. Inactivaiton of phagewas almost completely inhibited by 10 pg/ml catalase that removes
hydrogen peroxide, but 1Å}ttle inhibited by 100 pg/ml superoxide
dismutase that removes superoxide anion. Superoxide dismutase
might be inactivated by reduced mitomycin C in the presence of
cupric ion as well as by reduced streptonigrin (21). Enzymes
autoclaved for 10 min at 1200C did not affect the phage inacti-
vation. Tiron (38) whÅ}ch is a scavenger for superoxide anion
inhibited the inactivation of phage almost completely. These
results indicate that superoxide anion and hydrogen peroxide arethe intermediaries of the phage inactivation. Sodium benzoate,
dimethylsulfoxide, isopropanol and ethanol, which scavenge
hydroxyl radical (39), were incapable of inhibiting the phage
-13-
![Page 21: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/21.jpg)
Fig. I-6.Iabeled
drugs assodium
and 10
not
for
Inhi
though
7aiLget
ol SodiLun
F'
patterns
sodium
and
28% of
•fi.ee
vÅr=.l
-vre.9
vNx6F
60 (A)
40
20
o
60(B)
40
20
oa2 oA o.6 o.s 1.o
6X174hydrosulfite described hydrosulfitehydrosulfite; pg/ml
lnactlvatlon.
completely
hydroxyl
bition
bicyc1o[2,2,2]octane
the
MoZ2caZe
lgure of hydrosulfitehydrosulfite,
cata1se,
phage
60
40
20
o60
40
20
o
Normalized
Neutral sucrose density particles treated and cupric ion. in MATERIALS and cupric (C), mitomycin catalase; (D),
But the possible
excluded, because
radical (40), inh
of phage inactivation
(DABCO) whcÅ}h
rate of inhibition
oJte 6?(174 Attaclcad ey
hyduo6aZvae and Cupiz.Lc
I-6 shows the neutral 14c-labeled diX174
and cupric
with mitomycin
and without drug.
particles were inactivated
a2 o.4 o.6 o.B 1.o
fractions
14 gradient sedimentation of c- with mitomycin C, sodiumdiX174 partÅ}cles were treated with
AND METHODS. (A), mitomycin C, ion; (B), mitomycim C and sodiumC, sodium hydrosulfite, cupric iondrug free.
involvement of hydroxyl radical is
cysteamine and AET, scavengers
Å}bited the inactivation effectively.
' was caused also by 1,4-diaza- scavenges singlet oxygen (41),
was low.
R7tiSomyofn C Zn the /Dyze6ence
lon ' sucrose gardient sedimentation
parttcles treated with mitomycin C,
ion, with mitomycin C and sodium
C, soidÅ}um hydrosulfite, cupric ion
In each case, 997., 37%, 20% and
, respectively. But in all
-14-
![Page 22: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/22.jpg)
15 15 10 10 =. e.;5 .5 ..h.-
•)o o g15 15 b' 2 10 10 -rd 6 -5 5 oo O,2 O.4 O.6 O,8 1.0 O.2 O,4 O.6 O.8 1.0 Normatized tractions
Fig. I-7. Alkaline sucrose gradient sedimentation patterns of DNAextracted from 6X174 particles treated with mitomycin C, sodiumhydrosulfite and cupric ion. DNA was extracted from the sample inFig. I-6 as described in MATERIALS AND METHODS. Experimentalconditlons of A-D were described in the legends for Fig. I-6.
cases, the phage particles sedimenting as a single band had the
same sedimentation coefficient of 114S. Possibly the inactivatton
of 99% phage particles caused no detactable change in the sedimen-
tation properties. It is thus concluded that the coat proteins ofphage particles remain eSsentially unchanged. Adsorptionexperiments using l4C-labeled diX174 revealed that 6X174 treated
with mitomycin C, sodium hydroSulfite and cupric 'ion can adsorb
normally to the cells (data not shown).
Then DNA was extracted from these particles, and analyzed by
alkaline sucrose gradient sedimentation. The results are inFig. I-7. When phag6 was treated with mitomycin C, sodium hydro-
sulfite and cupric ion, the extracted DNA sedimented as a broad
peak having a sedimentation coefficient of 10S (Fig. I-7A). And no
detectable peaks were observed at the fraction of closed circular
and linear DNA. Thus, mitomycin C caused the degradation of phageDNA in the presence of sodium hydrosulfite and 6upric ion.
Ivlitomycin C could not degrade the phage DNA without cupric ion
-15-
![Page 23: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/23.jpg)
(Fig. I-7B), and 10 pg/ml catalase inhibited the degradation of the
phage DNA (Fig. I-7C). DNA in Fig I-7B,C did not sediment as a clear
peak as well as control DNA (Fig. I-7D), probably because a small
amount of DNA was nicked during incubation or in the course of
extracting process. These results are well compatible with the
loss of plaque-forming abilities of phage treated with drugs, and
indicate that the target molecule of phage attacked by mitomycin
C in the presence of sodium hydrosulfite and cupric ion is DNA.
And Fig. !--7 also indicates that the degradation of single-stranded
DNA occurs in the virion.
12eaction o/ 14C-Zae2Zed 62(174 SZngZ2-Stizancled DIVA Lvth R?#omyofn
C Zn iSh2 /)iLe62nee oZ SoattLu7z /lyduo6uZfÅëLt2 and CuR7zALc lon
As the above results revealed that the target molecule of
6X174 by mitomycin C in the presence of sodium hydrosulfite andcupric ion was DNA, 14C-labeled diX174 single-stranded DNA was
directly reacted with reduced mitomycin C in the presence of
cupric ion. [rhe resulting DNA was analyzed by neutral and
alkaline sucrose gradient sedimentations, and the infectivity wasassayed by transfection. Figures I-8 and 9 shovi the neutral andalkaline sucrose gradient sedimentation patterns of l4c-labeled
6X174 DNA treated with mitomycin C, sodium hydrosulfite and cupric
ion, with mitomycin C and sodium hydrosulfite, with mitomcyin C,
sodium hydrosulfite, cupric ion and catalase, and without drug.
The efficÅ}encies of transfection were 1%, 1009e, 100%, and 80%,
respectively. Mitomycin C caused the degradation of diX174 DNA
only in the presence of sodium hydrosulfite and cupric ion (Fig.
I-8A and 9A). Moreover, because the fragmentation of DNA was
observed also by the neutral sucrose gradient sedimentation (Fig.
I-8A), it is not considered that reduced mitomycÅ}n C eausesalkaline-15bile sites and the following fragmentation of DNA, but '
that reduced mitomycin C directly degrades DNA. Mitomycin C
-16-
![Page 24: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/24.jpg)
A NeO v År r- .) 't ro .9 v E i -o -
O.2 O.4 0.6 0.8 10 O.2 O.4 OS OB 10 Normatized fractions
iZg:,i.-i.•,.,Nedi",tia,i.s,.u.c,r,o.s-e,,g.r.a.d,i'.e,ne,t,,se,d.i.'m.e,n.t,at.!l.o,n,p.a,t,t.e.r,n.s,.of,,
sodium hydrosulfite and cupric ion. (A), mitomycin C, sodiumhydrosulfite and cupric ion; (B), mitomycin C and sodiumhydrosulfite; (C), mitomycin C, sodium hydrosulfÅ}te, cupric ionand 10 pg/ml catalase; (D), drug free.
reduced with sodium hydrosulfite could not degrade the DNA withoutcupric ion (Fig. I-8B and 9B) and 10 pg/ml catalase Å}nhibited the
degradation of DNA (Fig. I-8C and 9C). These results agreed well
with the results of transfection assay. Therefore, the targetmolecule of phage ÅëX174 attacked by mitomycin C in the presence
of sodium hydrosulfite and cupric ion is DNA, and degradation of
phage single-stranded DNA causes the loss of infectivity.
DISCUSSION
The present findings show that mitomycin C reduced with
sodium hydrosulfite inactivates diX174 or degrades 6X174 DNA in
vitro in the presence of cupric ion, although 6X174 single-
stranded DNA is cofisidered to be too small to interact with
mitomycin C (26). Cupric ion has a catalytic effect on the
-17-
30 (A)
20
10
o
30(B)
20
10
o
30 (c)
20
io
o
30(D)
20
10
o
![Page 25: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/25.jpg)
20
2. 10eÅrr-.l
o:ti
.8 2o
R
1 106F
20
10
o
20
10
oo O.2 O.4 O.6 O.8 1,O O.2 O.4 O.6 O.8 10
Normalized fractions
EZg:,i.',9.•,.,Aidik,aiine,,s.u,c,r.o-s.e,.g.r.a,d.i,en,t,,se,d.i.'m.e,n.t,at.!l.o,n,p.a,t,t.e.r,n.s,.of,,
sodium hydrosulfite and cupric ion. Experimental conditions ofA-D were described in the legend for Fig. I-8.
autoxidation of compounds with low redox potential (21,42), and is 'required for the inactivation of 6X174 by mitomycin C reduced with
sodium hydrosulfite. Mitomycin C-induced phage inactivation islnhibited by various radical scavengers (Table I-1). Mitomycin C-
induced diX174 inactiva't'ibn is due to the degradation of phage DNA
by oxygen radicals. But because other scavengers than cysteamine
and AET for hydroxyl radical were of no effect, hydroxyl radical
which was supposed to be responsible for mitomycin C-induced PM2DNA cleavag6 (18) may not mainly participate in mitomycin C-
induced 6Xl74 inactivation. These results suggest that mitomycin
C semiquinone radical is involved in mitomycin C-induced diX174
inactivation. Someya and Tanaka (43) have suggested the role of
the free radical form of anthracycline on the anthracycline-
induced DNA cleavage. A possible radical-generating mechanism is 'as follows:
-18-
![Page 26: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/26.jpg)
(l)
(2)
(3)
(4)
• {5)
(7)
(9)
H+Mitomycin C - Mitomycin C'--, Mitomycin CH2Mitomycin C'-+02 - Mitomycin C+02'-'MitomycinCH2+02 -MitomycinC"'+H02'+H'Mitomycin C'-+H202 - Mitornycin C+OH-+OH'H02•==tH++O,-- (6) 2H02•=H20,+iO,02•-+H202.HO•+HO-JFiO, (8) H20,+H202.2H20+i02O,•--+Cu2+.102+Cu+ (10) H20,-YCu+.OH-+OH--+Cu2+ DNA+ (OM2it'6' mHy2cOin2'cO.-H. " '02] e single strand scission
]vlitomycin C is slowly, non-enzymatically reduced by sodium
hydrosulfite to form semiquinone or hydroquinone. On the
subsequent rapid autoxidation of the reduced form of quinone,
oxygen radicals are produced. The semiquinone form of mitomycin C
has recently been detected by the electron paramagnetic resonance
method and shown to have a life-time of several seconds (44).
Several reducing agents were tested, but only sodium hydro-
sulfite was found to be effective for mitomycin C-induced 6X174
inactivation at pH 8.1 (Fig. I-2). Interestingly phage 6X174 was
resistant to mitomycin C reduced with sodium borohydride at pH 8.1
although dX174 was inactivated by mitomycin C reduced with sodium
borohydride at pH 7.1 (Fig. I-3). .Sodium borohydride reduces
mitomycin C very quickly as compared with sodium hydrosulfite
according to the spectral changes at 363 nm (data not shown).
This Å}s possibly because the coat protein of diX174 were less
permiable to mitomycin C reduced with sodium borohydride or sodium
borohydride at pH 8.1 than at pH 7.1, and because sodium boro-
hydride reduced mitomycin C rapidly outside of the virion. It is
considered that mitomycin C should be reduced near DNA for
inducing the DNA strand scission. Reducing agents containing
thiol group were of no effect at pH 8.1, possibly because these
reducing agents can not effectively reduce mitomycin C, which was
confirmed by the spectral changes (data not shown), and they are
potentially active as radical scavengers (40,45).
Ferrous ion or other transitton metal ions are of no effect
-19-
![Page 27: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/27.jpg)
oR the inactivation of 6X174 by mitomycin C reduced with sodium
hydrosulfite, although ferrous ion stimulates the phage inacti-
vation reaction of ascorbic acid as well as cupric ion (27) and
Fenton's reagent containing ferrous generates hydroxyl radical
from hydrogen peroxide (46). Cupric ion has specific affinity to
DNA (47). Cupric ion can bind, and disorder single-stranded
helical structures by cross-linking between and within polynucleo-
tide strands (48). Cupric ion may be responsible not only for the
generation of free radicals, but also for binding or proper
alignment of mitomycin C to 6X174 DNA prior to the generation of
free radicals. And cupric ion may make DNA to be easily attacked
by oxygen radicals and mitomycin C semiquinone radical through
destabilizing DNA.
-2O-
![Page 28: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/28.jpg)
CHAPTER II Induction of Strand Scission in Single- and Double- Stranded DNAs by Mitomycin c b,C,d)
The author described in chapter I that the target molecule of
mitomycin C is DNA. Mitomycin C, chemically reduced in situ,
cleaves phage single-stranded DNA in the virion, and inactivates
phege 6X174. Lown et al. (18) reported that reduced mitomycin C
induced DNA strand scission in vitro, whtch was detected by
ethidium fluorescence assay. However, chemically reduced
mitomycin C is not considered to directly affect double-strandedreplicative f6rm I DNA (RF I DNA; supercoiled, covalently closed,
circular duplex DNA) of phage dXl74 (49) or phage dA (26),
immunologically related to diX174. The author examined the action
of chemically reduced mitomycin C on single- and double-stranded
DNAs of phage 6X174 using agarose gel electrophoresis.
