BTG2 Antagonizes Pin1
-
Upload
keith-wheaton -
Category
Documents
-
view
222 -
download
0
Transcript of BTG2 Antagonizes Pin1
-
8/3/2019 BTG2 Antagonizes Pin1
1/14
BTG2 antagonizes Pin1 in response to mitogens andtelomere disruption during replicative senescence
Keith Wheaton, Jennifer Muir, Weili Ma and Samuel
BenchimolDepartment of Biology, York University, 4700 Keele Street,
Toronto, Ontario, Canada M3J 1P3
Summary
Cellular senescence limits the replicative capacity of nor-
mal cells and acts as an intrinsic barrier that protects
against the development of cancer. Telomere shortening
induced replicative senescence is dependent on the ATM-
p53-p21 pathway but additional genes likely contribute
to senescence. Here, we show that the p53-responsive
gene BTG2 plays an essential role in replicative senes-cence. Similar to p53 and p21 depletion, BTG2 depletion
in human fibroblasts leads to an extension of cellular life-
span, and ectopic BTG2 induces senescence indepen-
dently of p53. The anti-proliferative function of BTG2
during senescence involves its stabilization in response to
telomere dysfunction followed by serum-dependent
binding and relocalization of the cell cycle regulator prol-
yl isomerase Pin1. Pin1 inhibition leads to senescence in
late-passage cells, and ectopic Pin1 expression rescues
cells from BTG2-induced senescence. The neutralization
of Pin1 by BTG2 provides a critical mechanism to maintain
senescent arrest in the presence of mitogenic signals in
normal primary fibroblasts.
Key words: BTG2; p53; Pin1; replicative; senescence;
telomeres.
Introduction
In response to many forms of cellular stress, the p53 tumor sup-
pressor protein becomes active and is able to transactivate a
variety of target genes that regulate diverse cellular processes
including: cell cycle progression, senescence, DNA repair,
metabolism and cell survival (reviewed in (Vousden & Lane,2007). Through these processes, p53 protects cells from uncon-
trolled growth and genomic instability that lead to tumor devel-
opment. The divergent biological outcomes of p53 are thought
to be due to differential transcription of p53 target genes.Promoter selection is regulated by posttranslational modifica-
tions of p53 including phosphorylation as well as by the interac-
tion of p53 with various protein cofactors (Vousden, 2006;
Rozan & El-Deiry, 2007).
Primary human fibroblasts have a finite replicative lifespan
that terminates with the acquisition of a phenotype having
distinct morphological and biochemical characteristics termed
replicative senescence (Hayflick, 1965). In this state, the cells
accumulate primarily in the G1 phase of the cell cycle and
remain viable but refractory to mitogenic signals. Thus, replica-
tive senescence acts as an intrinsic barrier against unrestricted
cell growth and provides a mechanism for tumor suppression.Recent studies indicate that senescence is as effective as apopto-
sis in reducing cancer incidence and that senescence bypass is
an important step in the development of cancer (Dimri, 2005;
Collado et al., 2007). At the molecular level, senescent cells
exhibit elevated expression of p21, p16 and cyclin D1, and
increased activity of p53 (Atadja et al., 1995; Vaziri et al.,
1997), Rb (Stein et al., 1999) and PKC d (Wheaton & Riabowol,
2004). Replicative senescence is triggered by critically short telo-
meres. Telomeres are specialized nucleoprotein complexes that
cap and protect the ends of linear chromosomes (Verdun & Karl-
seder, 2007). Telomeres shorten with each round of DNA repli-
cation because of the end-replication problem the inability of
DNA polymerases to completely replicate the 3 end of linear
DNA molecules (Harley et al., 1990). Shortening of telomeric
DNA leads to uncapping of the telomeres, and this is believed to
initiate an ATM-dependent DNA damage response that acti-
vates p53 (Karlseder et al., 2002; Herbig et al., 2004; Stewart &
Weinberg, 2006).
The p53 protein has been implicated as one of the key media-
tors of cellular senescence. In its absence, the replicative capac-
ity of primary fibroblasts is extended 10-30 population
doublings (Hara et al., 1991; Shay et al., 1991; Masutomi et al.,
2003). Cells that bypass senescence as a result of p53 repression
undergo further rounds of cell division even though they con-
tinue to lose telomeric DNA and eventually encounter a secondblock in proliferation known as crisis characterized by massive
cell death. The identity of the transcriptional targets of p53
required to initiate and maintain the senescence phenotype is
uncertain. Although the p53 target gene, p21WAF1, was origi-
nally considered to be central to senescence arrest (el-Deiry
et al., 1993; Noda et al., 1994; Brown et al., 1997), subsequent
studies have questioned whether the protein is essential (Wyllie
et al., 2003) or if it is sufficient alone (Ma et al., 1999; Dulic
et al., 2000). Recently, PAI-1 was identified as a p53-responsive
Correspondence
Keith Wheaton and Sam Benchimol, Department of Biology, York Univer-
sity, 4700 Keele Street, Toronto, Ontario M3J 1P3, Canada. Tel.:
+1 416 736 2100 Ext. 20893 (Keith Wheaton); +1 416 736 2100 Ext.
20726 (Sam Benchimol); fax: +1 416 736 5698; e-mails: kwheaton@
yorku.ca and [email protected]
Accepted for publication 6 June 2010
2010 The Authors
Aging Cell 2010 Blackwell Publishing Ltd/Anatomical Society of Great Britain and Ireland
747
Aging Cell(2010) 9, pp747760 Doi: 10.1111/j.1474-9726.2010.00601.x
Aging
Cell
-
8/3/2019 BTG2 Antagonizes Pin1
2/14
gene that contributes to replicative senescence through its abil-
ity to inhibit the urokinase-type plasminogen activator, leading
to downregulation of PI(3)K-PKB signaling (Kortlever et al.,
2006). Thus, only two p53-responsive genes have been charac-
terized in the senescence program, neither of which can fully
recapitulate p53-dependent senescence. Therefore, we wished
to address the question of what other effector genes were
required for p53-dependent replicative senescence. Wescreened p53 effectors previously described as being involved in
cellular arrest and identified BTG2 and GAdd45a as being highly
upregulated during senescence. Further functional and mecha-
nistic analysis proved that BTG2 had a significant role in the
development of senescence.
BTG2 is a member of the BTGTob family of anti-proliferative
genes and has been implicated in various cellular processes
including cell cycle progression, differentiation and apoptosis.
BTG2 was previously reported to be an effector of p53-depen-
dent proliferation arrest (Rouault et al., 1996) and to act through
repression of cyclin D1 and cyclin E1 mRNA (Guardavaccaro
et al., 2000; Boiko et al., 2006; Kawakubo et al., 2006). BTG2 isinduced by various cellular stresses through p53-dependent and
p53-independent processes (Lim, 2006). The peptidyl-prolyl
isomerase Pin1 regulates diverse cellular processes including cell
cycle progression and apoptosis through its interaction with dif-
ferent phosphoproteins altering their conformation and stability
(Yeh & Means, 2007). Two notable studies reported that Pin1
was required for efficient reentry into the cell cycle in response
to mitogenic stimulation after G0 arrest (Fujimori et al., 1999;
You et al., 2002). Furthermore, Pin1 overexpression has been
correlatedwith oncogenesis (Yeh & Means, 2007).
Here, we show that BTG2 plays a critical role in promoting
p53-dependent replicative senescence in human cells through
its ability to sequester Pin1. This mechanism is unique to primary
cells, because BTG2 has been commonly reported to suppress
cyclin D1 levels in transformed cell lines rather than neutralize
Pin1-mediated cell cycle progression. BTG2 activity during
senescence is regulated at three levels: transcriptional regulation
by p53, protein stabilization in response to telomere disruption
and by mitogenic signaling pathways. Thus, we have further
explored the p53 genetic program leading to senescence by
characterizing the role of BTG2.
Results
Expression of p53-responsive genes in senescence
To investigate the expression of p53 effector genes during cellu-
lar senescence, we measured the transcript levels of p53-
responsive genes previously associated with cellular arrest
including BTG2, TOB1, 14-3-3r , Gadd45a , Reprimo and
p21WAF1. We measured mRNA expression by semi-quantitative
RTPCR (Fig. 1A) in young, cycling Hs68 human fibroblasts at a
mean population doubling (MPD) of 45 and in senescent Hs68
cells (MPD 85). The mRNA levels for BTG2, GADD45a and p21
were elevated during replicative senescence. This upregulation
was not due to cellular quiescence, since these gene transcripts
were not elevated during contact inhibition or serum starvation,
two conditions known to activate p53 (Itahana et al., 2002;
Meerson et al., 2004) (Fig. 1A). We confirmed the upregulation
of BTG2, Gadd45a and p21expression during the development
of senescence by Northern blotting (Fig. 1B) and Western immu-
noblot analysis (Fig. 1C). These results are consistent with previ-
ous reports, indicating that p21 (Noda et al., 1994), Gadd45a
(Jackson & Pereira-Smith, 2006) and BTG2 (Rouault et al., 1996)
are upregulated during replicative senescence. The increased
levels of cyclin D1 served as an additional molecular marker for
cellular senescence (Dulic et al., 1993; Lucibello et al., 1993).
