BSP UP Centennial Professor of · PDF fileBSP‐UP Centennial Professor of Agriculture....
Transcript of BSP UP Centennial Professor of · PDF fileBSP‐UP Centennial Professor of Agriculture....
Annual BSP‐UP Professorial Chair Lectures
LECTURE NO. 5LECTURE NO. 5LECTURE NO. 5
Abaca Breeding for a More Reliable Philippine Abaca Industry
Dr. Antonio LalusinBSP‐UP Centennial Professor
of Agriculture
Antonio G. Lalusin, Ph.D.Assistant Professor 6
Institute of Plant Breeding-Crop Science Cluster,College of Agriculture, UP Los Baňos
ABACA BREEDING FOR A MORE VIABLE
PHILIPPINE ABACA INDUSTRY
It is endemic to thePhilippines
It is a source of fiberinternationally known asManila hemp
Abaca is an important export crop and is a majordollar earnerThe abaca industry isgenerating 80 millionUS dollar annually
Abaca- Musa textilis Nee
As of 2008, abaca is cultivated in about 140,000 hectares in 52 provinces
The Philippines is supplying 85% of abaca in theworld market
The demand for abaca pulp and fiber will continue to increase
Car manufacturers use abaca as compositematerials for vehicle interiors and automotive parts
More countries are now shifting to the use of natural fibers in their bid to eliminate dependence on materials derived from fossil fuels
Uses of Abaca Fibers
The Abaca IndustryIn 1820, an American lieutenant of the US Navy
brought abaca fiber to the United States
Five years later, the first exportation of abaca was made.
Abaca became well known as one of the strongest materials for marine cordage due to its superior tensile strength and proven durability under sea water
With the onset of the 20th century, abaca fiber became the premier export commodity of the country.
In 1822, attempts to introduce the crop in India, Borneo, German East Africa, West Indies and Florida was done but it was not commercially viable (Copeland, 1911).
In 1923, the US government introduced abaca in many countries with climate similar to the Philippines, when the US Navy relied solely on Philippine abaca as the source of its marine cordage (Spencer, 1953)
In 1925, abaca seed pieces from the Philippines were also used to establish plantations in Sumatra, in British Borneo and in Malaya
In 1939, in New Caledonia and Queensland (Torres and Garrido, 1939).
In Vietnam, in 1958 with seed pieces from Costa Rica.
After World War II, a Japanese owner of the abaca plantation in Davao, started field testing and successfully cultivated abaca in Ecuador which produces abaca for export
INDUSTRY SECTORS
•Farmers 89,071 •Traders (licensed) 617 •Trader-Exporters (licensed) 31 •GBEs (licensed) 20 •Cordage firms (licensed) 6 •Pulp Manufacturers(licensed) 6 •Fibercraft processors (licensed) 105
TOTAL HECTARAGE: 141,711 hectares
TOTAL PRODUCTION: 66,471 m.t
MAJOR PRODUCING PROVINCES:
CatanduanesLeyteSouthern LeyteNorthern SamarDavao OrientalSurigao del SurDavao del SurSuluSorsogonWestern Samar
Abaca is grown in 52 provinces with the following as the top ten producers:
AVERAGE EXPORTS: (1997-2006)
EXPORTSVOLUME(in m.t.)
VALUE(in FOB US$)
RAW FIBERS ……………………………. 12,887 14,049,398MANUFACTURERS
Pulp …………………………………….. 17,384 38,391,313
Cordage, ropes and twines ….. 7,725 11,379,481Yarns and fabrics
…………………. 396,910Fibercrafts
…………………………… 15,046,555AVERAGE TOTAL EXPORT EARNINGS $79,263,657
MAJOR IMPORTING COUNTRIESRAW FIBERS United Kingdom, Japan, Indonesia
MANUFACTURERS
Pulp Germany, Japan, UK, France, USA
Cordage, ropes and twines USA, Singapore, Canada, Germany, Malaysia, United Kingdom, United Arab Emirates
Fibercrafts USA, Japan, Spain, Italy, UK, Hongkong, France, France, Australia
Threats and ProblemsAbaca has long been an established industry, but it is still plagued with problems.
Areas that continue to be addressed are (1) farm productivity, and (2) fiber quality.