In this chapter, the author describes that mitomycin C
induces single strand scission in single- and double-stranded DNAs
in the presence of sodium borohydride or in the presence of sodium
hydrosulfite and cupric ion. The mechantsm of strand scission in
single- and double-stranded DNAs are similar to each other in the
following respects: (i) The amount of intact DNA decreased in a
similar rate, (iO oxygen radicals were involvedL, and (iii) strand
scission was inhibited by EDTA.
MATERIALS AND METHODS
Ch2nzZcaLs and thzynee6 , Mttomycin C was kindly supplied by Kyowa Hakko Co. Ltd.,
Tokyo, Japan. Superoxide dismutase (EC 1.15.1.1, bovine blood,2,900 U/mg protein) and catalase (EC 1.11.1.6, bovine liver, 2,500
U/mg protein) were purchased from Sigma Chemical Co. Other
chemicals were obteined from Nakarai Chemicals Co. '
-21-
![Page 29: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/29.jpg)
/'yuzl?aitLation o7e 6t)('174 DIV,4 and .Z't6 nt Z- D!V,t2
6X174 single-stranded (SS) DNA was extracted from 6X174 gmu3
particles by the hot phenol method (32). 6X174 RF I DNA was
prepared as follows: Escherichia coli CN cells were grown at 370Cto 5 Å~ 108 cellslml in 2 liter of TPG-CA medium, which is identical
to TPG-2A medium (50) except that 19. of Casamino acids is substi-
tuted for the amino acids mixture. The cells were infected with
6X174 am3 at a multiplicity of infection of 5 to 10. After 9 min
of incubation, chloramphenicol was added to a final concentration
of 30 pg/ml (50). The cells were harvested after incubation for 3
h, washed with 50 mM Tris-HCI buffer (pH 8.1), resuspended in 10ml of ice-cold 50 mM Tris-HCI buffer (pH 8.1) containing 10% (W/V)
sucrose, and lysed with lysozyme-ED7rA and SDS (51). Solid NaCl
was added to the lysate to a concentration of 1 M, and the
solution was kept on ice for 2 h. Host DNA and proteins precipi-
tated were removed by centrÅ}fugation at 8,OOO Å~ g for IO min. The
sugpension was incubated with 20 pg of RNase A/ml (heated to 900C
fe'r IO min to inactivate DNase contaminated) at 370C for 30 min.
Ethidium bromide and CsCl were then added to give a concentrationQf 300 to 350 pg/ml and 1.58 g/cm3, respectively. After
centrifugation in a RP65[I]A rotor of a Hitachi 55P ultracentrifuge
at 86,OOO Å~ g for 40 h, the DNA bands were visualized with long-
wavelength ultraviolet light (365 nm). The lower band which
contains exclusively ofX174 RF I DNA was collected by aspiration.
After this centrifugation step was repeated, ethidium bromide was
removed from the DNA by five extractions with isopropyl alcohol
saturated with CsCl. dX174 RF I DNA suspension was dialysed
against 50 mM Tris-HCI buffer (pH 8.l).
f2eaction o7e DIVA zvth MZLonzycZn C 12educed to-(Lth SocLtLu7z Boaohycbt.tde . The reaction mixure (20 pl) contained O.2 pg of 6X174 SS DNA
or RF I DNA, 100 pM mitomycin C and O.5 mrvl soidium borohydride in
-22-
![Page 30: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/30.jpg)
50 mrvl Tris-HCI buffer (pH 7.1 or 8.1), unless otherwise noted.
The reaction was started by addÅ}tion of freshly prepared sodium
borohydride solution, carrted out for 60 min at 370C and
terminated by the additton of 5 pl of O.1 M EDTA solution
containing 50% (W/V) sucrose and O.1% bromophenol blue. The
sample in a final volume of 25 Fl was analyzed by agarose gel
electrophoresis.
f?eaction ojte DA/A topLth n?.(ZonzycZn C in th2 /)iLe62nce oie SoaeLwn
llyclito6ndleZte and CuR7zic fon
The reaction mixture (20 pl) contains O.2 pg 6X174 RF I DNA,
O.5 mhI mitomycin C, O.1 mM sodium hydrosulfite and 10 prvl cupric
ion in 50 mM Tris-HCI buffer (pH 7.1), unless otherweise noted.
The reaction was started by the addition of freshly prepared
sodium hydrosulfite solution, carried out for 3 h at 370C and
terminated by the addition of 5 pl of O.1 M EDTA soluttoncontaining 509. (W/V) sucrose and O.19o bromophenol blue. The
sample was analysed by agarose gel electrophoresis.
Agano6e g2Z EZectyzol?hoyte6Z6
Electrophoretic analysis of 6X174 RF I DNA was carried out in
!.4 9o agarose slab gel at 3.5 V/cm for 3 h in 40 inM Tris-
acetate buffer (pH 8.l) containing 5 mM sodtum acetate and 1 mM
EDTA (52). 6X174 SS DNA was analyzed by electrophoresis in agarose
slab gels (2.0%) at 10 V/cm for 1 h in 90 mM Tris-borate buffer
(pH 8.3) containing 2.5 mM EDTA (53). The gel was stained by
soaking in ethidium bromide solution (O.5 pglml) for 1 h.
D2LectZon of the DegiLe2 ofe D/VA Sthand Sof66Zon
The staÅ}ned bands were visualyzed using an ultraviolet lamp(254 nm) and photographed. ' The three topological forms of 6X174
double-stranded DNA, which are ccc DNA (RF I DNA), nicked, open
-23--
![Page 31: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/31.jpg)
circular duplex (oc) DNA and full-length linear duplex (linear)
DNA, and the two topological forms of 6X174 single-stranded DNA,
which are circular DNA (SS DNA), and full-length linear DNA, were
detected as clearly separated bands in agarose gels. 6X174 RF I
DNA produces oc DNA following single strand scission, or linear
DNA as the results of a double strand scisston. A strand scissionin circular diX174 SS DNA produces full-length linear DNA. Thus a
single strand scission causes a decrease in the amount of 6X174 RF
I DNA and SS DNA. This electrophoretic analysis using phage
single- and double-stranded DNAs is, therefore, very sensttive and
available for investigating the mechanism of substrates having DNA
strand scission activity (54, h).
The photographic negatives were scanned with a Shimadzu dual-
wavelength TLC-scanner CS-900 to quantitate the amount of 6X174 RF
I DNA and SS DNA, and to assay the degree of DNA strand scission.
Amount of DNA was corrected by the calibration curve.
RESULTS
-Z'nduciSZon ofe DIVA Sthand Sof662on ay i07.ttLonzycZn C •bz J6h2 1'ua6enc2 o7e
SoctZunz /lyduo6uZ/Zt2 and CuRizZc lon
6X174 RF I DNA was not affected by mitomycin C or mitomycin C
reduced with sodium hydrosulfite (Fig. II-IB,C). As shown in
Fig. II-IF-K, in the presence of 10 pM cupric ion, mitomycin C
reduced with sodium hydrosulfite caused DNA strand scission in RF
I DNA, and the RF I DNA was converted to RF II DNA (nicked, open
circular duplex DNA). The conversion of RF I DNA to RF II DNA was
proportional to the concentration of mitomycin C. When the
produced RF II DNA was heat-denatured and analyzed using agarose
gel electrophoresis, smaller DNA fragments other than circular .and full-length linear single-stranded DNA were observed (data not
shown). Even when RF I DNA was treated with 5 mM mitomycin C in
-24-
![Page 32: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/32.jpg)
RF ll -
RF ][I -
RFI-
AB e [) Il F {i +l I ,I e: i
(.)
(+)
Fig. II-1. Induction of single strand scission in 6X174 RF I DNAby mitomycin C in the presence of sodium hydrosulfite and cupricion. diX174 RF I DNA (O.93 pg/20 ;il) was reacted with mitomycin Cin 50 mM Tris-HCI buffer (pH 8.1). The reaction conditions are asfollows:A:B:C:
D:
E:
F:G:
Drug-free control1 mM mitomycin C1 mlvl mitomycin C,o.1 mM Na2S2041 mrvl mitomycin C,10 yM CuC12o.1 mM Na2S204,10 pM CuC12E + 10 pM mitomycin CE + 50 pM mitomycin C
H:I:
J:IÅq:
L:
E + O.1 mM mtomycin CE + O.5 mM mitomycin CE + 1.0 mrvl mitomycin CE + 5.0 miYI mitomycin CPst I-digested diX174 RF I(indicates the position oflinear duplex DNA, RF III)
DNA
the presence of sodium hydrosulfite and cupric ion (Fig. II-IK),
RF III DNA (linear duplex DNA), which is generated by double
strand scission in RF I DNA, was not observed. Nonreduced
mitomycin C (Fig. II-ID) or sodium hydrosulfite (Fig. II-IE) did
not convert RF I DNA to RF II DNA even in the presence of cupricion. other transition metal ions such as Fe2+, Fe3+, Mn2+, co2+
and zn2+ were of no effect (data not shown).
These results indicate that mitomycin C reduced with sodium
hydrosulfite causes one or more single strand scission, but not
double strand scissj.on in 6Xl74 RF I DNA, and cupric ion is essen-
tial for this DNA cleavage action.
-25-
![Page 33: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/33.jpg)
ABC DEFGH-
+
Fig. II-2.induction ofRF I DNA (O.93Tris-HCIA: Drug-freeB: ConpleteC: B+1D: B+ 10E: B+ 10F: B+ 10G: B+ 25 ,H: B+ 25
Efekeect ofe
ScZ66Zon ey MCaRiLZc, lon
It is
semqulnonemitomycin C are
and subsequent
and severalinhibit the RF
presence of
II-2D,
1ete1y 4nhi
of the
scission (Fig.
- RF
-RF
1
I
Effect of catalase and superoxide dismutase on the single strand scission in 6X174 RF I DNA. 6X174 }ig/20 pl) was reacted with mitomycin C in 50 mM buffer (pH 8.1). The reaction conditions are as follows: control (1.0 rnM mitomycin C, O.1 mM Na2S204, 10 ]Jrvl CuC12) pg/ml catalase pg/ml catalase pg/ml heat-inactivated catalase pg/ml superoxide dismutase pg/ml superoxide dismutase pg/ml heat-inactivated superoxide dismutase
Enzynz26 and f?czclZcaZ Scaveng2iz6 on th2 f21 l D!VA Sthand
tomycth C Zn the 10a26enc2 of So(ttwn llycino6uUZte and
suggested that free oxygen radicals and mitomycin C
radical generated during reduction and autoxidation of involved in the diX174 single-stranded DNA breakage
phage inactivation (Chapter I). Therefore, enzymes
radical scavengers were tested for their abilities to
I DNA strand scission by mitomycin C in the
sodium hydrosulfite and cupric ion. As shown in Fig.
catalase (10 pg/ml), which removes hydrogen peroxide, comp-
bited the DNA strand scission. The same concentration
heat-inactivated enzyme did not inhibit the DNA strand
II-2E). Tiron (38), a scavenger for superoxide
-26-
![Page 34: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/34.jpg)
ABC D EF GHIJ KLI
+
Fig. II-3.scission byreactedreactlonA:
B: 1.0 mM O.1 mM 10 pM CC: B+ O.4D: B+ 4.0E: B+ 10
anlon,3C,D), but
scission (F
dismutates
produces
formate
hydroxyl3F, H, J).
diazabicycl
(41)(Fig.
InductionSOCULU7Z
sclsslon ln
-. RF E
-RF I
Effect of radical scavengers on the DNA strand mitomycin C. 6X174 RF I DNA (O.93 pg/20 pl) was with mitomycin C in 50 mM Tris-HCI buffer (pH 8.1). The conditions are as follows:Drug-free control F: B+ 100 mM sodium benzoate mitomycin C, G: B+ 10 rnM sodium formate Na2S204, H: B+ 100 mM sodium formate uC12 I: B+ O.5 m/M KI mM Tiron J: B+ 5.0 mh KI mM Tiron K: B+ 1.0 mM DABCO mM sodium benzoate L: B+ 10 mM DABCO
completely inhibited the DNA strand scission (Fig. II-
superoxide dismutase did not inhibit the DNA strand
ig. II-2F,G). This is probably because the enzyme
superoxide anion to oxygen and hydrogen peroxide which
hydroxyl radical. Sodium benzoate (100 mM), sodium
(100 mM) and potassium iodide (5 mrvl), scavengers for
radical (39), inhibited the DNA strand scission (Fig. II-
The DNA strand scission was inhibited also by 1,4-
o[2,2,2]octane (DABCO) which scavenges singlet oxygen
II-3L).
o7g D!VA SbLand Sc.t66Zon ey MZiSonzycZn C 1?educ2d Ld#h
Boitohy(Zivtde tn 6)(774 SingZ2- and DoueZ2-Stitanded DIVA6
iviitomycin C reduced with sodium borohydride caused strand
naked 6X174 SS DNA in proportion to the concentration
-27-
![Page 35: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/35.jpg)
100:.
tg$glj 50
6c
.o-
U91eo
A
rÅrx,
N.?