Extension of cellular lifespan by shRNA-mediated
repression of p53, BTG2 and p21
To investigate the dependency of BTG2, Gadd45a and p21
expression on p53 during replicative senescence, we inhibited
p53 expression in BJ and Hs68 fibroblasts using shRNA
(Figs 2A,B and S1). p53 depletion suppressed the induction of
BTG2, p21 and Gadd45a that is normally seen as BJ cells enter
senescence (Fig. 2A,B). p53 shRNA-expressing cells (shp53 cells)
also failed to induce p21 and BTG2 in response to doxorubicin
treatment (Fig. S1A) or c-irradiation (Fig. S1C). As a conse-
quence of sustained p53 inhibition, both BJ and Hs68 cells
escaped senescence and grew an additional 10 MPDs compared
with control cells expressing pSuper vector (Figs 2C and S1B).
Hs68 and BJ fibroblast cell strains were derived from newborn
human foreskin; we have used both cell strains throughout this
study to confirm and validate our findings and have not
detected any differences in their molecular characterization or
behavior in culture.
To assess the contribution of BTG2, p21 and Gadd45a to thesenescence program, we inhibited their expression using shRNA
and developed stable shRNA-expressing BJ cells (shBTG2,
shp21, and shGadd45a cells). The shBTG2 and shGadd45a cells
failed to show an increase in BTG2 and Gadd45a protein,
respectively, at the initiation of senescence and the shp21 cells
exhibited a reduction in p21 protein induction at senescence
(Fig. 2A,B). The replicative potential of these cells was compared
with BJshp53 and BJpSuper control cells. The shp21 and
shBTG2 cells exhibited increased proliferative potential com-
pared with control cells but the extended lifespan was not as
great as the shp53 cells (Fig. 2C). BJ cells expressing shRNA to
both BTG2 and p21 exhibited little if any induction of BTG2 andp21 protein and had an extended lifespan similar to the shp21
cells (Fig. 2C). Thus, inhibition of p21 or BTG2 individually or
together could not fully mimic the loss of p53 with respect to
proliferative potential. The incomplete inhibition of p21 and
BTG2 compared with the efficacy of the shRNA against p53,
however, could account for the differences in replicative poten-
tial of these cells. shGadd45a cells did not exhibit an extended
lifespan and underwent senescence at the same time as
the BJpSuper control cells even though Gadd45a was effec-
tively repressed. This suggested that Gadd45a does not play a
BTG2 neutralizes Pin1 during replicative senescence, K. Wheaton et al.
2010 The Authors
Aging Cell 2010 Blackwell Publishing Ltd/Anatomical Society of Great Britain and Ireland
748
-
8/3/2019 BTG2 Antagonizes Pin1
3/14
significant role in replicative senescence, and as a result,
Gadd45a was not investigated further in this study.
In the course of these studies, we noted that the BJshp53
cells were not immortal (Fig. 2C) and that many cells exhibited
an apoptotic morphology that was consistent with entry into
crisis (data not shown). In contrast, the shp21, shBTG2 and
shp21
shBTG2 cells exhibited a senescence phenotype uponreaching their replicative limit (data not shown).
Reinstatement of senescence in shp53 cells by
ectopic expression of p53RR, BTG2 or p21
The ability of shp53 cells to bypass replicative senescence sug-
gests that one or more p53-responsive genes are required to ini-
tiate the senescence program. To determine whether ectopic
expression of p21, BTG2 or p53 would reinstate the senescence
program in BJshp53 cells that had bypassed their normal repli-
cative endpoint, cDNAs encoding BTG2, p21 and p53RR (resis-
tant to p53 shRNA) were introduced individually by retroviral
infection at MPD 72. Western blot analysis revealed that each of
the cDNAs was expressed in the infected BJshp53 cells and that
p53RR promoted expression of endogenous p21 and BTG2
(Fig. 3A). Moreover, ectopic p53 was phosphorylated on Ser15,
which serves as a marker for p53 activation (Fig. 3A). Impor-tantly, ectopic expression of p21, BTG2 and p53RR led to the
establishment of senescence as measured by the acidic b-galac-
tosidase assay and by the accumulation of cells in the G1 phase
of the cell cycle (Fig. 3B). Similarly, in Hs68shp53 fibroblasts
that had bypassed senescence as a result of p53 repression,
ectopic BTG2 resulted in cell cycle arrest in G1 and b-galactosi-
dase staining indicative of senescence (Fig. 3C). These results
indicate that ectopic expression of BTG2, p21or p53 can
promote senescence in cells that have escaped their normal
replicative endpoint.
(A)
(B) (C)
Fig. 1 Expression of p53 target genes in senescent cells. (A) Expression of various p53 target genes was assessed by semi-quantitative RTPCR. RNA was
extracted from Hs68 fibroblasts that were cycling (MPD 45), contact inhibited (2 weeks), serum starved (48 h) or senescent (MPD 85). RNA levels were normalized
using GAPDH as an internal control. Means and SD of three independent experiments are shown in the histogram. (B, C) Northern blot analysis (B) and Western
blot analysis (C) of p53 target genes; cyclin D1 and p53s15 serve as markers of senescence. RNA and protein samples were obtained from Hs68 fibroblasts that
were cycling (MPD 47), or 728 days afterthe initiation of senescence at MPD 85. The last lane shown in (B) represents RNA obtained from cycling Hs68 cells 3 h
after c-irradiation with 6 Gy. MPD, mean population doubling.
BTG2 neutralizes Pin1 during replicative senescence, K. Wheaton et al.
2010 The Authors
Aging Cell 2010 Blackwell Publishing Ltd/Anatomical Society of Great Britain and Ireland
749
-
8/3/2019 BTG2 Antagonizes Pin1
4/14
Sustained expression of p21 was recently shown to induce an
irreversible senescent-like state in early-passage human fibro-
blasts (Sang et al., 2008). To determine whether BTG2 and p53
could also promote premature senescence in early-passage
fibroblasts, we introduced BTG2 and p53RR cDNAs into young
cells at passage numbers that were well below their established
proliferative limit, BJshp53 cells at MPD 63 or Hs68shp53 cells
at MPD 52. Remarkably, neither BTG2 (Fig. 3D,E) nor p53RR
(Fig. 3D) promoted senescence or inhibited the growth of early-
passage fibroblasts.
To investigate the inability of p53 to promote growth arrest in
early-passage cells, we measured the amount of ectopic p53
and its phosphorylation by Western blotting in early-passage
BJshp53 cells (MPD 65) and in late-passage BJshp53 cells
(MPD 72). The amount of ectopic p53 protein was similar at
both passage numbers but p53 phosphorylation on Ser15 was
only observed at late passage (Fig. 3F), suggesting that p53 is
functionally inactive in early-passage cells. One important differ-
ence between shp53 cells at early and late passage is the pres-
ence of intact protected telomeres in the former and short
disrupted telomeres in the latter. Although shp53 cells bypass
senescence because they lack p53, these cells continue to lose
telomeric DNA until they enter crisis. Thus, one interpretation of
these results is that p53RR is inactive in unstressed low-passage
cells when telomeres are intact and capped; at high passage
number, p53RR is posttranslationally activated by ATM-medi-ated signals emanating from disrupted short telomeres.
The level of ectopic BTG2 protein was low in early-passage
Hs68pSuper and Hs68shp53 cells but increased in the pres-
ence of the proteasome inhibitor MG132 (Fig. 3G), suggesting
that BTG2 protein is normally unstable at early passages. This is
consistent with a previous report showing that BTG2 is rapidly
degraded through the ubiquitin proteasomal pathway (Sasajima
et al., 2002). We expressed BTG2 cDNA in BJshp53 cells before
(MPD 65) and after (MPD 72) their normal replicative limit, and
observed higher levels of BTG2 at MPD 72 compared with MPD
65 (Fig. 3H). The higher level of BTG2 protein at MPD 72 was not
the result of differences in the level of ectopic BTG2 mRNA
(Fig. 3H). As shown earlier in Fig. 2, p53 depletion prevents the
induction of endogenous BTG2 mRNA in these cells. Together,
these results suggest that BTG2 expression is regulated in senes-
cent or late-passage cells through two distinct mechanisms: one
is dependent on p53 and involves transcriptional regulation; the
other is independent of p53and involves protein stabilization. As
BTG2 is stable and functional only in late-passage cells, it is possi-
ble that telomere disruption is also required for BTG2 function.