Serious and aggressive moves by Indonesia to massively produce abaca under the government's reforestation program
Available cheaper substitutes (e.g., sisal, Ecuadorian abaca)
Cheaper sources of similar materials (e.g., China, India)
Technological advances and breakthroughs which make possible production of cheaper substitutes, whether from natural or synthetic-based materials
Presence of virus diseases
Abaca Bunchy Top
Abaca Mosaic
Abaca Bract Mosaic
Estimated losses in fiber yield and equivalent values in pesos as a result of the widespread occurrence of bunchy-top and mosaic viruses.
Area Disease Incidence
Fiber Yield Loss (kg)
Value
Region-wide 5.19 percent 833,587.99 kg Php18,338,935.78Sorsogon Php9,458,893.40Catanduanes Php5,814,850.36Eastern Visayas
312,076 kg Php8,440,350.00
Northern Samar
153,186 Php3,829,650.00
Northern Leyte 116,280 kg Php3,488,400.00
(source: Raymundo, 2002).
Abaca Bunchy Top
first reported in 1915 in Silang, Cavite and in 1937 inDavao province
a total of 12,000 ha had been wiped out in Laguna, Batangas, Cavite
it spread in Bicol region, Sorsogon and EasternVisayas
fiber yield loss ranged from 13 to 77%
it is caused by abaca bunchy top and transmittedby an aphid vector, Pentalonia nigronervosa
Symptoms of Abaca Bunchy Top
yellowish-white, chlorotic areas on lamina and margins of unfurled leaf
mature leaves become dark green, stiff, narrow, erect and necrotic
the petioles begin to rise from the same plane at the upper end of the pseudostem resulting to a rosette or bunchy appearance
infected plants may remain alive for years but they gradually become smaller until their leaves and leafsheaths turn brown and die
Transmissionby insect vector, banana brown aphid, Pentalonia nigronervosa Coq.
can be found on pseudostem, youngest unfurled leaves and at the underside of old leaves
a single aphid can transmit ABTV
ABTV can be retained in the vector from 5 to 12 days
Abaca Mosaic DiseaseSymptoms
alternate green and yellow streaks, spindle-shaped patterns or dashes on leaves
mottling on leafsheaths and pseudostem
chlorotic areas develop rusty brown borders and extend from midrib to leaf margins
pale green areas turn orange to brown and later dry out
Transmissionby sap
by insect vectors (9 species),Aphis gossypii, A. maidis, A. glycines, Rhopalosiphum nymphaceae, R. maidis, R. prunifoliae, Toxoptera citricidus, Schizaphis graminum, S. cyperi
a single aphid can transmit AMV
it takes only 15 sec to acquire and transmit the virus
Abaca Bract MosaicSymptoms
stringing of young leaves
spindle-shapes chlorotic streaks running parallel to the veins
older leaves show raised leaf veins originating from the midrib
greenish to yellowish streaks o spindle-shaped lesions in petioles
dark-colored mosaic pattern on bracts of the inflorescence
Transmission
by sap
by insect vectors:Aphis gossypiiPentalonia nigronervosaRhopalosiphum maidis
History of Abaca BreedingThe indigenous Musa species – M. acuminata, M.
balbisiana and M. textilis
Natural hybrids of pacol and abaca exist in Bicol region known as Canton and Minay (Valmayor et al., 1956).
The basic chromosome number for the section Eumusa to which the edible bananas belong is 11, whereas that of Australimusa to which abaca belongs is 10.
Minay/Minary/Minray has 2n=21 (Pancho and Capinpin, 1959; Tabora and Carlos 1978)
Canton has 2n=20 (Valmayor et al., 1956)
Crosses between Libuton x Itom and Canorajan x Lagurhuan were developed
As of 1928, there were already hybrids developed for the varietal improvement of abaca (Labrador, 1928).
There were 54 different crosses that were developed from 1928 to 1931, only 29 crosses were successfully planted, 19 in Guinobatan Abaca Experiment Station and 10 in Silang, Cavite
Screening for disease resistance was carried out in 39 clones.
The F1 hybrids produced greater number of suckers than either parent.
Crosses with Maguindanao were better adapted to different conditions and possess stronger root system.
In the early 1950’s, the abaca varietal improvement program was initiated by the College of Agriculture, UP (UPCA) and the Bureau of Plant Industry (BPI)
The emphasis was on varietal collection, classification, evaluation, establishment of disease observationnurseries, clonal selection and intra- and inter specifichybridization.
The cooperative work was centered on the developmentof resistant abaca verieties, and the most notable achievement was the identification of Pacol as a source of resistance.