NN"
.OOI .O]funovnt PMt-. (' ug)
•Xiiiii[
xÅ~
:•
vs9kgil
a'o
[.9
U9
-ut
eE
Ol 10 1oo Ol 10 1oo Concentratjon of mitornycin C (pM)
Fig. II-4. [rhe action of mitomycin C reduced vith sodium boro- hydride on 6X174 single- and double-stranded DNAs. 6X174 SS DNA (O.2 pg/20 pl, A) or Åqz{X174 RF I DNA (O.2 pg/20 .;il, B) was reacted with the indicated concentration of mitomycin C in the presence of O.5 mM sodium borohydride in 50 mlvl Tris-HCI buffer (e-•--{), pH 7.1;o---o, pH 8.l) at 37 C for 60 min. The degree of the DNA strand scission was detected as described in MATERIALS AND METHODS.
of mitomycin C above 10 pM both at pH 7.1 and at pH 8.1 (Fig. II- }4A). ,6X174 RF I DNA strand scission occured at pH 7.1 depending
on the concentratÅ}on of mitomycin C above IO pM (Fig. II-4B).
This was also the case for diX174 RF ! 'DNA strand scission at pH
8.1, hQwever, O.5 mrvl sodium borohydride alone induced strand
scission. in about half of the ,6X174 RF I DNA molecules at pH 8.l
(Fig. II-4B). The amount of intact single- and double-stranded
DNAs decreased in a similar rate at pH 7.1.
diX174 RF I DNA strand scission by mitomycin C reduced with
sodium borohydride, as well as that by mitomycin C reduced with
sodium hydrosulfite in the presence of cupric ion, was inhibited
by radical scavengers and EDTA (Table II-1). The effects of radical
scavengers and EDTA on strand scission in 6X174 SS DNA were
similar to those on strand scission in diX174 RF I DNA (Table II-
2). This indicates that oxygen radicals, such as hydroxyl radical
and singlet oxygen, participated in strand scission by chemically
reduced mitomycin C in both single- and double-stranded DNAs.
-28-
![Page 36: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/36.jpg)
Table II-1. Effects of enzymes and radical scavengers on DNAstrand scission by mitomycin C.A
Relative amount of intact DNA (9.)Scavenger
MDqC-NaBH4a bMMC-Na2S204
None
Catalase (10 pg/ml)Superoxide dismutase (10 yglml)Sodium benzoate (100 mM)DABCO (10 mlvl)Tiron (4 mM)EDTA (10 mh)
38
351563639472
18
85 18 38 271OO 81
B
Relative amount of intact DNA (%)Scavenger
6X174 SS DNAa 6X174 RF I DNAa
None
Catalase (10 pg/ml)Superoxide dismutase (25 pg/ml)Sodium benzoate (100 mM)DABco (lo mlvf)Tiron (4 rnM)ED[[]A (10 mM)
42
32 15 731OO 861OO
38
351563639472
adX174 SS DNA or RF I DNA (O.2 pg/20 yl) was reacted with O.1 mM mitomycin C (]tlMC) and O.5 mM sodium borohydride in 50 mM Tris-HCIb6bx" if 7f4erRF(PiH DN7A'i () o.a2t y3g7/02Co pf iO)r .6 .0.M.i .n.' .ted with o.s mTvi mitomycÅ}n
C, O.1 mrvl sodium hydrosulfite and 10 JiTvl cuprÅ}c ion in 50 mM Tris- HCI buffer (pH 7.1) at 370C for 3 h.
DISCUSSION
' The present results revealed that mitomycin C induces single
strand scission in diX174 SS DNA and double-stranded RF I DNA in
-29-
![Page 37: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/37.jpg)
the presence of sodium borohydride or in the presence of sodium
hydrosulfite and cupric ion. DNA strand scission by mitomycin C
reduced with sodium borohydride occurs by a similar mechanism to
that by mitomycin C reduced with sodium hydrosulfite in the
presence of cupric ion, although the reaction rates of these two
DNA strand scission seem to be different as described later.
The diX174 SS DNA strand scission and diX174 RF I DNA strand
scission are due to oxygen radicals which are generated during the
reduction and autoxidation of mitomycin C. The effect of scaven-
gers for hydroxyl radical on the DNA strand scission reactions
suggest that hydroxyl radieal is mainly responsible for DNA strand
scission by chemically reduced mitomycin C. Hydroxyl radical is
supposed as a responsible species for DNA strand scission by many
oxygen radical-generating agents (18,27,28). Singlet oxygen may
also be involved in the DNA strand scission, because DABCO partly
inhibited the reactions. The mitomycin C semiquinone radical (55)
generated during the reduction may also participate in the
reaction. Mitomycin C semiquinone radical has been detected by
'the electron paramagnetic resonance ,method and shown to have a
life-time of several seconds (44). Trace metal ions contaminating
in the mitomycin C-sodium borohydride reaction mixture or
exogeneously added cupric ion in the mitomycin C-sodium
hydrosulfite reaction mixture are supposed to be involved in the
autoxldation of mitomycin C and the generation of oxygen radicals
as in the case of streptonigrin (21).
. The DNA strand scission by mitomycin C reduced with sodiumborohydride was completed in less than 1 min as a result of rapid
reduction by sodium borohydride, whereas that by mitomycin C
reduced with sodium hydrosulfite in the presence of cupric ion
proceeded slowly for more than 2 h (data not shown). This may
account for the difference in irihibitory effect of catalase (Table
II-1).
-3O--
![Page 38: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/38.jpg)
Htgher concentration than O.1 mM of sodium borohydride
induced DNA strand scission in 6X174 RF I DNA at pH 8.1 as shown
in Fig. II-4B. Sodium borohydride also induced strand scission in
phage PM2 double-stranded DNA at pH 8.1, but not at pH 7.1 (data
not shown). Since sodium borohydride-induced DNA strand scission
was inhibited by superoxide dismutase, sodium benzoate, tiron and
EDTA (data not shown), oxygen radicals and metal ions appear to be
involved in the sodium borohydride--induced DNA strand scission.
It is still not clear why strand scission occurs only in double-
stranded DNA at pH 8.1 by sodium borohydride.
-31-
![Page 39: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/39.jpg)
CHAPTER III Phage Inactivation and DNA Strand Scission Activities of Mitomycin Derivatives e)
The structure of mitomycin C is very unique not only for the
natural product, but also the antitumor substance in respect that
it has three carcinostatic groups, i.e. quinone, aziridine and
carbamate. The uniqueness of the structure has stimulated the
preparation of numerous anaZogues of mitomycin C in the hope of
obtaining compaunds with improved therapeutic properties
(56,57,58). The author examined the phage inactivation and DNA
strand scission activities of mitomycin derivatives. This study
will serve to elucidate the mechanism of action of mitomycin C.
In this chapter, the auther describes that the binding of
mitomycin C at the Cl position to DNA will play an important role
in the DNA cleavage action, and the substitution at the C7 position
greatly affects the DNA strand scission activity. Among mitomycin
derivatives, 7-N-(2-hydroxyphenyl)mitomycin C (M-83)(59), which
has reported to have a higher antitumor activity than mitomycin C
(59,60), has higher activities of phage inactivation and DNA
strand scission.
• rvlATERIALS AND )fiilTHODS
0't2m-LcaZ6
Mitomycin C and its derivatives were kindly supplied by Kyowa
Hakko Co. Ltd., Tokyo, Japan. Sodium dextran sulfate 500 was
purchased from Pharmacia Fine Chemicals. Other chemicals were
obtained from Nakarai Chemicals Co.
BacteLia and /Dhag26
Escherichia coli CN and Pseudomonus BAL-•31 were used as the
indicator bacteria of phage 6X174 and phage PM2, respectively.
-r32d
![Page 40: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/40.jpg)
/'ua1?anatton o/T /Dhag2 6X174 anLZ .Z-t!L6 D!V,t16
Phage 6X174 am3 and its DNAs were prepared as described in
Chapters I and II.
/Diz2RaitcLtion oJ /Dhag2 IDM2
Pseudomonus BAL-31 was grown at 280C to 4 X 108 cells/ml in 1
liter of A)"IS-broth (59), and infected with PM2 at a multiplicity of
infection of 5 to 10. Incubation was continued for 2 to 3 h
after infection until complete lysis. After cooling in ice for 30
min, the lysate was concentrated according to the method described
by Salditt et al. (60): Polyethylene glycol 6000, powdered, was
slowly added to a final concentration of 43 g per liter and sodium
dextran sulfate 500 was added to a final concentration of 2.35 g
per liter. The mixture was vigorously shalÅqen and then allowed to
settle for 18 h at 40C. The bottom phase was collected and
centrifuged at 10,OOO Å~ g for 20 min. The interphase was collected
and suspended in 2-fold volume of 20 mM Tris-HCI buffer (pH 7.1)
containing 1 M NaCl and 10 mM CaCl2 (NTC buffer). To the
suspension was added 4 M KCI to a final concentration of 1.1 M.
After allowing the mixture to stand for 2 h at 40C, the precipi-
tate of dextran sulfate was removed by centrifugation at 8,OOO Å~
g. For every gram of solution, O.317 g of cesiuM chloride (CsCl)
was added (average density 1.28 g/ml). After centrifugation
(RP65[rA rotor: Hitachi 55P ultracentrifuge) at 86,OOO Å~ g for 24
h, the white virus band was collected by aspiration. The purified
virus was dialyzed against NTC buffer.
I6oZation o: f'R72 DIVA
PM2 covalentry cZosed circular (ccc) duplex DNA was extracted
from purified PM2 phage and, further purified by CsCl equillibrium
centrifugation essentially as described earlier (61,62).
-33-
![Page 41: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/41.jpg)
1?eaction ove R?-itomycZn D2iz.tvaiSZv26 toth 6X174 oa /DM2 Vtaon The reaction mixture (IOO pl) contaÅ}ned 2 Å~ 108 plaque--
forming units (p.f.u.)lml of dX174 or PM2 virion, 100 pM mitomycin
derivatives and O.2 mM sodium borohydride. The reacton wÅ}th 6X174
was carried out in 50 mM Tris-HCI buffer (pH 7.1) at 370C, and
with P]vl2 in NTC buffer at 280C. The reaction was started by
adding freshly prepared sodium borohydride solution, continued for
1 h with gentle shaking, and stopped by dilution with each
ice--cold buffer. The survival of phage was assayed by the double
agar layer technique (33,59).
1?2acUon oZ MLtonzyofn C D27ttvat.tv26 LvLth DA!A
The reaction mixture (20 pl) contained O.17 pg (8.5 ;pg/ml)
PM2 ccc DNA, diX174 SS DNA or RF I DNA, 100 pM mitomycin
derivatives and O.5 mM sodium borohydride in 50 mM Tris-HCI buffer
(pH 7.1), unless otherwise rtoted. Reactions were carried out for
1 h at 370C, and stopped by the addition of 5 pl of O.1 M EDTA
solution containing 50% (W/V) sucrose and O.1% bromophenol blue.
The sample in a final volume of 25 pl was analyzed by agarose gel
electrophoresis. The degree of DNA strand scission was determined
as described in Chapter II.
RESULTS
'/Ohag2 lnacLtvczLLon and Z)IVA Sthand ScZ66Zon ActtvZtl26 ofe
R7onodactZonczZ MLtomyeZn6
Mitomycin C is supposed to bÅ}nd mainly at the Cl position or
the CIO position to DNA (6). To investigate the role of the Cl
and CIO positions in the DNA cleavage action, the action of
decarbamoyl derivatives and 7-methoxymitosene, which have been
assumed to act a monofunctional alkylating agent (24) was examined
(Table III-1). 7-methoxymitosene scarcely induced DNA strand
-34-
![Page 42: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/42.jpg)
Table III-1.activitles
Phage inactivation and DNAof monofunctional mitomycins.
strand sclsslon
Nar"e
Mitomycin C
5tructure
NH2
CH3o
o,qhocM,2
OCH3
Mitomycin H
Mttomycin G
CH30
C ,i3
9a-O-demethytG
NH2
CH3
NH2
CH3
o
ll
oo
11
oo
7-methoxy-mitosene
CH2
owN=Il[NCH3
CH2
H3N21•.[ncH,
cH2
OH"oll[ncte
CH30
CH3
9CH20CNH2
ow NH2
PM2Vi ri on ('t.) DNA
92.
o9 cc9 +
67
5.4
18
56
Phage PM2 (2 Å~ 107 p.f.u.!100 pl) was incubated with O.1 mMmitomycin derivatives in the presence of O.2 mM sodium boro-hydride. The reaction was carried out in NTC buffer at 280C for 1h. PM 2 ccc DNA (O.17 pg/20 pl) was incubated with O.1 mMmitomycin derivatives in the presence of O.5 mM sodium boro-hydride. The reaction was carried out in 50 mM Tris-HCI buffer(pH 7.1) at 370C for 1 h.
-35-
![Page 43: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/43.jpg)
oocco
n"omAÅq
O.08
O.06
OD4
O.02
o
Fig. III-1.Calf thymusC in thein 50 mMwas precipitatedprecipitated•buffer (pH(---) DNAcomputed spectrumsubtractingfrom the
sclsslon lnof phage inactivation
Mitomycin
used in th
binding ratio
which was
E3io ii,soo
ethanol precipitation
suggest that
DNA cleavage
O.04
O.02
3oo 3go 4oo 3oo 3so nm nm Ultraviolet spectra of the DNA-mitomycin C complex. DNA (20 pg/200 pl) was incubated with O.5 mM mitomycinpresence of O.5 mM sodium borohydride at 370C for 30 minTris-HCI buffer (pH 7.1). After the reaction, the DNA with ethanol, rinsed with 709. ethanol. The DNA was resuspended in O.3 ml of 50 mM Tris-HCI 7.1). Left section: ( ) DNA-mitomycin C complex;alone at the same concentration. Right section: of mitomycin C bound to DNA, obtaining by 'the spectrum of DNA alone at the same concentrationspectrum of the complex.