BTG2 is required for T-oligo-induced senescence
To test the idea that the anti-proliferative effect of BTG2 isdependent on disrupted telomeres, we used an experimental
model in which exogenous oligonucleotides with a sequence
identical to the telomere 3-overhang sequence (T-oligo) are
used to induce senescence artificially in human fibroblasts.
Fibroblasts exposed to the T-oligo were reported to undergo
p53-mediated senescence through a process that resembles the
natural uncapping of telomeres in replicative senescence (Li
et al., 2003). T-oligo treatment induced senescence in BJpSu-
per control fibroblasts, but not in shp53, shp21 and shBTG2 BJ
cells as determined by staining for acidic b-galactosidase
(Fig. 4A) and by cell cycle analysis for G1 arrest (Fig. 4B). Cells
treated with a control oligonucleotide (C-oligo) containing asequence complementary to the T-oligo showed no b-galactosi-
dase staining or G1 arrest (Fig. 4A,B). To support these results,
BJpSuper fibroblasts were treated with T-oligo or C-oligo and
were analyzed over a 2 -week period for the expression of p21,
BTG2 and p53 by Western blotting. The levels of these three
proteins increased initially in response to T-oligo but not C-oligo
treatment, and the amount of BTG2 and p21 remained elevated
2 weeks after T-oligo treatment (Fig. 4C). The accumulation of
BTG2 protein upon T-oligo treatment was also seen by immuno-
fluorescence microscopy (Fig. S2). The amount of p53 protein
(C)(A)
(B)
Fig. 2 p53, p21 and BTG2 shRNA-expressing cells have an extended proliferative lifespan. (A, B) Western blot analysis of BJ cells expressing various shRNAs
directed to p53 and its targets p21, BTG2 and GADD45a at MPD 65 (cycling, presenescent) and at later MPDs as indicated. pSuper represents BJ cells transfected
with the empty pSuper vector. (C) Measurement of the number of mean population doublings over the lifespan of BJ cells expressing various shRNAs as indicated.
For each shRNA-expressing cell strain, the mean SD of three independent cultures is shown. See also Fig. S1. MPD, mean population doubling.
BTG2 neutralizes Pin1 during replicative senescence, K. Wheaton et al.
2010 The Authors
Aging Cell 2010 Blackwell Publishing Ltd/Anatomical Society of Great Britain and Ireland
750
-
8/3/2019 BTG2 Antagonizes Pin1
5/14
returned to basal level over a 2 -week period but the activated,
Ser15 phosphorylated form of p53 remained elevated in T-oli-
go-treated BJ cells. These results indicate a role of p21 and BTG2
in the p53-dependent senescence pathway induced naturally bytelomere shortening or artificially by treatment with T-oligo.
Next, we asked whether ectopic BTG2 could sensitize shp53
cells to undergo T-oligo-induced senescence. BTG2-expressing
Hs68shp53 cells at MPD 52 exhibited a senescent morphology
and stained for b-galactosidase upon addition of T-oligo but not
C-oligo (Fig. 4D). Notably, the level of ectopic BTG2 protein
in the shp53 cells increased upon T-oligo treatment (Fig. 4E). In
addition, cyclin D1 levels increased upon T-oligo treatment in
BTG2-expressing shp53 cells, providing further support for entry
into senescence. Residual p53 activity is unlikely to contribute to
senescence induced by BTG2 in shp53 cells because we do not
detect the Ser15 phosphorylated form of p53 nor p21 induction
in these cells after T-oligo treatment (Fig. 4E) or after DNA dam-
age (Fig. S1A,C). These data support the view that uncappedtelomeres represent the senescent-specific signal that promotes
BTG2 stabilization and anti-proliferative activity.
BTG2 binds and colocalizes with Pin1 in senescent
fibroblasts
Having found that BTG2 is a key effector of telomere-dependent
replicative senescence and T-oligo-induced senescence, we next
wanted to identify downstream effectors. Previous reports
suggested that BTG2 represses cyclin D1 (Guardavaccaro et al.,
(A) (B)
(C)(D) (E)
(F) (G) (H)
Fig. 3 BTG2, p21 and p53 can reinstate senescence in p53 shRNA-expressing cells. (A) p53 shRNA-expressing BJ cells (BJshp53) at MPD 72 were infected with
the indicated retroviral expression constructs or with the empty pBabe vector. Western blot analysis was performed with the indicated antibodies 1 week afterinfection. p53RR represents a p53 retroviral construct that is resistant to p53 shRNA. b-actin serves as a loading control. (B) Representative cell cycle profiles
obtained by flow cytometry after propidium iodide staining of BJshp53 cells 2 weeks after infection with the indicated retroviral constructs. The G1S ratios were
determined from the cell cycle profiles of cells from four independent viral infections. Staining for senescence-associatedb-galactosidase was performed on
BJshp53 cells 2 weeks after retroviral overexpression of BTG2, p21 or p53RR. (C, D) Cell cycle profiles and b-galactosidase staining of p53 shRNA-expressing Hs68
cells (Hs68shp53) at MPD 90 and BJshp53 cells at MPD 63. (E) Growth curve of Hs68pSuper or Hs68shp53 cells after retroviral expression of BTG2 or the
pBabe.hygro control vector (MPD 57). Each cell strain was initially seeded at 50 000 cells and counted every day over a 6 -day period. (F) Western blot analysis of
p53 and phospho-p53 S15 in BJshp53 infected with p53RR at MPD 65 and MPD 72. (G) Cells as in (E) were treated with MG132 for 1 h before harvesting for
Western blot analysis of BTG2. (H) Ectopic BTG2 protein and RNA expression in BJshp53 cells after retroviral infection with a BTG2 cDNA expression constructs at
MPD 65 or MPD 72. MPD, mean population doubling.
BTG2 neutralizes Pin1 during replicative senescence, K. Wheaton et al.
2010 The Authors
Aging Cell 2010 Blackwell Publishing Ltd/Anatomical Society of Great Britain and Ireland
751
-
8/3/2019 BTG2 Antagonizes Pin1
6/14
2000; Boiko et al., 2006; Kawakubo et al., 2006) and cyclin E
expression (Lim et al., 1998). We show, however, that cyclin D1
is highly expressed and that cyclin E expression is unchanged
during senescence (Figs 1B,C and 4E). Thus, it is unlikely that
BTG2 promotes replicative senescence through suppression of
cyclin D1 and cyclin E. BTG2 was also reported to serve as a reg-
ulator of Pin1 nuclear export in transformed human cells (Hong
et al., 2005). To test the possibility that BTG2 might sequester
Pin1 in the cytoplasm of senescent cells and neutralize its func-tion, we expressed a mutant BTG2 protein (BTG2 S147A) that is
unable to interact with Pin1 (Hong et al., 2005) in late-passage
BJshp53 cells and tested whether this mutation prevented
BTG2 from inducing senescence. Unlike wild-type BTG2, BTG2
S147A was unable to promote senescence in shp53 cells that
had bypassed their normal replicative limit (Fig. 3B). Next, we
examined the interaction of BTG2 with Pin1 in young and senes-
cent Hs68 cells by coimmunoprecipitationWestern blot analy-
sis. As the binding of Pin1 to BTG2 requires ERK12-dependent
phosphorylation of BTG2 on Ser147 (Hong et al., 2005), we
deprived the cells of serum for 72 h and stimulated with serum
for 24 h prior to cell harvesting. The levels of both Pin1 and
BTG2 protein were elevated in senescent cells compared with
young cells and these levels were unaffected by serum (Fig. 5A).
BTG2 coimmunoprecipitated with Pin1 in both young and
senescent cells, and the binding between these two proteins
was greatly enhanced after serum stimulation (Fig. 5B).
Together, these data indicate that BTG2 binds to Pin1 and they
suggest that the interaction of these proteins could be impor-tant for the induction of senescence by BTG2.