Experimental breeding between M. balbisiana and M. textilis produced hybrids with morphological characteristics and chromosomal numbers similar to those of Canton and Minay (Bernardo, 1957)
Hybrids between Minay and abaca, with the latter serving as male parent, have been produced.
The hybrids resemble the Minay parent more than the abaca parent (Brewbaker et. al, 1956)
Artificial hybridization proceeds more effectively when the abaca is the male parent.
In 1974, abaca hybrids developed in 1939 were field tested and they were named after the name of the parental.
Crosses with Linawaan x Laylay was named as Linlay , Linawaan x Libutanay as Linlib and Linawaan x Inosa as Linino (Cruz and Balingit, 1974).
Oyardo (1974) also field tested and named some abaca hybrids such as Itom x Lausigon as Itolaus, Itom x Maguindanao as Itomag, and Lausigon x Maguindanao as Lausimag.
Diaz (1997) generated F1 hybrids of Mininongacrossed with six varieties of abaca and screen for bunchy top resistance.
Crosses that produced F1 seedlings: Malaniceron x Mininonga, Mininonga x Itolaus 39, Mininonga x Layahon, Mininonga x Putumag 22, Mininonga x Tinawagan Puti and Sogmad Pula X Mininonga.
The reaction of the hybrids to abaca bunchy top varied,
Malaniceron x Mininonga, Mininonga x Itolaus 39, and Mininonga x Layahon, has resistance to bunchy top virus
Sogmad Pula X Mininonga has moderate resistance.
In 1981, the abaca collection which was then maintained by the Forestry Abaca Gene Bank, was turned over to the UPLB Experiment Station.
Several crosses were made and in 1986 the first six F1 hybrids between Pacol and abaca were released.
These hybrids have resistance to bunchy top virus butthe fiber quality is quite poor.
BC1 crosses were produced in 1995 and evaluated,but the work was ended due to unavailability of funds.
It was only last 2006, that the breeding work wascontinued although to a limited extent, and several BC1crosses were evaluated.
Selected BC1 progenies were backcrossed again toabaca to generate BC2 populations.
BC2 populations are now evaluated forbunchy top resistance and fiber qualities.
Development of Abaca HybridsDevelopment of Abaca HybridsWild
BananaAbaca
x
50% F1 Abaca
x
75% xBC1 Abaca
x87.5% BC2 Abaca
Hybrids
Abaca:w/ good fiber
quality
Wild Banana:w/ resistance to
ABTV92.25% BC3
• F1 hybrids have resistance to ABTV but poor fiber quality• BC1 has resistance and improved fiber quality as compared to F1
Generation of BC2 HybridsGeneration of BC2 HybridsSelected BC1 hybrids were backcrossed to recurrent abaca parents to generate the BC2 populations.
Germination beds Inoculation w/
P. nigronervosa
Fiber extractionFiber quality analysis
Selection of BC2 hybrids
Best SelectionsBest Selections
Characters Abuab Inosa Pacol BC2-37
Number of Stools
9 8 8 11
Plant Ht.(cm)
273 295 321 290
Girth (cm) 53 38 49 51
Stem Fresh Wt. (kg)
25 24 29 35
Leaf Sheath Number
22 17 19 22
Fiber Length (cm)
250 250 150 260
% Fiber Recovery
0.588 1.104 0.421 0.949
Tensile Strength
71.24 67.28 31.24 53.60
BC2-37
Characters Abuab Inosa Pacol BC2-46
Number of Stools
9 8 8 9
Plant Ht.(cm)
273 295 321 447
Girth (cm) 53 38 49 47
Stem Fresh Wt. (kg)
25 24 29 24
Leaf Sheath Number
22 17 19 19
Fiber Length (cm)
250 250 150 250
% Fiber Recovery
0.588 1.104 0.421 0.952
Tensile Strength
71.24 67.28 31.24 50.12
BC2-46
Characters Abuab Inosa Pacol BC2-76
Number of Stools
9 8 8 9
Plant Ht.(cm)
273 295 321 357