' PM2 DNA, whereas mitomycin G had almost the same level
' ' and DNA cleavage activities as mitomycin C. C reduced with sodium borohydride under the conditions
is study formed a complex with calf thymus DNA and the
' was 50-IOO nucleotides/antibiotic (Fig. III-1),
determined by ultraviolet absorbance at 310 nm and using
(55). The mitomycin C-DNA complex was stable to
'' ' and phenol extraction. These results the binding at the Cl position is essential for the
action of mitomycin C.
-36-
![Page 44: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/44.jpg)
Table III-2of mitomycin
A
Phage inactivation and DNAderivatives.
strand sclsslon actlvltles
bo g Type
MtctnycnC 1
Pcrt,romytin 1
mo-O024 2
KD-O085 2
wo-O02] 1
O-oo65 1
ke-oo25 1
mo-O035 2
wo-co27 1
K! -- O032 1
x
NH2'
.
.
-
CH3NH-
CH3(CH2)"NH-
D)N-
I) N-
ON- -- ON-
Y
-oCH3
.
-OH
.oCHs
.
tl
tl
-OH
.oCH3
tl
z
-H
.CH3
,
,
-H
te
-
.CH3
-H
t-
R
.CONH2
s
-
-
.
il
.
It
tt
-t
PM2V:RION (Z) DNA
10
37
st
77
65
14
3,6
9,6
7,2
7,3
Phage PM2 (2 Å~ 107 p.f.u./100 pl) was incubated with O.l mMmitomycin derivatives in the presence of O.2 mM sodium boro-hydride. The reaction was carried out in NTC buffer at 280C for 1h. PM 2 ccc DNA (O.17 pg/20 pl) was incubated with O.1 mMmitomycin derivatives in the presence of O.5 mM sodium boro-hydride. The reaction was carried out in 50 mM Tris-HCI buffer(pH 7.1) at 370C for 1 h.
-37-
![Page 45: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/45.jpg)
Table III-2B
P,ve
Na&Type x Y z R V:R:ON (x) DNA
. oc ccc •
MitnyMC 1 NH2- .ocH3 -H -cONH2 2,2
MitornycbA i CH30- . titt 2,5
MitornycmB 2 , -OH -CH3 tt 78
mo-O121 1 ,..oCHs
, tt 51
xu..oo82 2 , . . tt so
i"]-0302 1 CH3CH20- -I - -t 46/
L
KDOS05 1 CHs(CH2)sO- , ' tt 8,it
fJ-0308 1 OCH20- Jt, it o,i L
Table III-2C
No.gType x Y z RPM2
V:R1ON ÅqZ) DNA
- oc ccc +
M,tor"ycnC 1 NH2' .OCH3 -H -• COma2 2, 2
K[r)-oOo7 1 te . -CO(CH2)2CH3 , 98
KD-O021 1 i- tj -C02CH2CHs . NKD-O083 1 . - -H -H sa
KD-O087 1 . . . -cOCH3 2, o
KD-O099 1 . - g -CocH2Ct "xu-Ol16 1 . . . -CONHCH3 7,2
ua-Ol15 1 • lt -H . 11
-38-
![Page 46: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/46.jpg)
/Ohag2 lnacLtvation and D/VA SiEiLand Sof66Zon ActivZtZe6 o7e MZiSomyc.Ln
DenZvativ26
The examined derivatives involves 7-substituents (X) in the
quinone ring with other functional groups and substituents (Z) on
the aziridine ring, (R) on the hydroxymethyl side chain and (Y) at
the 9a position (Table III-2A,B,C). The replacement at above
positions (X, Y, Z and R) all affected the phage inactivation
activity or the DNA strand scission activity. Among these deriva-
tives, the 7-aziridino mitomycin C (KD-O025, Table III-2A) and 7-
benzyloxy derivative (IÅqD-0308, Table III-2B) had the remarkably
higher phage inactivation and DNA strand scission activities than
mitomycin C. The 7 position is supposed to be important because
it controls the reduction potential of the quinone ring, thus
offering a chance to obtain some selectivity between normal cells
and certain cancer cells (56,58).
x
CH3
o
N" o Type1
Fig. III--2. Structures
AcLZon o,e I'2-83
Among the
mitomycin C (M-83)
inactivation and
sodium borohyd
mitomycin C, showed
against 6X174
ocHoR x cH,oR --tt-t'""' :::rN-z C"3 o "V'-":N-•z
Type 2
of mitomycin derivatives.
on 1'hage6 6t)('174 ana( f'/'?2 and 7heZ/L DIV7`16
7-substituted derivatives, 7-N-(2-hydroxyphenyl)-
had the remarkably high activities of phage
DNA strand scission. Ivl-83 reduced in situ with
ride, at one third to one sixth concentration of
the same degree of phage inactivation activity
(Fig. III-4) and Prvl2 (Fig. III-5), and of DNA strand
-39-
![Page 47: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/47.jpg)
HO
Fig.
H N
CH3
III-3.
o
7-N-(2-
o.CH2OCNH2
OCH3
"'NH
hydroxylphenyl)-mitomycin
51OO
A 10
.9 tr,
ls o e' so oNo Li
.l l = ut
O.1 o
1 10 1oo Conc. of antibiotic (pM)
Fig. III-4. Inactivation of phagereduced with sodium borohydride.pl) was incubated at 370C for 1 h withmitomycin C (o---O) or M-83 (e e) in7.1) in the presence of O.2 mM sodium
Fig. III-5. Inactivation of phage PM2reduced with sodium borohydride. Phagepl) was incubated at 280C for 1 h withmitomycin C (o---o) or M-83 O e) inof O.2 mM sodÅ}um borohydride.
C (M-83).
1 10 100 Conc. of antibiotic (pM)
S,Xg,7g b,Åq,yz't?gyc.in,,9 o,r.,Y.:92,,
indicated concentrations of 50 mM Tris-HCI buffer (pH borohydride.
by,,m,it2,my:i:,9o,r.,.M.:/83,,,
indicated concentrations of NTC buffer in the presence
-4O-
![Page 48: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/48.jpg)
ABCDEFGHIJKLMNPQ
100l-NeN"
vÅq
zaL"o= 50u'U
")xN o
-circular
-einear
1 10 100 Conc. of antibiotic (pM)
Fig. III-6. Induction of strand scission in 6X174 single-strandedDNA by mitomycin C (o--o) or M-83 (e e) reduced with sodiumborohydride. Concentrations of mitomycin C or M-83: C and J,1 pM; D and K, 10 pM; E and L, 30 pM; F and M, 50 pM; G andN, 75 pM; H and P, 100 pM; I and Q, 500 pM.A: Drug-free controlB: O.5 mM sodium borohydride aloneC-I: Mitomycin C + O.5 mrvl sodium borohydrideJ-Q: M-83 + O.5 mM sodium borohydride
ABCDEFGHIJKLMNPQoc
Inear
cc
100 F• v Åq z o 8 N i 10
No
1 10 100 Conc. of antibiotic (yM)
Fig. III-7. Induction of strand scission in PM2 ccc DNA bymitomycin C (o--o) or M-83 (e e) reduced with sodium borohydride.Concentrations of mitomycin C or M-83: B and J, 1 pM; C and K,IO pM; D and L, 20 jp M; E and M, 30 Ji M; F and N, 50 pM; G andP, 75 pM; H and Q, 100 pM; I, 500 pM. A, drug-free control.
-41-
![Page 49: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/49.jpg)
Table III-3. Effect of catalase and superoxide dismutase on DNAstrand scission by mitomycin C or M-83 in the presence of sodiumhydrosulfite and cupric iona.
Antibiotic EnzymeRelative amount ofintact DNA (%)
rvlitomycin CCatalaseSuperoxide dismutase
439049
M-83CatalaseSuperoxide dismutase
339821
adX174 RF I DNA (O.2 pg) was reacted with O.5 mM mitomycin C or 50prvl M-83 in 50 mrvl Tris-HCI buffer (pH 7.1) in the presence of O.1 mrvlsodium hydrosulfite and 10 pM cupric ion at 370C for 1 h.
ABC DEFG HIJKLMN PQ(-)
oc
1lnear
CCC
(+)
Fig. III-8. Effect of enzymes, radical scavengers and EDTA on DNAstrand scission by mitomycin C or M-83 in the presence ofsodium borohydride. PM2 ccc DNA (O.17 pg/20 pl) was reacted with100 pM mitomycin C or 50 prvl M-83 in the presence of O.5 mMsodium borohydride in 50 mM Tris-HCI buffer (pH 7.1) at 370C for1 h. Reaction conditions are as follows:A: Drug-free controlB: O.5 mM soidium borohydride aloneC: 100 pM mitomycin C, O.5 mM sodium borohydrideJ: 50 prvl M-83, O.5 mM sodium borohydrideD or K: C or J+ 10 pglml catalaseE or L: C or J + 25 pglml superoxide dismutaseF or M: C or J+4 mM TironG or N: C or J+ 200 mM sodium benzoateH or P: C or J+ 10 mM DABCOI or Q: C or J+ 10 mM EDTA
-42-
![Page 50: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/50.jpg)
scission activity against their DNAs (Fig. III-6,7).
EJeZect o7e Enzynz26 and f2acUcaZ Scaveng2n6 on th2 Rl-83 12eacLLon
The effect of enzymes and radical scavengers on DNA strand
scission by both antibitics were similar (Fig. III-8, Table III-
3). This indicates that oxygen radicals such as hydroxyl radical
and siglet oxygen participate in DNA strand scission by reduced M-
83. Since the reaction was inhibited by EDTA (Fig. III-8I,Q),
trace metal ions in the reaction mixture are presumed to be
involved in the generation of oxygen radicals.
0thea 1imofng Ag2n.t6 -(n the DIVA CZeavag2 1?eaction oJe R?-83
rvl-83 reduced with dithiothreitol showed much higher DNA
strand scission activity than mitomycin C reduced with dithio-
thretol (Fig.III-9B). rvl-83 reduced with 2-mercaptoethanol (Fig.
III-9C), NADH (Fig. III-9D) or HADPH (Fig. III-9E) caused DNA
strand scission appreciably, but mitomycin C did not. These
results suggest that M-83 is more readily reduced to an active
form than mitomycin C.
Fig. III-9. Usefulness of reducing agent in the inductionstrand scission by M-83. PM2 ccc DNA (O.17 pg120 pl)with O.5 mM mitomycin C or O.5 mM M-83 reduced withdithiothreitol (B), O.1 mM 2-mercaptoethanol (C), 2or 2 mM NADPH (E) in 50 mM,Tris-HCI buffer (pH 7.1)h. A, drug-free control. In B-E, left lanes, antibiotic-freecontrol; middle lanes, mitomycin C; right lanes, M-83
-43-
-circular
-linear
of DNA was reacted10 mMmM NADPH (D)at 37eC for 1
.
![Page 51: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/51.jpg)
100
A s v Åq z o u 50 v v N E a
o
O 10 20 30 40 50 Temperature (eC)
Fig. III-10. Temperature dependency of DNA strand scission. PM2ccc DNA (O.17 pg/20 pl) was reacted with 50 pM M--83 reduced withO.5 mM sodium borohydride in 50 m)1 Tris-HCI buffer (pH 7.1) at theindicated temperature for 1 h.
7enRwLatwz2 Del?`2naLency oZ DAIA Stitand Sof66Zon
DNA strand scission by M-83 reduced with sodium borohydride
was dependent on temperature, and was greatly depressed at 40C(Fi'g. III-10). Strand scission in 6X174 SS DNA by reduced M-83 was
also dependent on temperature (data not shown). Similar tempera-
ture•dependency was observed in DNA strand scission by reduced
mitomycin C(data not shown).
DISCUSSION
Mitomycin derivatives induced DNA strand scission in double-straLnded Prvl2 DNA as well as in diX174 SS DNA and RF I DNA, and
inactivated phage PM2. This indicates that mitomycins do not
attack particularly 6X174 DNAs alone. The phage Å}nactivation
activities of mitomycin derivatives generally reflected their DNA
strand sctssion activities in this study. The phage inactivation
experiment is supposed to be useful for investigating the action of
substances obtaining DNA strand scission activity (63,64,65), and
for the first screening method of those substances
-44-
![Page 52: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/52.jpg)
because it is applicable to crude samples contaminated with DNase.
This study suggested that reduced mitomycin C binds mainly at
the Cl position to DNA, generates oxygen radicals during
autoxidation of quinone, and induces DNA strand scission. This
study also suggested that the substitution at the C7 position,
which is supposed to control the reduction potential of the
quinone ring, greatly affects the DNA strand scission activity of
mitomycins. Among the 7-substituted derivatives, M-83 had the
remarkably high activities of phage inactivation and DNA strand
scission. M-83 has a high antitumor activity than mitomycin C
against lymphocytic leuchemia P388 and fibrosarcoma Meth 1
(59,60), and a lower toxicity than mitomycin C with myelo-
suppression and leukopenia (66). M-83 is, therefore, expected to
be more useful as a clinical antitumor agent.
M-83 was more active than mitomycin C: M-83, at one third to
one sixth concentration, showed the same degree of phage inacti-
vation and DNA strand scission activities of mitomycin C. The
mechanism of phage inactivation and DNA strand scission by M-83
were similar to those by mitomycin C: (1) Reduction of M-83 was
required for its actions. (2) Oxygen radicals were involved, and
metal ions possibly participated in the generation of these
radicals. (3) The DNA strand scission was single strand and
dependent on temperature. Oxygen radicals participate also in DNA
strand scission by several antitumor antibiotics including
bleomycin (l9,67). Metal ions are also associated with bleomycin-
mediated DNA strand scission (67). DNA strand scission by
bleomycin in the absence of reducing agents is relatively insensi-
tive to the change in reaction temperature from 4 to 600C (68),
however, in the presence of reducing agents DNA strand scission Å}s
dependent on temperature (69). Reduction of M--83 or mitomycin C
to form an active Å}ntermediate may be dependent on temperature,
and M-83 appears to be reduced to an active form more readily than
-45-
![Page 53: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/53.jpg)
mitomycin C.