BTG2 promotes nuclear export of Pin1
Next, we examined the expression and localization of endoge-
nous Pin1 and BTG2 in young and senescent Hs68 cells by con-
focal microscopy. We deprived the cells of serum for 72 h and
stimulated with serum for 24 h prior to immunostaining. As
expected, young cells had no detectable BTG2 protein
expression and showed nuclear Pin1 staining regardless of
(A) (D)
(E)(B)
(C)
Fig. 4 BTG2 is required for T-oligo-induced senescence. (A, B) BJ cells expressing the indicated shRNAs were treated with a single dose of T-oligo (40 lM), C-oligo
(40 lM), or vehicle (H2O). After 2 weeks, cells were fixed and stained for b-galactosidase (A) or propidium iodide and analyzed by flow cytometry (B). Cells were
collected at similar densities to ensurethe measured growth arrest was not because of contact inhibition. TheG1S ratio was determined for three independentexperiments. (C) Western blot analysis of p53, p53 Ser-15, p21 and BTG2 in BJpSupercells after treatment with T-oligo, C-oligo or vehicle at the times indicated.
(D) b-galactosidase staining of Hs68shp53 cells expressing BTG2 or empty pBabe vector, 2 weeks after treatment with T-oligo, C-oligo or vehicle at MPD 52. (E)
Western blot analysis of p53 and BTG2 in Hs68shp53 expressing BTG2 after oligo treatment at the times indicated. MPD, mean population doubling.
BTG2 neutralizes Pin1 during replicative senescence, K. Wheaton et al.
2010 The Authors
Aging Cell 2010 Blackwell Publishing Ltd/Anatomical Society of Great Britain and Ireland
752
-
8/3/2019 BTG2 Antagonizes Pin1
7/14
serum stimulation. In serum-starved senescent cells, Pin1 was
expressed primarily in the nucleus and BTG2 was expressed dif-
fusely in the nucleus and cytoplasm. Upon serum stimulation,
however, 4555% of cells examined showed cytoplasmic stain-
ing for Pin1 that colocalized with BTG2 (Fig. 5C). The cellular
redistribution of Pin1 and its colocalization with BTG2 in the
cytoplasm were also observed when cells were induced to
undergo senescence using T-oligo (Fig. S2).
To determine whether ectopic BTG2 affects the localization of
endogenous Pin1, we expressed BTG2 and BTG2 S147A in late-
passage BJshp53 cells and monitored expression by immuno-
fluorescence microscopy (Fig. 6). Endogenous Pin1 is predomi-
nantly nuclear in unstimulated cells, while ectopic BTG2 and
BTG2 S147A were expressed diffusely in both the cytoplasm
and the nucleus of BJshp53 cells. Upon serum stimulation of
BTG2-expressing cells but not BTG2 S147A-expressing cells,
Pin1 redistributed and colocalized with BTG2 in the cytoplasm.
Nearly all serum-stimulated cells showed colocalization of BTG2
and Pin1. In contrast, there was minimal colocalization of BTG2
S147A with Pin1 (Fig. 6). These results suggest that BTG2 pro-
motes senescence in shp53 cells through binding and nuclearexport of Pin1 and that the neutralization of Pin1 contributes to
cellular senescence.
Pin1 inhibition leads to senescence in p53
knockdown cells that have bypassed their normal
proliferative limit
If the primary role of p53-induced BTG2 expression is to neutral-
ize Pin1, we reasoned that Pin1 inhibition should lead to senes-
cence in shp53 cells. Because these cells fail to induce BTG2
expression (Fig. 2A) and have an extended lifespan, they provide
a good experimental model to investigate Pin1 function in the
absence of BTG2. Pin1 promotes S phase entry in response to
mitogenic stimulation (Fujimori et al., 1999; You et al., 2002);
hence, we cultured BJshp53 cells at MPD 67 or 73 in serum-
free media for 48 h and stimulated with serum for 24 h in
the absence or presence of the Pin1 inhibitor, diethyl-1,3,
6,8-tetrahydro-1,3,6,8-tetraoxobenzo[lmn][3,8]phenanthroline-
2,7-diacetate (PiB). Cell cycle progression was monitored by
propidium iodide staining and flow cytometry. Unexpectedly,
we observed that Pin1 was required for entry into S phase in the
late-passage cells but not in the early-passage cells (Fig. 7A).
PiB-treated late-passage cells (but not early-passage cells) accu-
mulated in G0G1 and stained for b-galactosidase indicative of
a senescence phenotype (Fig. 7B). Because pharmacological
inhibition of Pin1 with PiB could have nonspecific or off-target
effects, we used shRNA specific for Pin1 to knockdown its
expression. shRNA-mediated knockdown of Pin1 reduced the
level of endogenous Pin1 in early- (MPD 63) and late-passage
(MPD 73) BJshp53 cells (Fig. 7C). Pin1 knockdown did not
decrease the proliferative activity of early- or late-passageBJshp53 cells in culture. Serum starvation of BJshp53 and
BJshp53shPin1 cells at early and late passage resulted in
G0G1 arrest without any evidence of b-galactosidase staining
even after 2 weeks in serum-free media (Fig. 7D, upper panel).
Upon serum stimulation, however, only the late-passage
BJshp53shPin1 cells failed to enter S phase and stained for
b-galactosidase (Fig. 7D, lower panel). Hence, Pin1 inhibition
using PiB or shRNA reveals a role of Pin1 in promoting S phase
entry only in late-passage human fibroblasts. Moreover, late-
passage shp53 cells that are unable to enter S phase from
(A)
(B)
(C)
Fig. 5 BTG2 binds and colocalizes with Pin1 in senescent fibroblasts. (A and B) CoimmunoprecipitationWestern blot analysis of Pin1 and BTG2 in young (MPD
52) and senescent Hs68 fibroblasts (MPD 84). Cells were serum starved (SS) for 72 h or serum stimulated for 24 h. Panel A shows total levels of Pin1 and BTG2 byWestern blot analysis and panel B shows the coimmunoprecipitationWestern blot. (C) Immunofluorescence staining of Pin1 and BTG2 in Hs68 cells, young (MPD
50) and senescent (MPD 82). Cells were serum starved for 72 h or serum stimulated for 24 h prior to fixation. 4555% ofcells examined showed cytoplasmic
staining for Pin1 that colocalized with BTG2 after serum stimulation. Nuclear counterstaining used Draq5. Images show a single optical layer of a confocal image
at 400 magnification. See also Fig. S2. MPD, mean population doubling.
BTG2 neutralizes Pin1 during replicative senescence, K. Wheaton et al.
2010 The Authors
Aging Cell 2010 Blackwell Publishing Ltd/Anatomical Society of Great Britain and Ireland
753
-
8/3/2019 BTG2 Antagonizes Pin1
8/14
G0G1 because of Pin1 inhibition are redirected into a senes-
cence program upon mitogenic stimulation.
Exogenous expression of Pin1 rescues BTG2-
mediated senescence in late-passage cellsBecause Pin1 inhibition leads to senescence and BTG2 expres-
sion promotes senescence in late-passage cells, possibly through
its interaction with Pin1, we tested whether ectopically
expressed Pin1 could prevent BTG2-induced senescence in
shp53 cells. Pin1 was coexpressed with BTG2 in late-passage
shp53 cells (Fig. 8A). Approximately 80% of the cells expressing
BTG2 alone exhibited b-galactosidase staining and flattened
morphology typical of senescent cells when compared with
10.4% of control shp53 cells infected with empty vector. Coex-
pression of Pin1 and BTG2 resulted in only 17.5% of the cells
staining for b-galactosidase (Fig. 8B). These results show that
Pin1 expression can rescue cells from BTG2-dependent senes-cence and serve to demonstrate a functional relationship
between BTG2 and Pin1.
Discussion
The repression of p53 by shRNA allows normal human fibro-
blasts to bypass their normal replicative limit. While this demon-
strates that p53 activation is a critical step in the development of
senescence, the downstream p53 effectors required to induce
senescence have not been fully established. In this study, we
show that the p53-responsive gene BTG2 plays an essential role
in replicative senescence and in T-oligo-induced senescence (an
oligonucleotide-based model that mimics the natural uncapping
of telomeres during replicative senescence). Endogenous BTG2
protein levels rise during replicative and T-oligo-induced senes-
cence and shRNA-mediated repression of BTG2 extends prolifer-ative lifespan and prevents T-oligo-induced senescence.
Moreover, ectopic BTG2 promotes senescence in cells that have
bypassed their normal replicative limit because of shRNA-medi-
ated silencing of p53 and restores the sensitivity of shp53 cells
to undergo T-oligo-induced senescence. These results demon-
strate that BTG2 can act independently of p53 to induce senes-
cence in response to dysfunctional telomeres.
One striking observation is the ability of ectopic BTG2 or p53
to promote senescence in shp53 cells that have bypassed their
normal replicative limit and their inability to promote senescence
in early-passage cells that have not yet reached their normal pro-
liferative limit. This is unlike p21, which is capable of arrestingcells at any point during their replicative lifespan (Sang et al.,
2008). We find that ectopic BTG2 protein is unstable in young
cells and that BTG2 protein accumulates at higher passage
number. One possible explanation is that uncapped telomeres
activate a signaling pathway that promotes BTG2 protein
stabilization. The activation of ectopic p53 in late-passage but
not early-passage cells is likely because of telomere-dependent
ATM activation. We find that ectopic p53 is expressed at similar
levels in early- and late-passage shp53 cells but that p53 Ser15
phosphorylation and p53 target gene expression (p21, BTG2)
Fig. 6 The BTG2 A147S mutant does not colocalize with Pin1. BJshp53 cells beyond their normal replicative limit were retrovirally infected with BTG2 or BTG2
A147S expression constructs and selected with hygromycin. Cells were serum starved for 72 h or serum stimulated for 24 h, fixed and analyzed by immuno-
fluorescence staining for BTG2 and Pin1. Nuclear counterstaining used Draq5. Images show a single optical layer of a confocal image at 400 magnification.
BTG2 neutralizes Pin1 during replicative senescence, K. Wheaton et al.
2010 The Authors
Aging Cell 2010 Blackwell Publishing Ltd/Anatomical Society of Great Britain and Ireland
754
-
8/3/2019 BTG2 Antagonizes Pin1
9/14
occur only in late-passage cells. Because telomeres continue to
shorten in late-passage shp53 cells leading to crisis, the ATM
pathway is expected to remain active but incompetent at pro-
moting senescence in the absence of p53. A similar telomere
dysfunctionDNA damage sensing pathway is likely to be play-
ing a role in the stabilization of BTG2 in late-passage cells.
In addition to protein stabilization, BTG2 activation is depen-
dent on mitogenic stimulation resulting in phosphorylation on
Ser147. The dual regulation of BTG2 function in response to
telomere disruption and mitogenic stimulation provides tight
control over BTG2 expression at senescence. Moreover, thetranscriptional regulation of BTG2 expression by p53 provides a
third level of control to ensure that BTG2 levels remain elevated
during senescence (see model, Fig. 8C).
We demonstrate that BTG2 promotes senescence through its
ability to bind and sequester Pin1. We show that Pin1 inhibition
leads to senescence in late-passage cells and that ectopic Pin1
expression rescues cells from BTG2-induced senescence. Taken
together, our findings indicate that BTG2 and Pin1 interact phys-
ically and functionally in senescence. The mitogen-dependent
binding and colocalization of BTG2 with Pin1 during senescence
suggest a model in which BTG2 promotes senescence by redis-
tributing Pin1 in the cytoplasm and preventing Pin1 from inter-
acting with proteins required for cell cycle progression. This is
consistent with previous reports showing that Pin1 is required
for mouse primary cells to escape quiescence in response to
serum (Fujimori et al., 1999; You et al., 2002). Our results with
human fibroblasts using PiB to inhibit the catalytic activity of
Pin1 and shRNA to reduce endogenous Pin1 indicate that Pin1 is
required for S phase entry only in late-passage cells. Inhibition of
Pin1 leads to senescence in p53 knockdown cells only after
these cells are prompted to reenter the cell cycle with serumafter being held in G0G1 by serum deprivation. It is notable
that senescent cells do not proliferate in response to mitogenic
stimulation even though mitogenic signaling pathways are
intact (reviewed in (Wheaton et al., 1996). Moreover, persistent
mitogenic stimulation is required for the development of the
senescent phenotype (Satyanarayana et al., 2004). As Pin1 pro-
motes S phase entry in response to mitogenic stimulation, these
findings suggest that the interaction between BTG2 and Pin1
provides a mechanism to neutralize Pin1 function to ensure
that senescent cells remain in G1 in the presence of mitogenic
(A) (D)
(B)
(C)
Fig. 7 Pin1 inhibition leads to senescence in late-passage quiescent cells stimulated to reenter the cell cycle. (A) The G1S ratios of BJshp53 cells, 24 h after
serum stimulation in the presence or absence of the Pin1 inhibitor, PiB (20 lM). (B) b-galactosidase staining of BJshp53 cells, 2 weeks after serum stimulation in
the presence of absence of PiB. The PiB in the culture medium was replenished every second day. (C) Western blot analysis of Pin1 expression in BJshp53 cells
expressing shRNA directed to Pin1 or empty pSuper vector (pS) at MPD 63 or 73. (D) Upper 2 panels: The cell cycle profiles of BJshp53 cells and BJshp53shPin1
cells, 72 h after serum withdrawal. The b-galactosidase staining of the cells, 2 weeks after serum withdrawal is shown immediately below. Lower 2 panels: The cell
cycle profiles of BJshp53 cells and BJshp53shPin1 cells stimulated with serumfor 24 h following serum starvation for 48 h. The b-galactosidase staining of the
cells, 2 weeks after serum stimulation, is shown at the bottom. MPD, mean population doubling.
BTG2 neutralizes Pin1 during replicative senescence, K. Wheaton et al.
2010 The Authors
Aging Cell 2010 Blackwell Publishing Ltd/Anatomical Society of Great Britain and Ireland
755
-
8/3/2019 BTG2 Antagonizes Pin1
10/14
signals. Three observations support this idea: first, binding to
Pin1 requires MAPK-dependent phosphorylation of BTG2 on
Ser147 (Hong et al., 2005); second, the BTG2 S147A mutant
protein is unable to induce senescence in late-passage shp53
and is defective in promoting Pin1 nuclear export; and third,
ectopic Pin1 expression rescues cells from BTG2-induced senes-
cence. In this model, p53-dependent induction of p21 initiates
senescence by arresting cells in G1 and p53-dependent induc-
tion of BTG2 inhibits Pin1, ensuring that cells remain in G1 dur-
ing mitogenic stimulation. Although our study does not identify
the Pin1 substrates that regulate S phase entry and senescence
in late-passage cells, several candidates, among the manyknown Pin1 targets, may be considered including cyclin D1, cy-
clin E, b-catenin, Rb and Myc (Yeh & Means, 2007).
Previous studies reported that Pin1 functions as a positive
regulator of p53 through an interaction that is dependent on
DNA damageinduced p53 phosphorylation on several sites
including Ser 33, Thr 81 and Ser 315 (Zacchi et al., 2002;
Zheng et al., 2002), and yet our studies suggest that Pin1 must
be inhibited during p53-dependent senescence. This could
reflect temporal regulation of Pin1 during senescence, because
Pin1 has been shown to have a dual role in regulating both
p53 activity and cell cycle progression. Pin1 protein accumu-
lates at senescence and may be required to activate p53; how-
ever, upon activation of signaling cascades by serum, Pin1
needs to be neutralized to maintain G1 arrest. Pin1 in senes-
cent cells is inactivated through interaction with BTG2 to block
activation of target phosphoproteins required for cell cycle
progression. Thus, BTG2 becomes a significant Pin1 substrate
only when cells are mitogenically stimulated to enter S phase.
At other times in the cell cycle, Pin1 is free to interact with all
its substrates including p53. It should also be noted that the
involvement of Pin1 in regulating p53 is complex, being
dependent on cell and tissue type; moreover, the requirementfor Pin1 differs on different p53-responsive genes (Zacchi
et al., 2002; Zheng et al., 2002). The Pin1-p53 interaction has
been studied primarily in established cell lines treated with
DNA damaging agents and the role of Pin1 in enhancing the
transcriptional activation of p53-regulated genes during repli-
cative senescence is not known.
Recently, TRF1 was reported to be a substrate for Pin1, and
the interaction between Pin1 and TRF1 was shown to regulate
telomere length in telomerase-positive transformed human cells
(Lee et al., 2009). Upon Pin1 inhibition, TRF1 protein stability
(A) (B)
(C)
Fig. 8 Exogenous expression of Pin1 rescues late-passage shp53 cells from BTG2-mediated senescence. (A) p53 shRNA-expressing BJ cells (BJshp53) at MPD 72
were infected with the indicated retroviral expression constructs or with the empty pBabe vector. Western blot analysis was performed with the indicated
antibodies 1 week after infection. b-actin serves as a loading control. (B) Staining for senescence-associatedb-galactosidase was performed on BJshp53 cells
2 weeks after retroviral expression of BTG2 and Pin1. (C) Model showing the involvement of BTG2 during p53-dependent replicative senescence. p53 induces
BTG2 mRNA expression. BTG2 protein is stabilized downstream of telomere-dependent signals and undergoes phosphorylation on Ser147 in response to
mitogenic stimulation. Phosphorylated BTG2 binds Pin1 and promotes the nuclear export of Pin1. In this model, replicative senescence is dependent on telomere
disruption, p53 activation and mitogenic stimulation. The model does not exclude the possibility that p53 promotes expression of other responsive genes such as
p21 and PAIthat function collectively to induce senescence. MPD, mean population doubling.