These results suggest that covalent binding
the Cl positton to DNA is essential for the DNA
and that the high antitumor activity of Tvl-83 may
strand scission activity.
of mitomycin C at
strand scission,
reflect the DNA
-- 46-
![Page 54: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/54.jpg)
CHAPTER IV Sequence Specificity of Heat-Labile Sites in DNA Induced by Mitomycin C f'g)
Mitomycin C interacts with DNA, resultÅ}ng in covalent bÅ}nding
of the drug to DNA, as well as in the formation of crosslinks
between the complementary strands of DNA (5,6,7). These DNA
modifications are believed to be essential for the cytotoxicity of
mitomycin C (5,8,9,10). The aziridine and methyl uretane moietiesare suggested to be involved in the binding to DNA (6,12,70).
The binding sites of mitomycin C in DNA are the O--6 position or
the 2-amino group of guanine resÅ}dues or the 6-amino group of
adenine residues (12,13). However, the details of the inter-
action of mitomycin C with DNA have yet to be elucidated.
Mitomycin C contains quinone moiety besides aziridine and
methyl uretane. Reduction of mitomycin C, by chemical or
enzymatic methods, followed by exposure to air results in the
generation of superoxide anion and hydrogen peroxide (14,15).
Oxygen radicals were generated not only by free mitomycin C but
also by mitomycin C irreversibly bound to DNA (15). The author
described that chemically reduced mitomycin C induces single
strand scission in single-stranded and double-stranded DNAs
(Chapter I,II,III). The DNA strand scisison is 6onsidered to
involve the oxygen radicals such as hydroxyl radical and singlet
oxygen, and mitomycin C semiquinone radical.
DNA cleavage via mechanism involving oxygen radicals are
reported for some antitumor anttbiotics such as bleomycin
(19,20). Strand scission by bleomycin occurs preferentially at
specifÅ}c sequences (71,72) and at specific sites in DNA (73), and
the sequence specificity of single strand scission is related to
the site-specific double strand scission by bleomycin (74).
The author investigated the interaction of mitomycin C with
DNA by using DNA substrates of defined sequence. In this chapter,
-47--
![Page 55: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/55.jpg)
the author shows that reduced mitomycin C induces heat-labile
sites in DNA preferentially at specific sequences, and that oxygen
radicals are possibly involved in the induction of heat-labile
sltes.
MATERIALS AND MEHTODS
Ch2mZcaZ6 ancl Enzyme6
Mitomycin C was kindly supplied by Kyowa Hakko Co. Ltd., Tokyo,
Japan. Restriction enzymes Haelll, LTLag,I and Hinfl, and T4
polynucleotide kinase were obtained from Takara Shuzo Co. Ltd.,
the Klenow fragment of DNA polymerase I of Escherichia coli was
from Bethesda Research Laboratories GmbH, and calf intestinealkaline phosphatase was from Boeringer Manheim GmbH. [ok-32p]dTTp,
[o(-32p]dc[[[p and [if-32p]ATp (specific activity about 3000 Cilmmol)
were purchased from New England Nuclear a Du Pont Co., and
Amersham International plc.
DIVA Snd6btaiS26
Three DNA fragments of defined sequence were obtained frombacteriophage 6X174 replicative form DNA. Double-stranded 6X174
replicative form DNA was prepared as previously described (Chapter
II) and digested with Haelll, and 194 and 234 base pair fragments
[Z7 and Zs fragments in the map reported by Sanger (75)] were
puriCied. Fragment Z7 was digested with .T!ggl, and was labeled by
extention of the 3' termini with Klenow polymerase in the presenceof [ct-32p]dCTP (76). Fragment Zs was digested with Hinfl and
labeled at the 3' termini in the presence of [ok--32p]d[rTp and
unlabeled dATP and dCTP. Resulting 3Lend labeled 56, 142 and 178
base pair fragments (C436-C4gl, Cgso--Tl121 and C4g2-C66g in the
map reported by Sanger, respectively) were purified by
electrophoresis on a 6% polyacrylamide gel.
-48--
![Page 56: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/56.jpg)
[s'-32p]DNA fragments were obtained by incubatton of the Z7
or Zs fragment with [K'-32P]ATP and T4 polynucleotide kinase.
After digestion with -T!,gg,I or Hinfl, 5Lend labeled 55 and 139 base
pair fragments were purifeid by electrophoresis on a 6% polyacryl-
amide gel.
1?eaction ConaeLtion6
The standard reaction mixture (100 pl) contained 25 mM Tris-
HCI buffer (pH 7.1), O.1 mM mitomycin C, O.5 mM sodium borohydrÅ}deand 3L or 5L32p-labeled DNA fragment [approximately 50 ng
(specific activity 2 Å~ 103 cpm/ng)]. The reaction was started by
the addition of freshly prepared sodium borohydride solution,
carried out for 15 min at 370C and terminated by the addition of 4
pl of O.5 M EDTA, 2 Jil of 1 mglml tRNA, 10 pl of 3 M sodium
acetate (pH 5.2) and followed by ethanol precipitation. The
pellet was rinsed in 709. ethanol, dried and resuspended in 40 pl
of 10 mM Tris-HCI buffer (pH 8.1), and the suspension was heated
The heat-treated DNA was reprecipitated with ethanol, rinsed
in 70% ethanol, dried, and dissolved in 5 pl of 80% (V/V)
formamide--IO mM NaOH loading buffer for gel electrophoresis. DNA
was heat denatured for 1 min at 900C, and loaded on a 107o or 169o
polyacrylamide slab gel for sequence analysis. Electrophoresis '
was at 25 mA. Autoradiography was done on a Fuji RX film at -700C.
QuanLLtattve Sequmc2 AnaZy616 The autoradiorams were scanned with a microdensitometer
(Double-Beam Recording Microdensitometer rvlK III CS•, Joyce Loebl &
Co. Ltd.). The relative position of oligonucleotides produced by
the reaction with reduced mitomycin C and subsequent heat-
treatment were determined by direct comparison with oligonucleo-
-tides produced by the chemical reactions of the Maxam-Gilbert
' -49-
![Page 57: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/57.jpg)
Procedure (77) and by the thymidylate specific reaction which was
newly developed (i,j). The relative amounts of produced oligo-
nucleotides were measured quantitatively as follows: The relative
peak heights on densitometric scans were measured, and normalized
relative to the average height of peaks of products of deoxy-
guanylate specific reaction on the autoradiogram of each
sequencing gel. DNA fragments shorter than 10 base long were
neglected, because they were precipitated inefficiently by ethanol.
AnaZy6Z6 o/ 5' 72imLrzZ
The 5' termini of the fragmbnts resulting from breaks induced
by reduced mitomycin C and subsequent heat--treatment were analyzed
for the presence of a phosphoryl group. For analysis of the 5'
termini of the DNA fragments resulting from dimethyl sulfate
reaction, piperidine treatment in the Maxam-Gilbert procedure was
replaced by hydrolysis with O.1 N NaOH, and followed by pH neutra-
li2ation (78). DNA was precipitated with ethanol and resuspended
in 40 pl of 10 mTvl Tris-HCI buffer (pH 8.1). DNA was heated for 5
min at 900C, and quickly chilled. For dephosphorylation of DNA,10 pl of 10 X CIP buffer [O.5 Tvl Tris-HCI (pH 9.0), 10 mM r"lgC12, 1
mM ZnC12, 10 mM spermidine] and 10 units of calf intesttne
alkaline phosphatase were added, and the mixture was incubated for
30 min at 370C and for 30 min at 560C. The a second aliquat of
the enzyme was added and the incubation was repeated at both
temperatures (76). The reaction was terminated by phenol
extractions and followed by ethanol precipitation. The pelllet
was rtnsed in 709. ethanol, dried and dissolved in 5 pl of loading
buffer for gel electrophoresis.
--. 5O-'
![Page 58: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/58.jpg)
RESULTS
lndLtctZon o,e /leat-LmuZe SZiSe6 Zn D/VA ey 1imc2d R7#omyc-Ln C
To investigate the interaction of mitomycin C with DNA, we
used end--labeled DNA fragments of defined sequence as substrates.
The DNA substrate used in Fig. IV`1 was the 3'-end labeled 142
base pair restriction fragment of 6X174 replicative form DNA
(Cgso-Tll21 in the map reported by Sanger). Oligonucleotides
were clearly detected on the autoradiogram as the products of the
reaction with reduced mitomycin C and subsequent heat-treatment
(Fig. IV-1 lanes 2 and 3). These oligonucleotides were scarcely
produced without heat-treatment (Fig. IV--1 lane 1), and were
produced depending on the time of heat-treatment (Fig. IV-1 lanes
2 and 3). All DNA samples were routinely denatured by heating at
900C for 1 min just before applying to the gel as described in
MATERIALS AND METHODS, but this heating procedure alone was not
enough to cleave mitomycin C-treated DNA. Heat-treatments for 3
or 5 min in Tris-HCI buffer before the denaturation procedure (1
min) were required for chain cleavage of mitomycin C--tr'eated DNA.
No oligonucleotides were produced by reaction with non-reduced
mitomycin C (lane 5) or sodium borohydride alone (Fig. IV--1 lane
6) and subsequent heat--treatment.
.[nhle.ttZon ey O)cygen 12aa"caZ Scavengez6 and P?ezSaZ-CheZatZng Ag2naE6
Oxygen radicals and metal ions are involved in mitomycin C-
tnduced DNA strand scission (18, Chapter I,II,III). The auther
examined the involvement of oxygen radicals and metal ions in the
induction of heat-labile sites by reduced mitomycin C. The DNA
substrate used in Fig. IV-2 was 3'-end !abeled 178 base pair
restriction fragment of 6X174 replicative form DNA (C4g2-C66g in
the map reported by Sanger). Oligonucleotides were produced by
the reaction with reduced mitomycin C and subsequent heat-treat--
-51-
![Page 59: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/59.jpg)
!c', c+T
I,ol,:igTg•,/g
so-
IIiil!,liTiGil
4o.cTCI!illo
TAT
TA CCA
30-T
T• x e
x
8•,
Fig. IV-1. Induction of heat-labile siteq in DNA by reducedmitomycin C. The 142 base pair 3'-end [J`P]labeled DNA wasincubated with O.1 mM mitomycin C and O.5 mM sodium borohydridefor 15 min at 370C. After the reaction, DNA was precipitated withethanol, resuspended in 40 Jil of 10 mM Tris--HCI buffer (pH 8.1)and heated for 3 min (lane 2), and for 5 min (lane 3) at 90eC.The heat-treated DNA was reprecipitated with ethanol, dissolved in5 pl of loading buffer and loaded on a 109o polyacrylamide gel forsequence analysis. Products without heat-•treatment were in lane1. Products of reactions in the presence of 10 mM EDTA, in theabsence of sodium borohydride or mitomycin C, followed by heat-treatment, were in lanes 4, 5 and 6, respectively. Lane 7contains untreated 142 base pair 3Lend labeled DNA. Products ofbase-specific chemical reactions were in lanes CT, GA and G.Sequence was indicated on the left side.
-5'2-
![Page 60: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/60.jpg)
CT GA G1 2345 6
?, iiF,iS•1[il:CIGi2"liii]ll!ilifIA,3•2
AG AGc 4o-IGIgt!]c ' AGTA
G 30- A AT CCAA
A c T 20-T i
l,•
gk\.} gv,:.2fi, lgse S' gl2", .ey
and O.5 mM sodiumsodium benzoate (pHfor 15 min at 370C. DNApended in 40 pl of 10 mMmin at 900C. Theethanol, and analyzed onanalysis. Products ofhydride or mitomycin C,and 5, respectively.base-specific chemical
ee"'
.•Nc •"X'. k$
K.
xxwh"T"
lt
ee.vt
ct( ;•:• .l •'. •(
t .,1. C,. v'
t ,
e
oxygen radical scavengers. The 178 base DNA was incubated with O.1 mM mitomycin Cborohydride (lane 1), in the presence of O.1 M 7.5)(lane 2) or O.1 M DABCO (pH 7.5)(lane 3) was precipitated with ethanol, resus- Tris-HCI buffer (pH 8.1) and heated for 5heat-treated DNA was reprecipitated with a 109. polyacrylamide gel for sequence reaction in the absence of sodium boro- followed by heat-treatment, were in lane 4 Lane 6 contains untreated DNA. Products of reactions were in lanes CT, GA and G.
-53-
![Page 61: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/61.jpg)
ment (Fig. IV-2 lane 1). The production of oligonucleotides were
inhibited by sodium benzoate (Fig. IV-2 lane 2) which scavenges
hydroxyl radical (39), and 1,4--diazablcyclo-[2,2,2]octane
(DABCO)(Fig. IV-2 lane 3) which scavenges singlet oxygen (41).
DABCO completely inhibited the production of oligonucleotides evenat a concentration of 10 mM, and 10' mM sodium benzoate also have
an inhibitory effect (data not shown). EDTA, a metal chelating
agent, also inhibited the production qf oligonucleotides (Fig. IV- ,
1 lane 4). The production of oligonucl.eotides was almost
completely Å}nhibited also by 10 mM diethylenetriamine pentaacetic
acid (DETAPAC), a metal chelating age4t, and partially by 1 mM
DE[rAPAC (data not shown). The high concentrations of these salts
were reported to inhibit the binding bf mitomycin C to DNA (79).