BTG2 neutralizes Pin1 during replicative senescence, K. Wheaton et al.
2010 The Authors
Aging Cell 2010 Blackwell Publishing Ltd/Anatomical Society of Great Britain and Ireland
756
-
8/3/2019 BTG2 Antagonizes Pin1
11/14
increased resulting in enhanced binding of TRF1 to telomeres
and gradual telomere erosion in transformed cells. Pin1 knock-
down, however, had no effect on telomere length in telomer-
ase-negative normal human cells including human fibroblasts.
Hence, there is no evidence for the TRF1Pin1 interaction play-
ing a role in telomere shortening during normal replicative
senescence, and it is unclear whether Pin1 affects TRF1 stability
in normal human cells.Several studies using transformed cells report that BTG2 pro-
motes cell cycle arrest through suppression of cyclin D1 (Guarda-
vaccaro et al., 2000; Boiko et al., 2006; Kawakubo et al., 2006)
or cyclin E expression (Lim et al., 1998). In one study, BTG2 was
reported to contribute to Ras-induced senescence in fibroblasts
through suppression of cyclin D1 and E levels (Boiko et al.,
2006). Consistent with previous reports, we found that neither
of these cyclins was suppressed during replicative senescence in
human fibroblasts. We provide an alternative mechanism in
which BTG2 temporally antagonizes Pin1 function in response
to serum. Thus, senescence induced in response to eroded
telomeres or oncogenic stress requires BTG2, but the mecha-nisms are divergent. This may reflect differences between nor-
mal and transformed cells or differences between telomere-
dependent replicative senescence and telomere-independent
oncogene-induced senescence. Furthermore, oncogenic Ras
delivers constitutive and deregulated signals for proliferation,
whereas mitogens and growth factors deliver physiological
signals to regulate cell cycle progression. Hence, BTG2-mediated
cyclin D1 repression may be restricted to transformed cells while
the interaction between BTG2 and Pin1 may be favoured in
normal cells. The ability of BTG2 to neutralize Pin1-mediated
entry in S phase is unique to normal senescent cells.
Our study reveals a critical role for BTG2 in imposing the p53-
dependent senescence barrier that limits the proliferative capac-
ity of human cells. The interaction of BTG2 with Pin1 promotes
its relocation and neutralizes its function. The inability of Pin1 to
modify nuclear proteins required for S phase entry contributes
to the senescence program of human fibroblasts.
Experimental procedures
Plasmid constructs
The shRNA constructs were created using hairpin inserts with
BglII and XhoI and ligated into pSUPER.retro.puro (Brummelk-
amp et al., 2002). The shRNA target sequences included: p53,GACTCCAGTGGTAATCTAC; p21, GGTGACTTCGCCTGGGAG-
CGT; BTG2, CTACGTGATGGCAGTCTCC; GADD45a, AG-
TCGCTACATGGATCAAT; and Pin1, GCCGAGTGTACTACTT-
CAA. cDNAs for human p21, BTG2 and Pin 1 were generated by
PCR using the primers: ggaattcatgtcagaaccggctgg and cag-
cgtcgacttagggcttcctctt for p21, catgagccacgggaag and atggca-
gtctccagctagg for BTG2, and cgggatcccatggcggacgagg
agaaagct and ggaattcctactcagtcggaggatga for Pin1. These
products were cloned into pBabe.hygro or pBabe.zeo using
BamHI and EcoRI.
The p53RR construct was generated using 2 sets of primers
that amplified the human p53 cDNA and overlapped in the
region targeted by the shRNA (nt 775793 from the translation
initiation site). The primers were designed to change the
sequence of the p53 cDNA in the shRNA target region without
changing the amino acid sequence. The 5-terminal fragment
was amplified using cgggatccCATGGAGGAGCCGCAGT and
CAAGTTGCCCGAGCTATCTTCCAGTGTGATGATGGTG, and the3-terminal fragment was amplified using TAGCTCGGGCA-
ACTTGCTGGGACGGAACAGCTTTG and ggaattcGAGTCAG-
TCTGAGTCAGG (underlined italics show the overlapping
sequences that differ from wild-type p53 and lower case letter-
ing indicates BamHI and EcoRI sites). A third PCR utilized the
purified products of the first two reactions as both substrate and
primer to generate full-length p53RR with silent nucleotide
changes in the 775793 region. The full-length product was
digested with BamHI and EcoRI and cloned into pBabe.hygro.
All constructs were verified by automated sequencing.
Cell culture and retroviral infection
Hs68 and BJ human fibroblast cell strains were maintained as
previously described (Wheaton & Riabowol, 2004). The fibro-
blasts were infected with amphotropic isotyped virus (Phoenix-A
packaging cells) containing the ecotropic receptor (pm5-Eco)
and then selected with G418 (1 mg mL)1) for 2 weeks to gener-
ate Hs68 and BJ Eco strains. Ecotropic retroviral supernatants
were produced by cotransfection of HEK 293 cells with the vari-
ous pBabe or pSuper retroviral constructs and pCL Eco using
Fugene. After 48 or 72 h, the medium was collected, supple-
mented with 0.8 lg mL)1 polybrene and used to infect Hs68
Eco or BJ Eco cells. Selection was performed 4872 h after viral
infection using 1 lg mL)1 puromycin for 3 days (pSuper orpBabe.puro), 150 lg mL)1 hygromycin for 4 days (pBabe.hy-
gro), or 80 ng mL)1 zeocin for 3 days (pBabe.zeo). The acidic b-
galactosidase assay was performed as described (Dimri et al.,
1995).
Cell counting
BJ cells were virally infected at MPD 65, and Hs68 cells were
infected at MPD 53. Every 7 days, cells were counted by coulter
counter and replated at 1:10 or 1:20 dilution. The mean popula-
tion doubling (MPD) was calculated by the formula: MPD = Log
(Nf
Ni)
Log2, where Nf = the number of cells counted andNi = the number of cells seeded. Growth rate experiments used
Hs68pSuper MPD 52 and Hs68shp53 MPD 52 expressing
either ectopic BTG2 or pBabe.hygro vector. The resulting cell
strains were seeded at 50 000 cells in triplicate for each time
point and harvested for counting daily.
Cell cycle analysis
Cells were fixed on ice in 70% ethanol, washed with PBS con-
taining 1% BSA, incubated with 100 lg mL)1 RNase A for
BTG2 neutralizes Pin1 during replicative senescence, K. Wheaton et al.
2010 The Authors
Aging Cell 2010 Blackwell Publishing Ltd/Anatomical Society of Great Britain and Ireland
757
-
8/3/2019 BTG2 Antagonizes Pin1
12/14
10 min at 37C and resuspended in PBS containing 50 lg mL)1
propidium iodide. Cell cycle distribution was examined by flow
cytometry using a FACScalibur flow cytometer (Becton Dickin-
son, Mississauga, ON, Canada).
T-oligo treatment
The T-oligo (GTTAGGGTTAG) or its compliment (C-oligo;CTAACCCTAAC) were added to cells at 40 lM as described pre-
viously (Li et al., 2003). Medium was changed after 1 week of
treatment. Efficient T-oligo-induced senescence in fibroblasts
depended on three variables: low cell density, timing of T-oligo
treatment and the use of newborn calf serum. Cells were
harvested 2 weeks after T-oligo treatment, and the C-oligo or
vehicle (H2O) controls were harvested at a similar cell density of
growth-arrested T-oligo-treated cells. In order to facilitate BTG2
detection, the cells were serum starved for 48 h and stimulated
with serum for 24 h before harvesting.
Semiquantitative RTPCR
Total RNA was isolated using the TRIzol reagent (Gibco-BRL,
Burlington, ON, Canada) according to the manufacturers
instructions. Reverse transcriptionPCR (RTPCR) was performed
on 1 lg of total RNA. The optimal annealing temperature for
each primer set was determined empirically, and varying cycles
of PCR were performed to determine the linear range of amplifi-
cation. PCR was performed using the following primer
sequences, annealing temperature and cycle number.
p21: ctggagactctcagggtcgaaa and gattagggcttcctcttgagaa,
55C, 29 cycles;
BTG2: gcgagcagaggcttaaggtc and aggccacttccaagcagctc,
55C, 34 cycles;Reprimo: gcaatctgctcatcaagtccgag and ccccgcattccaagtaag-
tagc, 55C, 43 cycles;
14-3-3r: gtgtgtccccagagccatgg and accttctcccggtactcacg,
55C, 47 cycles;
Tob1: cacaggatcttagtgtttggatcga and ttcttcattttggtagagccga-
act, 60C, 40 cycles; Gadd45a: gctctctccctgggcgacctg and
ccatgtagcgactttcccggc, 55C, 34 cycles; and
GAPDH: cggagtcaacggatttggtcgtat and agccttctccatggtg-
gtgaagac, 55 or 60C, 22 cycles. Glyceraldehyde-3-phosphate
dehydrogenase (GAPDH) served as an internal loading control.
To ensure linear GAPDH amplification, its primers were added
for the final 22 cycles of each reaction. The amplified productswere resolved by agarose gel (2%) electrophoresis, stained
with ethidium bromide, and band intensity was determined
using UV illumination and IMAGEQUANT (GE Healthcare, Baie
durfe, QC, Canada) software using GAPDH as an internal
control.
Northern blot analysis
Fifteen micrograms of RNA was resolved on a denaturing aga-
rose gel and transferred to a nylon membrane. Hybridization of
32P-radiolabelled probes was performed using standard condi-
tions. Labeled RNA was detected by autoradiography.
Western blots and immunoprecipitation
Cells were lysed directly in 2X Laemmli sample buffer (4%
SDS, 25 mM TrisHCl [pH 6.8], 20% glycerol, 0.1 M DTT) or
lysed in PBS containing 1% NP40 and complete proteaseinhibitor cocktail. Protein samples were quantified by Bradford
assay, resolved by PAGE, transferred onto nitrocellulose and
blocked overnight in 10% milk or 5% BSA TBS with 0.5%
Tween 20. Primary or secondary antibodies were diluted in
5% BSA TBS with 0.5% Tween 20. The following antibodies
were used: p53 (DO-1), phospho(S-15)-p53 (Cell Signaling,
Danvers, MA, USA, #9284), BTG2 (Santa Cruz, CA, USA,
sc-33775 and Aviva, ARP33561), cyclin E (Santa Cruz, sc-198),
cyclin D1 (NeoMakers, Fremont, CA, USA, RB-010), p21
(Santa Cruz, sc-397), GADD45a (Santa Cruz, sc-797), Pin1
(Santa Cruz, sc-46660 and sc-15340) and b-actin (Sigma,
Oakville, ON, Canada). Anti-rabbit and anti-mouse secondary
antibodies were conjugated with HRP (Jackson IR, West Grove,
PA, USA).
Immunoprecipitations were performed using DSP cross-
linked cell lysates (Thermoscientific, Nepean, ON, Canada) and
precleared using Protein ASepharose beads. The mouse Pin1
antibody (sc46660) or control immunoglobulin (mIgG) was
incubated overnight at 4C followed by the addition of Protein
ASepharose beads for a further 60 min at 4C. IPs were
washed three times using RIPA as previously described (Whea-
ton & Riabowol, 2004). The bead IP complexes were boiled for
15 min in protein sample buffer containing 50 mM DTT and
5% b-mercaptoethanol to reverse cross-linking. Analysis of
bound BTG2 and Pin1 was performed by Western blottingusing rabbit polyclonal antibodies sc-33775 and sc-15340,
respectively.
Immunofluorescence microscopy
Cells on glass coverslips were fixed with 2% paraformaldehyde
in PBS for 10 min and permeabilized with 0.5% Triton X for
15 min. Antibodies were diluted in 1% BSA TBS. BTG2 staining
utilized anti-BTG2 (sc-30342; 1:50) for 1 h, followed by mouse
anti-goat (Sigma; 1:200) for 1 hr and goat anti-mouse FITC-con-
jugated antibody (Sigma). Pin1 staining utilized anti-Pin1
(sc-15340; 1:200) for 1 hr, followed by anti-rabbit Cy-3 (JacksonIR; 1:800) for 30 min. Coverslips were washed 3 times with TBS
with 0.5% Tween 20 between antibody incubations. The nuclei
were stained with Draq5 (Enzolife Sciences International, Inc.,
Plymouth Meeting, PA, USA) according to the manufacturers
instructions. Images were obtained using an Olympus FluoView
300 confocal laser-scanning microscope (Carsen Group,
Markhan, ON, Canada), and a single 0.35 -lm optical section at
400 magnification of each sample is shown. Images were
analyzed and superimposed using IMAGEJ (NIH, Bethesda, MD,
USA) software.
BTG2 neutralizes Pin1 during replicative senescence, K. Wheaton et al.
2010 The Authors
Aging Cell 2010 Blackwell Publishing Ltd/Anatomical Society of Great Britain and Ireland
758
-
8/3/2019 BTG2 Antagonizes Pin1
13/14
Acknowledgments
Rosalyn Fleites Garcia for technical assistance. This research is
funded by the Canadian Cancer Society and the Canadian
Institutes of Health Research. SB is supported by a Canada
Research Chair.
Author contributions
KW & SB designed the experiments and wrote the manuscript.
KW, WM & JM conducted the experiments.
References
Atadja P, Wong H, Garkavtsev I, Veillette C, Riabowol K (1995)
Increased activity of p53 in senescing fibroblasts. Proc. Natl Acad.
Sci. USA 92, 83488352.
Boiko AD, Porteous S, Razorenova OV, Krivokrysenko VI, Williams BR,
Gudkov AV (2006) A systematic search for downstream mediators
of tumor suppressor function of p53 reveals a major role of BTG2 in
suppression of Ras-induced transformation. Genes Dev. 20, 236252.
Brown JP, Wei W, Sedivy JM (1997) Bypass of senescence after disrup-
tion of p21CIP1WAF1 gene in normal diploid human fibroblasts.
Science 277, 831834.
Brummelkamp TR, Bernards R, Agami R (2002) A system for stable
expression of short interfering RNAs in mammalian cells. Science
296, 550553.
Collado M, Blasco MA, Serrano M (2007) Cellular senescence in can-
cer and aging. Cell 130, 223233.
el-Deiry WS, Tokino T, Velculescu VE, Levy DB, Parsons R, Trent JM,
Lin D, Mercer WE, Kinzler KW, Vogelstein B (1993) WAF1, a poten-
tial mediator of p53 tumor suppression. Cell 75, 817825.
Dimri GP (2005) What has senescence got to do with cancer? Cancer
Cell 7, 505512.Dimri GP, Lee X, Basile G, Acosta M, Scott G, Roskelley C, Medrano
EE, Linskens M, Rubelj I, Pereira-Smith O, Peacocke M, Campisi J
(1995) A biomarker that identifies senescent human cells in culture
and in aging skin in vivo. Proc. Natl Acad. Sci. USA 92, 93639367.
Dulic V, Drullinger LF, Lees E, Reed SI, Stein GH (1993) Altered regula-
tion of G1 cyclins in senescent human diploid fibroblasts: accumula-
tion of inactive cyclin E-Cdk2 and cyclin D1-Cdk2 complexes. Proc.
Natl Acad. Sci. USA 90, 1103411038.
Dulic V, Beney GE, Frebourg G, Drullinger LF, Stein GH (2000) Uncou-
pling between phenotypic senescence and cell cycle arrest in aging
p21-deficient fibroblasts. Mol. Cell. Biol. 20, 67416754.
Fujimori F, Takahashi K, Uchida C, Uchida T (1999) Mice lacking Pin1
develop normally, but are defective in entering cell cycle from G(0)
arrest. Biochem. Biophys. Res. Commun. 265, 658663.
Guardavaccaro D, Corrente G, Covone F, Micheli L, DAgnano I,
Starace G, Caruso M, Tirone F (2000) Arrest of G(1)-S progres-
sion by the p53-inducible gene PC3 is Rb dependent and relies
on the inhibition of cyclin D1 transcription. Mol. Cell. Biol. 20,
17971815.
Hara E, Tsurui H, Shinozaki A, Nakada S, Oda K (1991) Cooperative
effect of antisense-Rb and antisense-p53 oligomers on the extension
of life span in human diploid fibroblasts, TIG-1. Biochem. Biophys.
Res. Commun. 179, 528534.
Harley CB, Futcher AB, Greider CW (1990) Telomeres shorten during
ageing of human fibroblasts. Nature 345, 458460.
Hayflick L (1965) The limited in vitro lifetime of human diploid cell
strains. Exp. Cell Res. 37, 614636.
Herbig U, Jobling WA, Chen BP, Chen DJ, Sedivy JM (2004) Telomere
shortening triggers senescence of human cells through a pathway
involving ATM, p53, and p21(CIP1), but not p16(INK4a). Mol. Cell
14, 501513.
Hong JW, Ryu MS, Lim IK (2005) Phosphorylation of serine 147 of
tis21BTG2pc3 by p-Erk12 induces Pin-1 binding in cytoplasm
and cell death. J. Biol. Chem. 280, 2125621263.Itahana K, Dimri GP, Hara E, Itahana Y, Zou Y, Desprez PY, Campisi J
(2002) A role for p53 in maintaining and establishing the quies-
cence growth arrest in human cells. J. Biol. Chem. 277, 18206
18214.