But the inhibitory effect of salts seems negligible when the
inhibitors are used below 10 mM, because 10 mM sodium chloride
did not inhibit the production of oligonucleotides (unpublished
results).
S2qttence Sl?2cZfetc-Lty eJg /le(zt--Lcze.tZe S.Lt26
Autoradiograms tn Figs. IV--1 and 2 made us expect that
reduced mitomycin C induced heat-labile sites preferentially at
specific sequences in DNA. To examine this possibility, The
auther used another DNA substrate (3'--end labeled 56 base pair DNA
fragment)(Fig. IV-3), and scanned autoradiograms in Fig. IV-1, 2
and 3 with a microdensitometer (Fig. IV-4). The relative amounts
of produced oligonucleotides were measured quantitatively as
described in rvlATERIALS AND METHODS, and the relative positions
were determined by direct comparison of the products of mitomycin
C reaction with products of deoxyguanylate specific chemical
reaction (FÅ}g. IV-5). DNA was cleaved at the 3' side of deoxy-
guanosines and of some deoxyadenosines by the heat--treatment of
DNA reacted with reduced mÅ}tomycin C. Reduced mitomycin C induced
heat-labile sites extensively at sequences GGT, GAGGGT and AAGT,
--54-
![Page 62: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/62.jpg)
?,
CTC AT4o- EcTavT[lillTil
30- G c CG T• TT TG 20-X
T
K
2
io-Rt
S,
CT GA G 1 tMe.r.-. "'#S:'•"'l'.. .tt .. ..
•r. Iz•e..,1.• ift.
tt-' tret/s: tltAtt tt
.(, I• fi .1':•"l
ew;..:.ig,.: tw
tti-ttwwtX 'ww
IP.Y,hY.•
" etre.(Rlf
234t.,m•tttt•)1'el.%'Isc..it.'1'""".t.•.'.t',{
+t Ei,
:. k Bv,K.3• ,R.asg,ss.qggnsgrfpsc,-j.f.ii,ltpll,ei.as.tlgE ,ofi,me5sml.;i6:,g,.,
with O.1 mM mitomycin C and O.5 mM sodium borohydride (lane 1),O.1 mM mitomycin C alone (lane 2) or O.5 mM sodium borohydridealone (lane 3). After the reaction, DNA was heated for 5 min at90CC, and the products were analyzed on a 169o polyacrylamide gelas described in MATERIALS AND METHODS. Lane 4 contains untreatedDNA. Products of base-specific chemical reaction were in lanesCT, GA and G. Arrows I, II and III indicate oligonucleotidesdescribed in the text.
followed by at sequences GGC, GT, GAGAGC, AGT, AGGC and GGA. In
dinucleotides sequeces, G-T sequences (especially PuG-T) were
cleaved most extensively by the reaction with reduced mitomycin C
and subsequent heat-treatment.
-55-
![Page 63: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/63.jpg)
A
f r,i
`( ,i IZ'v"e
tl lttL i r. s" s6166 58 SS 54 5e
B
,
46)S
u ItiCr."v,`,l:f.rt:g:.t;.h,.as..,fvv..L.......,bo..-'.L:v7ÅqSl
10.-
-ln?
c
a r,
s90 t35 33 72 fi ",
M'", ,S
lli
tVI
/sl .. NN `-.6C E7 55 52 Se a644 42 4e 3,9
] tl lt Sl
iJ-'rl'
!,V;,N'N',,....S,i"
v7 ]]År6 30 ?7 ?221
35 32
"StN.k A L"J'v.. v
ISt
ltt :l ll
.Llvastsrr
12
IS
Fig. IV-4. (A) Densitometric scans of lanes 3 (Fig; IV-1. (B) Densitometric scan of lanes 1 (Fig. IV-2. (C) Densitometric scan of lanes 1 (Fig. IV-3. Numbers correspond to the position ofln the fragments from the 3' terminus. Arrows I,indicate oligonucleotides described in the text.
)and G (---)in) and G (---) in) and G (--) indeoxyguanylateII and III
-56-
![Page 64: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/64.jpg)
5,-CCCATCTTS-S-S2TTCCTTGCTanCAGATTGG]CG-I
70 60 50 " CTTATTACCATTTCAACTACTCCGGTTATC-3'
il
B: iilll llll tll llls,-cElzl;s;lis;I,gTccTAcAmp, CCAGCGTAsgCATAAIA IC
UIi Hill lt slil ; l" GCAAGCCTCAACGCAGC6ACGAGCACGAGAGCG Cn T
""" ," ; CA-S-I AGCAATCCAAACTTTGTTACT -3, 30 20 !EMc: lll ,, ,l ".5t- CATTCA-G-Si-l TTCTGCC6TTTT fi-GATTTAACCGAA -3t
Fig. IV-5. Sequence specificity of heat-labile sites indticed in3Lend labeled DNA fragment of l42 (A), 178 (B) and 56 (C) basepair long. These fragments were used in Figs. IV-1, 2 and 3.Arrows locate sites determined from the densitometric scans inFig. IV-4. The length of the arrows indicates the realtive extentof cleavage at a particular site as mesured from densitometricscans. Sequences indicated by (C ;) are the sites extensivelycleaved, followed by sequences ( ).
-57-
![Page 65: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/65.jpg)
Sbtactun2 oZ 72m7z•Ln.L oZ the Bnealc(s
The structure of termini of the breaks was analyzed to
investigate the chemical nature of the heat-labile sites induced
by reaction with reduced mitomYcln C. The electrophoretic mobili-
ties of oligonucleotides produced from 3'-end labeled DNA by
reaction with reduced mitomycin C, followed by heat-treatment,
were the same as some of thQse produced by the chemical degrada-
tion with the Maxam--Gilbert procedure (Fig. IV-1,2,3). The
comigration of the products suggested that the 5' termini of the
breaks are phosphorylated (80). To determine the structure of.the 5' termini of the breaks,
the author treated the produceq oligonucleotides with calf
intensine alkahne phosphatase which removes 5'-phosphoryl groups.
Treatment of the products of a dimethyl sulfate (deoxyguanylate
specific) reaction with the enzyme resulted in the retardation of
the electrophoretic mobilities (Fig. IV-6 lane l). Treatment of
the oligonucleotides produced by reaction with reduced mitomycin C
and subsequent heat-treatment resulted in a similar retardation
(Fig. IV-6 lane 4). The retardation bf the electrophoreticmobilities is expected to be due to the removal of 5'--phosphoryl
groups from the oligonucleotides and the resulting change of the
chargelmass ratio of the molecule. These results indicate that
the 5' termini of the oligonugleotides produced by the reaction
wtth reduced mitomycln C and subsequen,t heat-treatment contain
phosphoryl groups.
SbLuofLyz2 oZ 3' 727vnZnt ol th2 B,t2ak6
For analysis of the structure of 3' terminÅ} of the breaks,
5'-end labeled DNA was used. The same strand of the fragment used
in Fig. IV-3 was labeled at the 5' terminus, and used as a
substrate (Fig. IV-7). Oligonucleotides were produced when the
DNA was reacted with reduced mitomycin C and then heat-treated
-58-
![Page 66: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/66.jpg)
l G23 GAww'A..
me
.eegaj'
4e.m
en•+
Fig. IV-6. SNructure of 5' termini of the breaks. The 178 basepair 3Lend[jLP]labeled DNA was reacted with O.1 mM mitomycin Cand O.5 mM sodium borohydride, and subsequently heated for 5 minat 900C. DNA was treated with calf intestine alkaline phosphataseas described in MATERIALS AND METHODS (lane 3). Original productsof the mitomycin C reaction were in lane 2. Products of thedimethyl sulfate reaction, in which piperidine treatment wasreplaced by O.1 N NaOH hydrolysis followed by pH neutralization,were treated with calf intestine alkaline phosphatase (lane 1).Original products of base-specific reactions were in lanes G andGA.
(Fig. IV-7 lane 1). Reduction of mitomycin C and the subsequent
heat-treatment were prerequisite for the production of oligo-
nucleotides (Fig. IV-7 lanes 3 and 2, respectively) as well as in
the reaction of 3'-end labeled substrates. Sodium benzoate, DABCO
and EDTA inhibited the reaction also in this case (data not
shown).
The heat-treatment of the DNA fragment bearing a heat-labile
site results in the production of two oligonucleotides. The
oligonucleotide indicated by arrows I in Fig. IV-7A and B, and
-59-
![Page 67: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/67.jpg)
Fig. IV-7.strand oftermlnus,with O.1heated forMETHODS,gel forin lane 2.hydride or3 and 4, .reactlonslanes 1 (from theArrows I,text.
A ?t
II
i8i
20@ pa c T T A c t 5t
B
CT GA G 1 2 3 4
}.'s,."•xrl•)' :t.,rs
l$r'ft'ti't:'8'
11
ll
N
"'th"f" +llI
4-ll
"I
tM v.,".tz )N4(iil'!es;•AiL,ctAv},tg
,-s..".vV."ASM".
5'-C A T T C AG GCT TCT-3' e 20 Structure of 3' termini of the breaks. the fragment used in Fig. IV-3 was and the 5'-end labeled 55 base pair DNAmM mitomycin C and O.5 mM sodium borohydri 5 min at 900C (lane 1) as described in and the products were analyzed on a 16%sequence analysis. Products without Products of reactÅ}ons in the absence mitomycin C, followed by heat-treatment,respectively. Products of base-specific
were in lane CT, GA and G. (B) )and GA (--). G21, which is the 21st correspods to G37 in Fig. IV-3 in 5t-end, II and III indicate oligonucleotides
(A) The same labeled at the 5' was incubated de. DNA was MATERIALS AND polyacrylamide heat-treatment were of sodium boro- were in lanes chemicalDensitometric scans of nucleotide the fragment. described in the
-60-
![Page 68: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/68.jpg)
that indicated by arrows I in Figs. IV--3 and 4 are considered to
have resulted from the cleavage at a heat-labile sÅ}te. Oligonucleo-
tides indicated by arrows II or arrows III in Figs. IV--3, 4 and 7
are also considered to be resulted from the cleavage at a heat-
labile site. The products from 5'-end labe!ed DNA had lower
electrophoretic mobilities than the dimethyl sulfate-reaction's
products and the formic acid-reaction's products, although the
products from 3'-end labeled DNA had the same mobilities with the
' products of the chemical reactions of the Maxam-Gilbert procedure
(Figs. IV-3 and 4). Broad peaks on the scan of the autoradiogram
of the products from the 5'-end labeled DNA (Fig. IV-7B) suggest
that 3' termini of the breaks do not have simple structures. The
lower electrophoretic mobilities and the broadness of peaks of the
products from the 5'-end labeled DNA were confirmed with another
fragment (5'-end labeled 139 base pair fragment)(data not shown).
DISCUSSION
The author has investigated the interaction of mitomycin C
with DNA using sequencing technique. The results demonstrate that
reduced mitomycin C induces heat-labile sites in DNA at specific
sequences. The breaks occur at the 3' side of deoxyguanosines and
of some deoxyadenosines by heat--treatment of DNA reacted with
reduced mitomycin C. A dinucleotide sequence G-T (especially PuG-
T) is the most preferred for induction of heat-labile sites.
Mono-, di- and trinucleotide of deoxyadenosine are rather
resistant to induce heat-labile sites. DNA sequencing technique
have revealed the sequence specific interaction with DNA of
several antitumor agents, e.g. bleomycin (71,72), neocarzino-
statine (81), hedamycin (82), actinomycin D and netropsin (83).
The sequence specificity of' mitomycin C-DNA interaction reported
in this paper is remarkable to compare with other agents, although
-61-
![Page 69: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/69.jpg)
mitomycin C is a rather small molecule.
Covalent binding of mitomyctn C to DNA is thought to be
preceded by a noncovalent associatÅ}on, presumably of intercalation
type, between DNA and the mitomyein C semiquinone (55). The
association facilitates covalent bond formation between the O-6
position or the 2-amino group of guanine and Cl of mitomycin C
(12,13) . Mitomycin C reduced with sodium borohydride under the
conditions used in this study formed a complex with ca!f thymus
DNA and the binding ratÅ}o was about 100 nucleotides/antibiotic
(Fig. IIX-1). A derivative of mitomycins, 7-methoxy--mitosene,
which can not bind to DNA via the aziridine ring did not induce
heat--labile sites in DNA (Chapter III). These results also
suggest that covalent binding of mitomycin C at Cl position to DNA
is essential for the induction of heat-labile sites.
Substitution at certain sites on bases in DNA, e.g. 7-alkyl-
guanine, increases the rate of hydrolysis of N-glycosidic bond to
yield apurinic sites (84), and then produces strand breaks.
Ivlitomycin C does not alkylate the N--7 position (85), but the O-6
'posÅ}tion or the 2-amino group of guanine residues in DNA (12,13).
It is not known that O-6-alkylguanine produces apurinic sites. The
inhibitory effects of oxygen radical scavengers and metal
chelating agents suggest the involvement of oxygen radicals such
as singlet oxygen and hydroxyl radical in the induction of heat--
labile sites by mÅ}tomycin C. DNA cleavage via mechanism involving
oxygen radicals and metal ions are reported for some antitumor
drugs such as bleomycin and phenanthroline (86). The DNA cleavage
by bleomycin (87,88) and by phenanthroline (89) is considered to
be caused by oxidation of C4' and Cl', respectively, of the deoxy-
ribose moiety. Mitomycin C induces heat-labile sites in DNA, but
does not cleave DNA under the conditions used. [rhe detailed
mechanism of sequence specific induction of heat-labile sites
needs further study.
-62-
![Page 70: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/70.jpg)
1 The author has described that reduced mitomycin C induces DNA
strand scission in covalently closed circular DNA (Chapter
I,II,III). However, the present results demonstrate that the
subsequent heat--treatment is reqired for DNA cleavage in the
reaction wtth DNA fragments of 50 to 200 base pair long. The
mechanism of above two reactions of mitomycin C are closely
resemble each other, e.g. in the inhibitory effects of radical
scavengers and metal chelating agents. As the binding ratio was
about 100 nucleotides/antibiotic under our experimental condi-
tions, more than 50 heat-labÅ}le sites are supposed to be induced
in closed circular phage DNA (6X174 DNA is 5386 base long) if one
bound mitomycin C molecule produces one heat-labile site. The
damage is thought to be very unstable, because the author only
needed short period (3 to 5 min) of heating in neutral pH to
produce strand scission. It is predictable that one of those
damages spontaneously produces strand scission in long DNA
molecules. The hÅ}gher-order structures of DNA such as super-coiling may also involve in the production of st.hnd scission.
TAI02, a new strain for the Salmonella/microsome mutagentcity
test (Ames test) which detects oxidative mutagens with high sensi-
tivity detects also bleomycin and mitomycin C (90). •This suggests
that mutagenicity of those antibiotics involve o'xygen radicals.
[rhe surrounding sequence of mutation site of the strain is AAG-T---
AA. This sequence is interesting because a dinucleotide sequence
GT is one of the most preferred sites for cleavage by bleomycin
(71,72) , and is the most preferred site for induction of heat-
labile sites by reduced mitomycin C. The dinucleotide sequence GT
is also known as the sequence, in the alternatingly repeating
sequence, potentially forming Z-form (91). Poly (dG-dT) sequences
are highly dispersed in the human genome, and could be involved in
the regulation of gene expression (92). Mitomycin C possibly
induces heat-labile sites at specific sequences and causes DNA
--63--
![Page 71: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/71.jpg)
strand scission in cellular DNA.
Lindqvist and Sinsheimer (49) have found that in a HCR-
(host cell reactivation minus) cell the multiplication of diX174 isnot suppressed by mitomycin C, although in a HCR+ cell the
multiplication of 6X174 is suppressed as well as synthesis of hostDNA by mitomycin C. It is suggested that plaque yield in a HCR+
cell after treatment with mitomycin C is reduced through competi-
tion between host DNA and viral DNA replication system because of
dependence of viral DNA replication on some enzymes or sites
involved in host DNA repair system (26). DNA repair system can
not function in HCR- cell by treatment with mitomycin C and the
multiplication of 6X174 is normal. There is no clear elucidation
for why 6X174 DNA is not affected by mitomycin C. One possibility
is that diX174 is not affected by mitomycin C through competition
between large quantities of host DNA and small molecu!ar size of
6X174 DNA. The sequence specificity of the mÅ}tomycin C reaction
may stimulate the difference reactivity between'host DNA and phage
DNA against mitomycin C.
This is the first paper reporting the sequence speciftc
interaction of mitomycin C with DNA, which produce the heat--labile
sites. Although the properties of mitomycin C-DNA complexes have
been eagarly studied (4,55,93), no loss of crosslinked fraction or
no appreciable decrease of molecular weight of DNA was observed
even Å}f those complexes were heated. The differences in the in
vitro activation systems of mitomycin C may be important, namely
other authors used sodium hydrosulfite (Na2S204) under anaerobic
conditions and the author used sodium borohydride under aerobic
conditions. Although it needs further study whether the reported
heat-labile damages play an important role in the actions of
mitomycin C, the heat-lability showed us the sequence specificity
of mitomycin C-DNA interaction. Anyhow it is of biochemical and
chemical interests to reveal the mechanism of sequence specific
-64-
![Page 72: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/72.jpg)
'
mitomycin C-DNA interaction.
-65-
![Page 73: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/73.jpg)
SUMI![ARY
Chapter I Inactivation of Bacteriophage 6X174 by Chemically
Reduced Mitomycin C
Mitomycin C, chemÅ}cally reduced in situ, inactivated
bacteriophage 6X174 which was considered to be resistant to
mitomycÅ}n C. Sodium hydrosulfite in the presence of cupric ion,
and sodium borohydride were useful as reducing agent in the phage
inactivation reaction of mitomycin C. The phage inactivatÅ}on
reaction was dependent on the length of incubation time, the
concentrations of mitomycin C and reducing agents, and pH of
reaction buffer. The phage inactivation was inhibited by EDTA,
catalase and several oxygen radical scavengers such as cysteamine,
2--aminoethylisothiuronium bromÅ}de (AET), Tiron and 1,4--diaza--
bicyclo[2,2,2]octane (DABCO). Inactivated phage sedimented at
llZ"S just as intact phage, but phage DNA was degraded in the
virion, which was detected by sucrose density gradient centrifuga-
tions. Strand scission was also observed when 6Xi74 DNA was
directly reacted with mitomycin C in the presence of sodium
hydrosulfite and cupric ion.
These results suggest that the target molecule of mitomycin C
is DNA, and that chemically reduced mitomycin C Å}nteracts also
with 6X174 single-stranded DNA in proper conditions. Oxygen
radicals such as hydroxyl radical and singlet oxygen, and mitomycin
C semiquinone radical generated during autoxidation of reduced
mitomycin C are supposed to be involved in the strand scission of
phage DNA and subsequent phage inactivation. Metal ions are also
considered to be involved in the reaction.
-- 66-
![Page 74: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/74.jpg)
Chapter II Induction of Strand Scission in Single- and Double-
Stranded DNAs by Mitomycin C
The author examined the direct action of chemically reducedmitomycin C on single- and double-stranded DNAs of phage 6Xl74
using agarose gel electroPhoresis. Mitomycin C induces singlestrand scission in 6X174 single-stranded DNA and double-stranded
RF I DNA in the presence of sodium borohydride or in the presence
of sodium hydrosulfite and cupric ion. DNA strand scission by
mitomycin C reduced with sodium borohydride occurs by a similarmechanism to that by mitomycin C reducedwith sodium hydrosulfite
in the presence of cupric ion. The mechanisms of strand scission
in single- and double-stranded DNAs are similar to each other in
the following respects: (i) the amount of intact DNA decreased in
a similar rate, (ii) oxygen radieals were involved, and (iii)
strand scission •was inhibited by EDTA.
Agarose gel electrophoretic analysis using phage DNAs is
available for investigating the mechanism of substances having DNA
strand scission activity, because it is very convenient and sensitive.
'Chapter III Phage Inactivation and DNA Strand Scission Activities
of Mitomycin Derivatives
' Studies on the DNA strand scission activities of monofunction-
al mitomycins revealed that the Cl position of mitomycin C plays
an important role in the DNA cleavage action. Mitomycin C reduced
with sodium borohydride under the condition used in this study
formed a comp!ex with DNA. These results suggest that the binding
at the Cl position is essential for the DNA cleavage action of
mitomycin C. • Among the examined mitomycin derivatives, 7-aziridino,
7-benzyloxy and 7-N-(2-hydroxyphenyl) derivatives showed the
-67-
![Page 75: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/75.jpg)
remarkably higher phage inactivation and DNA strand scission
activities than mitomycin C. The phage inactivation and DNA
strand scission mechanisms of 7-N--(.R-hydroxyphenyl)mitomycin C
(M-83), which is reported to have a higher antitumor activity
than mitomycin C, were examined in detail. M-83, at one third to
one sixth concentration, showed the same degree of phage inactiva-
tion and DNA strand scission activities of mitomycin C. The
mechanisms of phage inactivation and DNA strand scission by M-83
were similar to those by mitomycin C. M-83 appeared to be reduced
to an active form more readily than mitomycin C, this may cause
the high DNA strand scission activity and the high antitumor
activity of M-83.
The phage PTvl2 inactivation activities of mitomycin derivatives
generally reflect their DNA strand scission activities. The phage
inactivation experiment is supposed to be useful to investigate
the action of substances having DNA strand scission activity, and
for the first screening method of those substances because it wil!
be applicable to crude samples contaminated with DNase.
Chapter IV Sequence Specificity of Heat-Labile Sites in DNA
Induced by Mitomycin C
The sequence specificity of mitomycin C-DNA interaction was
directly determined by using DNA sequencing technique, and by
usipg 3'- or 5Lend labeled DNA fragments of defined sequence as
substrates. DNA was cleaved at the 3' side of deoxyguanosines and
of some deoxyadenosines when DNA was treated with mitomygin C
reduced with sodium borohydride and subsequently heated at 900C
for 5 min. Reduced mitomycin C induced heat-labile sites
extensively at sequences GGT, GAGGGT and AAGT, followed by at
sequences GGC, GT, GAGAGC, AGT, AGGC and GGA. In dinucleotide
-68--
![Page 76: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/76.jpg)
sequences, G-T sequences (especially PuG-T) were cleaved most
extensively by the reaction with reduced mitomycin C and subse-
quent heat-treatment, which was determined by scanning autoradio-
grams with a microdensitometer after gel electrophoresis. Mono-,
di- and trinucleotide of deoxyadenosine are rather resistant to
induce heat-labile sites although mitomycin C has been thought to
bind to adenine residues as well as guanine residues in DNA.
Oligonucleotides produced by heat-treatment after reaction with
reduced mitomycin C contained phosphoryl groups at the 5' termini.
The 3' termini seemed not to have simple structures, judging from
their eiectrophoretic mobilities. Oxygen radicals such as sÅ}nglet
oxygen and hydroxyl radical were possibly involved in the
induction of heat-labile sites.
Xl X2
02 oH;lo2ctY•
wy
cng1
N o' :X3eA G oH;lo2
9NH2
T X4 Xs
s,i pl pU pl pS pJ 3,
J pH 7, 900C, 5 min eqk,Nxim ]Åq)gs,,
Xl X2 X3GT X4 Xs - s'iplpj'i'pxll plpIpi3' ec
-69--
![Page 77: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/77.jpg)
Conclusion
Mitomycin C, chemically reduced in vitro, interacts with DNA
and binds at specific sequences to DNA. Mitomycin C will bind
mainly at the Cl position to guanine residues especially in
trinucleotide sequences PuGT in DNA. Then bound mitomycin C
generates oxygen radicals such as singlet oxygen and hydroxyl
radical during autoxidation of reduced quinone in the presence of
metal ions. Oxygen radicals which are generated extremely near
DNA strands induce heat-labile sites in DNA. The induced heat-
labile lesions are enough unstable to become DNA strand scission
in long DNA molecules with higher--order structures. Mitomycin C,
chemically reduced, induces such lesions in phage DNAs to
inactivate phages.
Mitomycin C, reduced enzymatical!y in the cells, may induce
such lesions at specific sequences in cellular DNA. This action ,of mitomycin C may involve in the antitumor action of mitomycin C.
--- 7 O --
![Page 78: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/78.jpg)
1)
2)
3)
4)
5)
6)
7)
8)
9)
10)
11)
12)
13)
14)
15)
REFERENCES 'Wakaki, S., Marumo, H., Tomioka, K., Shimizu, G., Kato, E.,Kamada, H., Kudo, S., & Fujimoto, Y. (1958) Antibiot. andChemother. 8, 228-240.
Webb, J.S., Cosulich, D.B., Mowat, J.H., Patrick, J.B.,Broshard, R.W., Meyer, W.E., Williams, R.P., Wolf, C.F.,Fulmor, W., Pidacks, C., & Lancaster, J.E. (1962) J. Am. Chem.Soc. 84, 3185.
Shiba, S., Terawaki, A., Taguchi, T., & Kawamata, J. (1958)Biken's J. 1, 179-193. •Szybalski, W., & Iyer, V.N. (l964) Federation Proc. 23, 946-957.
Iyer, V.N., & Szybalski, W. (1963) Proc. NatZ. Sci. U.S.A. 50,355-362.
'Iyer, V.N., & Szybalski, W,. (l964) Science 145, 5.5-58.
Matsumoto, I., & Lark, K.G. (1963) Exptl. Cell Research 32,192-196.
Weiss, M.J., Redin, G.S., Allen, G.R. Jr., Dornbush, A.C.,Lindsay, H.L., Poletto, J•.F., Remers, W.A., Roth, R.H. &Sloboda, A.E. (1968) J. Med. Chem. 11, 742---745.
Kinoshita, S., Uzu, K., Nakano, K., & Takahashi, T. (!971) J.Med. Chem. I4, 109--112.
Mercado, C.M. & Tomasz, lvl. (1972) Antimicrob. AgentsChemother. 1, 73--77.
Weissbach, A., & Lisio, A. (1965) Biochemistry 4, 196-200.
Hashimoto, Y., Shudo, K., & Okamoto, T. (1982) TetrahedronLett. 23, 677-680.
Tomasz, M., Lipman, R., Snyder, J.K., & Nakanishi, K. (1983) J.Am. Chem. Soc. 105, 2059-2063.
Handa, K.,,& Sato, S. (1975) Gann 66, 43-47.
Toma$z, M. (1976) Chem.-Biol. InteractiQns 13, 89-97.
-71-
![Page 79: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/79.jpg)
16)
17)
18)
l9)
20)
2!)
22)
23)
24)
25).
26)
27)
28)
29)
30)
31)
32)
Brown, K., & Fridovich, I. (1981) Arch. Biophem. Biophys. 206,414-419.