Jackson JG, Pereira-Smith OM (2006) p53 is preferentially recruited to
the promoters of growth arrest genes p21 and GADD45 during rep-
licative senescence of normal human fibroblasts. Cancer Res. 66,
83568360.
Karlseder J, Smogorzewska A, de Lange T (2002) Senescence induced
by altered telomere state, not telomere loss. Science 295, 2446
2449.
Kawakubo H, Brachtel E, Hayashida T, Yeo G, Kish J, Muzikansky A,
Walden PD, Maheswaran S (2006) Loss of B-cell translocation gene-
2 in estrogen receptor-positive breast carcinoma is associated withtumor grade and overexpression of cyclin d1 protein. Cancer Res.
66, 70757082.
Kortlever RM, Higgins PJ, Bernards R (2006) Plasminogen activator
inhibitor-1 is a critical downstream target of p53 in the induction of
replicative senescence. Nat. Cell Biol. 8, 877884.
Lee TH, Tun-Kyi A, Shi R, Lim J, Soohoo C, Finn G, Balastik M, Pastori-
no L, Wulf G, Zhou XZ, Lu KP (2009) Essential role of Pin1 in the
regulation of TRF1 stability and telomere maintenance. Nat. Cell
Biol. 11, 97105.
Li GZ, Eller MS, Firoozabadi R, Gilchrest BA (2003) Evidence that expo-
sure of the telomere 3 overhang sequence induces senescence.
Proc. Natl Acad. Sci. USA 100, 527531.
Lim IK (2006) TIS21 (BTG2PC3) as a link between ageing and can-
cer: cell cycle regulator and endogenous cell death molecule. J. Can-
cer Res. Clin. Oncol. 132, 417426.
Lim IK, Lee MS, Ryu MS, Park TJ, Fujiki H, Eguchi H, Paik WK (1998)
Induction of growth inhibition of 293 cells by downregulation of
the cyclin E and cyclin-dependent kinase 4 proteins due to overex-
pression of TIS21. Mol. Carcinog. 23, 2535.
Lucibello FC, Sewing A, Brusselbach S, Burger C, Muller R (1993)
Deregulation of cyclins D1 and E and suppression of cdk2 and cdk4
in senescent human fibroblasts. J. Cell Sci. 105(Pt 1), 123133.
Ma Y, Prigent SA, Born TL, Monell CR, Feramisco JR, Bertolaet BL
(1999) Microinjection of anti-p21 antibodies induces senescent Hs68
human fibroblasts to synthesize DNA but not to divide. Cancer Res.
59, 53415348.
Masutomi K, Yu EY, Khurts S, Ben-Porath I, Currier JL, Metz GB,
Brooks MW, Kaneko S, Murakami S, DeCaprio JA, Weinberg RA,
Stewart SA, Hahn WC (2003) Telomerase maintains telomere struc-
ture in normal human cells. Cell 114, 241253.
Meerson A, Milyavsky M, Rotter V (2004) p53 mediates density-
dependent growth arrest. FEBS Lett. 559, 152158.
Noda A, Ning Y, Venable SF, Pereira-Smith OM, Smith JR (1994) Clon-
ing of senescent cell-derived inhibitors of DNA synthesis using an
expression screen. Exp. Cell Res. 211, 9098.
Rouault JP, Falette N, Guehenneux F, Guillot C, Rimokh R, Wang Q,
Berthet C, Moyret-Lalle C, Savatier P, Pain B, Shaw P, Berger R,
Samarut J, Magaud JP, Ozturk M, Samarut C, Puisieux A (1996)
Identification of BTG2, an antiproliferative p53-dependent compo-
BTG2 neutralizes Pin1 during replicative senescence, K. Wheaton et al.
2010 The Authors
Aging Cell 2010 Blackwell Publishing Ltd/Anatomical Society of Great Britain and Ireland
759
-
8/3/2019 BTG2 Antagonizes Pin1
14/14
nent of the DNA damage cellular response pathway. Nat. Genet.
14, 482486.
Rozan LM, El-Deiry WS (2007) p53 downstream target genes and
tumor suppression: a classical view in evolution. Cell Death Differ.
14, 39.
Sang L, Coller HA, Roberts JM (2008) Control of the reversibility of
cellular quiescence by the transcriptional repressor HES1. Science
321, 10951100.
Sasajima H, Nakagawa K, Yokosawa H (2002) Antiproliferative pro-teins of the BTGTob family are degraded by the ubiquitin-protea-
some system. Eur. J. Biochem. 269, 35963604.
Satyanarayana A, Greenberg RA, Schaetzlein S, Buer J, Masutomi K,
Hahn WC, Zimmermann S, Martens U, Manns MP, Rudolph KL
(2004) Mitogen stimulation cooperates with telomere shortening to
activate DNA damage responses and senescence signaling. Mol.
Cell. Biol. 24, 54595474.
Shay JW, Pereira-Smith OM, Wright WE (1991) A role for both RB and
p53 in the regulation of human cellular senescence. Exp. Cell Res.
196, 3339.
Stein GH, Drullinger LF, Soulard A, Dulic V (1999) Differential roles for
cyclin-dependent kinase inhibitors p21 and p16 in the mechanisms
of senescence and differentiation in human fibroblasts. Mol. Cell.
Biol. 19, 21092117.Stewart SA, Weinberg RA (2006) Telomeres: cancer to human aging.
Annu. Rev. Cell Dev. Biol. 22, 531557.
Vaziri H, West MD, Allsopp RC, Davison TS, Wu YS, Arrowsmith CH,
Poirier GG, Benchimol S (1997) ATM-dependent telomere loss in
aging human diploid fibroblasts and DNA damage lead to the post-
translational activation of p53 protein involving poly(ADP-ribose)
polymerase. EMBO J. 16, 60186033.
Verdun RE, Karlseder J (2007) Replication and protection of telomeres.
Nature 447, 924931.
Vousden KH (2006) Outcomes of p53 activationspoilt for choice.
J. Cell Sci. 119, 50155020.
Vousden KH, Lane DP (2007) p53 in health and disease. Nat. Rev.
Mol. Cell Biol. 8, 275283.
Wheaton K, Riabowol K (2004) Protein kinase C delta blocks immedi-
ate-early gene expression in senescent cells by inactivating serum
response factor. Mol. Cell. Biol. 24, 72987311.
Wheaton K, Atadja P, Riabowol K (1996) Regulation of transcription
factor activity during cellular aging. Biochem. Cell Biol. 74, 523
534.
Wyllie F, Haughton M, Bartek J, Rowson J, Wynford-Thomas D (2003)
Mutant p53 can delay growth arrest and loss of CDK2 activity in
senescing human fibroblasts without reducing p21(WAF1) expres-
sion. Exp. Cell Res. 285, 236242.
Yeh ES, Means AR (2007) PIN1, the cell cycle and cancer. Nat. Rev.
Cancer 7, 381388.You H, Zheng H, Murray SA, Yu Q, Uchida T, Fan D, Xiao ZX (2002)
IGF-1 induces Pin1 expression in promoting cell cycle S-phase entry.
J. Cell. Biochem. 84, 211216.
Zacchi P, Gostissa M, Uchida T, Salvagno C, Avolio F, Volinia S, Ronai
Z, Blandino G, Schneider C, Del Sal G (2002) The prolyl isomerase
Pin1 reveals a mechanism to control p53 functions after genotoxic
insults. Nature 419, 853857.
Zheng H, You H, Zhou XZ, Murray SA, Uchida T, Wulf G, Gu L, Tang
X, Lu KP, Xiao ZX (2002) The prolyl isomerase Pin1 is a regulator of
p53 in genotoxic response. Nature 419, 849853.
Supporting Information
Additional supporting information may be found in the online
version of this article:
Fig. S1 Characterization of Hs68 cells expressing p53 shRNA,
related to Fig. 2 (tif file).
Fig. S2 The cellular redistribution of Pin1 and its colocalization
with BTG2 in the cytoplasm of BJ cells induced to undergo
senescence using T-oligo, related to Fig. 5 (tif file).
As a service to our authors and readers, this journal provides
supporting information supplied by the authors. Such materials
are peer-reviewed and may be reorganized for online delivery
but are not copyedited or typeset. Technical support issues aris-
ing from supporting information (other than missing files)
should be addressed to the authors.
BTG2 neutralizes Pin1 during replicative senescence, K. Wheaton et al.
2010 The Authors
Aging Cell 2010 Blackwell Publishing Ltd/Anatomical Society of Great Britain and Ireland
760