Van Hemmen, J.J. & Meuling, W.J.A. (1975) 402, 133-141.
Lown, J.W., Begleiter, A., Johnson, D., & Morgan, A.R. (1976)Can. J. Biochem. 54, 110-!19.
Lown, J.W., & Sim, S.-K. (1977) Biochem. Biophys. Res. Commun.77,1l50-1l57.
Sausville, E.A., Peisach, J., & Horwitz, S.B. (1976) BÅ}ochem.Biophys. Res. Commun. 73, 814-822.
Cone, R., Hasan, S.K., Lown, J.W., & Morgan, A.R. (l976) Can.J. Biochem. 54, 219-233.
White, J.R. (1977) Biochem. Biophys. Res. Commun. 77, 387--391.
Lown, J.W. Sim, S.-K., Majumdar,K.C., & Chang, R.-Y. (1977)Biochcem. Biophys. Res. Commun. 76,705-710.
Szybalski, W., & Iyer, V.N. (1967) in Antibiotics I. Mechanismof Action (Gottlieb, D. and Shaw, P.D., Eds.) pp 211-245,Springer-Verlag, New York.
Borenfreund, E., Krim, M. & Bendich, A. (1965) Virology 25,393-400.
Taketo, A. (1975) J. Gen. Appl. Microbi61. 21, 185-194.
Murata, A., & Kitagawa, K. (1973) Agric. Biol. Chem. 37, 1145--1151. •
Wong, K., Morgan, A.R., & Paranchych, W. (1974) Can. J. Biochem.52, 950-958.
Kashimura, N., Morita, J., & Komano, T. (1979) Carbohydr. Res.70, C3-C7.
Morita, J., Nishida, T. & Komano, T. (1977) Agric. Biol. Chem.41, 567-571.
Fukuda, A., & Sinsheimer, R.L. (1976) J. Virol. 17, 776-787.
Guthrie, G.D. & Sinsheimer, R.L. (1963) Biochim. Biophys.Acta 72, 290-297.
--72-
![Page 80: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/80.jpg)
33)
34)
35)
36)
37)
38)
39)
40)
41)
42)
43)
44)
45)
46)
47)
Adams, M.H. (1959) Methods of study of bacterial viruses,Bacteriophages, pp 450-454, Interscience Publishers, New York.
Newbold, J.E. &. Sinsheimer, R.L. (1970) J. Mol. Biol. 49, 49--66.
Hayatsu, H. & Miller, R.C. Jr., (l972) Biochem. Bigphys. Res.Commun. 46, l20-124.
Tuazon, P.T., & Johnson, S.L. (1977) Biochemistry 16, 1183-1188.
Inoue, M. Hayatsu, H., & Tanooka, H. (1972) Chem.-Biol.Intera'ctions 5, 85-95..'
Greenstock, C.L. & Miller, R.W. (1975) Biochim. Biophys. Acta396, 11-16.
Dorfman, L.M., & Adams, G.E. (1973) in Reactivity of the hydroxylradical• in aqueous solutions, U.S. National Bureau of Standards,U.S. Govt. Printing Office, Washington.
Bielski, B.H.J. & Gebicki, J.M. (1977) in Free Radicals inBiology III (Pryor, W.A., Ed.), pp 40L43, Academic Press, New York.
Ouannes, C. & Wilson, T. (1968) J. Am. Chem. Soc. 90, 6527-6528 .
Barron, E.S.G., Miller, Z.B. & Kalni.tsky, G. (1947) Biochem.J. 41, 62-68.
Someya, A. & Tanaka, N. (1979) J. Antib.iotics (Tokyo) 32, 839-845.
Nagata, C. & Matsuyama, A. (1970) in Prog. Antimicrob.Anticanser Chemother., Proc. Int. Congr. Chemother., 6th, pp 423--427, University of Tokyo Press, Tokyo.
Asada, K., & Kanematsu, S. (1976) Agric. Biol. Chem. 40, 1891-l892.
Pryor, W.A. (1966) in Free radicals pp 135-145, McGraw-Hill,Inc., New York.
Bloomfield, V.A., Crothers, D.M. & Tinoco, I. Jr. (1974) inPhysical Chemistry of Nucleic Acids, pp 420-429, Harper & RoW,New York.
-- 73-
![Page 81: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/81.jpg)
48)
49)
50)
51)
52)
53)
54)
55)
56),
57)
58)
59)
60)
6!)
62)
63)
Rifkind, J.M., Shin, Y.A., Heim, J.M. & Eichhorn, G.L. (1976)Biopolymers 15, 1879-1902.
Lindqvist, B.H. & Sinsheimer, R.L. (1967) J. Mol. Biol. 30,69-80.
Komano, T. & Sinsheimer, R.L. (1968) Biochim. Biophys. Acta
Godson, G.N. & Vapnek, D. (1973) Biochim. Biopys. Acta 299,516-520.
Johnson, P.H. & Grossman, L.I. (1977) Biochemistry 16, 4217-4225.
Been, M.D. & Champoux, J.J. (1980) Nucleic Acids Res. 8, 6129-6142.
Morita, J., & Komano, T. (1983) Agric. Biol. Chem. 47, 11-18.
Tomasz, M., Mercado, C.M., Olson, J. & Chatterjie, N. (1974)Biochemistry 13, 4878-4887.
Kinoshita, S., Uzu, K., Shimizu, M. & Takahashi, M. (1971) J.Med. Chem. 14, 103-108.
Kinoshita, S., Uzu, K., Nakano, K" & Takahashi, M. (1971) J.Med. Chem. 14, 109-112.
Iyengar, B.S., Lin, H.-J., Cheng, L., & Remers, W.A. (1981)J. Med. Chem. 24, 975-981.
Espejo, R.T., & Canello, E.S3 (1968) Virology 34, 738-747.
Salditt, M., Braunstein, S.N., Camerini-Otero, R.D., &.Franklin, R.M. (1972) Virology 48, 259-262.
Franklin, R.M., Salditt, M., & Silbert, J.A. (1969) Virology
'Grossman, L.I., Watson, R., & Vinograd, J. (1974) J. Mol. Biol.86, 271-283.
rvlorita, J., Kashimura, N., & Komano, T. (1980) Agric. Biol.Chem. 44, 883-890.
-7•4-
![Page 82: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/82.jpg)
64)
65)
66)
67)
68)
69)
70)
71)
72)
73)
74)
75)
76)
77)
78)
79)
Morita, J., Kashimura, N., & Komano, T. (1980) Agric. Biol.Chem. 44, 2971-2978.
Tanaka, A., Morita, J., & Komano, T. (1982) Agric. Biol. Chem.46, 1013-1020.
Kobayashi, T., Inaba, M., Tsukagosht, S., Sakurai, Y., Imai,R., & Morimoto, M. (1981) Gann 72, 950-954.
Ekimoto, H., Kuramochi, H., Takahashi, K., Matsuda, A., &
Umezawa, H. (1980) J. Antobiotics 33, 426--434.
Sausville, E.A., Stein, R.W. Peisach, J., & Horwitz, S.B.(1978) Biochemistry 17, 2746--2754.
Takeshita, M., Grollman, A.P. & Horwitz, S.B. (1976) Virology69, 453-463.
'
?wC.h,Wha.•r.Zgt.H.'SD':c.gOid4er2g,r2:giJ:iEi,siPhiiips, F•S• (ig63) science
Takeshita, M., Grollman, A.P., Ohtsubo, E., & Ohtsubo, H.(1978) Proc. Natl. Acad. Sci. U.S.A. 75, 5983-5987.
D'Andrea, A.D., & Haseltine, W.A. (1978) Proc. Natl. Acad. Sci.U.S.A. 75, 3608-3612.
Lloyd, R.S. Haidle, C.W., & Robberson, D.L. (1978) Biochemistry17, 1890-1896.
Mirabelli, C.K., Ting, A., Huang, C.-H., Mong, S., & Crooke,S.T. (1982) Cancer Res. 42, 2779-2785.
Sanger, F., Coulson, A.R., Friedmann, T., Air, G.rvl., Barrell,B.G., Brown, N.L., Fiddes, J.C., Hutchison, C.A., III,Slocombe, P.M., & Smith, M. (!978) J. Mol. Biol. 125, 225-246.
Maniatis, T., Fristsch, E.F. & Sambrook, J. (1982) in MolecularCloning pp97--148, Cold Spring Harbor Laboratory.
Maxam, A.M., & Gilbert, W. (l977) Proc. Natl. Acad. Sci. U.S.A.74, 560-564.
Kross, J., Henner, W.D., Hecht, S.M., & Haseltine, W.A. (1982)Biochemistry 21, 4310-4318.
Lipman, R., Weaver, J., & Tomasz, lvl. (1978) Biochim. Biophys.Acta 521, 779-791.
--75-
![Page 83: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/83.jpg)
80)
81)
82)
83)
84)
85)
86)
87)
88)
89)
90)
91)
92)
93)
Tvlaxam, A.M., & Gilbert, W. (1980)
Hatayama, T., Goldberg,(1978) Proc. Natl. Acad.
Bennett,
Lane,Natl.
G.N. (l982)
M.J.,Acad.
Lawe1y,
Tomasz,
Sigman,j. Biol.
GiJ.
loni,Biol.
Wu,42,
I.H., Sci
Nucleic
Dobrowiak,Sci. U.S.A.
P.D., & Brookes
M. (1970)
D.S.,C'hem.
J.C.80,
Methods
Takeshita,. U.S.A. 75,
Acids Res.
Enzymo1. 65, 499-559.
M., & Grollman,3603-3607.
10,
, & Vournakis,3260-3264.
, P. (1963)
Biochim. Biophys.
4581-4594.
JeN•
Biochem.
Acta
(1983)
J. 89,
213,
Graham, D.R., D'Aurora, V., &254, 12269-12272.
L., Takeshita, M., Johnson,Chem. 256, 8608-8615.
J.C.,1938.
Kozarich,
Uesugi, S.Kobayashi,Series No.
Levin,Ames,
,ShY.,
11,
J.W., & Stubbe,
ida, T., Miyashiro,& Kyogoku, Y. (1982)237-240.
D.E., Hollstein,B.N. (1982) Proc.
Hamada,398.
H.s &
Hamada, H.,Acad. Sci'i
Kaplan,
Kakunaga,
Petrino,U.S.A. 79,
D.J.,
M.,Natl
A. P.
Proc.
127-138.
288-295.
Stern,
F., & Grollman,
J. (1983)
A.M. (1979)
A.P.
Federation
H., Tomita, K., Nucleic Acids
Christman,. Acad. Sci
T. (1982)
(l981)
Proc.
Ikehara, M.,Symposium
M.F., Schwiers, E.A., &. U.S.A. 79, 7445-7449.
Nature
M.G., & Kakunaga,6465-6469.
& Tomasz, M. (1982)
(London)
T. (1982)
Biochemitry 21,
298, 396-
Proc. Natl.
3006-3013.
-- 76-
![Page 84: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/84.jpg)
List of Publications
(a) Inactivation of bacteriophage 6X174 by mitomycin C in the presence of sodium hydrosulfite and cupric ions
' Ueda, K., Morita, J., Yamashita, K., & Komano, T.
Chem.-Biol. Interactions (1980) 29, 145-158.
(b) Actions of mitomycin C reduced with sodium borohydride on bacteriophage dX174 and its single- and double-stranded DNAs
Ueda, K., Morita. J., & Komano, T.
Agric. Biol. Chem. (1982) 46, 1695-1697.
'(c) Induction of single strand scission in bacteriophage 6X174 replicative form I DNA by mitomycin C
Ueda, K., Morita, J., & Komano, T. ' J. Antibiotics (1981) 34, 317-322.
(d) The mechanism of DNA strand scission by redueed mitomycin C
Ueda, K., Morita, J., & Komano, T.
Nucleic Acids Symposium Series (1982) No.11 233-236.
(e) Phage inactivation and DNA strand scission activities of 7-N- (2-hydroxyphenyl)mitomycin C
Ueda, K., Morita, J., & Komano, T.
J. Antibiotics (1982) 35, 1380-1386.
(f) Reduced mitomycin C induces heat-labile sites in DNA at specific sequences
Ueda, K., Morita, J., & Komano, T.
Nucleic Acids Symposiu'm Series (1983) No. 12 99--102.
-77-
![Page 85: BY MITOMYCIN C - 京都大学repository.kulib.kyoto-u.ac.jp/.../1/D_Ueda_Kazumitsu.pdf · 2018-08-02 · INTRODUCTION Mitomycin C is an anticarclnogenic antibiotic that has demonstrated](https://reader033.fdocuments.net/reader033/viewer/2022042010/5e71c50226756d35cf4aa6d4/html5/thumbnails/85.jpg)
(g) Sequence specificity of heat-labile sites induced by mitomycin C
Ueda, K., Morita, J., & Komano, T.
Biochemistry (1984) in press.
(h) Induction of DNA strand breakage by autoxidized unsaturated fatty acids
Morita, J., Ueda, K., Nakai, K., Baba, Y., & Komano, T.
Agric. Biol. Chem. (1983) in press.
(i) A new, convenient method for determining T residue in DNA utilizing photo reaction with amine
Sugiyama, H., Sa,tto, I., Matsuura, T., Ueda, K., & Komano, T.
Nucleic Acids Symposium Series (1983) No. 12 103-!06.
(j) A new procedure for determining thymine residue in DNA sequencing. -Photoinduced cleavage of DNA fragments in the presence of spermine-
Sugiyama, H., Saito, I., Matsuura, T., Ueda, K., & Komano, T.
Submitted to J. Biol. Chem.
-78-