Girth (cm) 53 38 49 38
Stem Fresh Wt. (kg)
25 24 29 32
Leaf Sheath Number
22 17 19 18
Fiber Length (cm)
250 250 150 280
% Fiber Recovery
0.588 1.104 0.421 0.991
Tensile Strength
71.24 67.28 31.24 57.19
BC2-73
Characters Abuab Inosa Pacol BC2-64
Number of Stools
9 8 8 9
Plant Ht.(cm)
273 295 321 290
Girth (cm) 53 38 49 52
Stem Fresh Wt. (kg)
25 24 29 30.3
Leaf Sheath Number
22 17 19 22
Fiber Length (cm)
250 250 150 275
% Fiber Recovery
0.588 1.104 0.421 1.361
Tensile Strength
71.24 67.28 31.24 65.84
BC2-64
Fiber quality analysis of selected abaca with AbBTV resistance
IPB 0 IPB 15 IPB 30
IPB 45 IPB 60
Recent Advances in Abaca Breeding
Research
Development of Abaca Molecular MarkersDevelopment of Abaca Molecular Markers
Sample collection
DNA extraction
DNA Quantification and quality check
Molecular marker analysis
Gel Electrophoresis PCR amplification
Musa SSR PrimersMusa SSR Primers
*4/12 working primers = 33.3%; 3 polymorphic
Primer DesignPrimer Design
6 cellulose synthase genes were shown to be required in cellulose synthesis
Download CesA genes from diff. plants
Find tandem repeats
(TRF and Ocular)
Found tetra-nucleotide (CCTC) repeats in CesA2
barley
Designed gene specific SSR primers targeting the cellulose, lignin and pectin biosynthetic pathway
Degenerate Resistance Gene Analogs Primers
Name Primer Sequence from 5’ to 3’ region Type
1. IF GGCGGGGTGGGCaaracnacnht F
2. P3B AIITYIRIIRYIAGIGGIAGICC R
3. 3F2 GAGGTACTTCCTGGTGCTGgaygayrtbtgg F
4. I3R1 CGGCCAAGTCGTGCAyvakrtcrtgca R
5. PIA GGIATGCCIGGIIIIGGIAARACIAC F
6. P3A AIITYIRIIRYIAGIGGYAAICC R
7. PIB GGIATGGGIGGIIIIGGIAARACIAC F
8. CNL298F GGN ATG GGN GGN GTN GGN AAR AC F
9. M1445R YTT NAR NGC NAR NGG NAR NCC R
10. NBS1R CGT CTT TGC MGC NAR NGG NAA NCC R
Genetic Diversity and Phylogenetic Relationships of Abaca Genotypes
SSR amplification products generated by the primer pairs, mMaCIR39, mMaCIR40 and mMaCIR45. A. lanes 1-22 were the representative products of mMaCIR40; B. lanes 30-50 were representative products of mMaCIR39; C. lanes 30-50 were representative products of mMaCIR 45; L: 1kb plus ladder.
Dendogram (UPGMA) of 158 M. textilis from Luzon, Visayas and Mindanao using Nei’s (1978) unbiased genetic identity (limit: 0.72 coef.).
DNA fingerprinting of the 196 BC2 hybrids using PCR with mMaCIR45. Abuab (A) and Lausigon (L) (abaca check) were run in parallel with the BC2 samples; Musa balbisiana (Mb) and ‘Seniorita’ (S) were used as positive controls.
Cloning of Abaca Resistance Gene Analog (RGA)
Reamplified RGA PCR products for cloning
M 1 2 3 4 5 6 M
1325
868
666
M 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 M
Colony PCR products of three samples with two replicates electrophoresedusing 2% agarose.
Sequences of rgaA1 insert of Musa textilisand the representative chromatogram>Musa textilis rgaA1 – 868 bases
GGCATGGGAGGCGTGGGAAAGACCTAAAAGATTAACGAGAGGCAAGATGGACCTCAAGATGGGCAATGGAGTAAACATTGTTATAATAGCTGTTGGCATGGTCACCTTACATCTGCTTGGTGGAGCTATTATTGCATTAGATGCATGTTATTTTGTTCCTCTTATTATCAAAAATATTATTTCCATTTCATATTTGATAATTAGTAGATATAAATTAGTTTTTTAGAATAATGGTTGTTCAATAATATTAGATGATGAGATCGTCATGAGAGGAATATTGCATAATGGTTTATTTATACTAGACACTACTCAACATATCATAAATATAAGTGTGTCCAAAAAGAAATTAGATGAGATGAACAGTACATACTTGTAGCATTATAGGCTAGGTCACATCCATAAGGGAATGAGTCAAAAGTTGCTAAAGGATGGATATATAGATCCATTTGACCGTGAGTCATATACAACTTGCAAGCCTTGCCTTCGTGGAAAACTAATATGTATGTGGACCCATGTCATGTCAACTCATGCTATAGGTGGTTACTCATACTTTGTTACTTTTACTAATGATTTCTTAAGGTATAGATATGTGTACTTGATGAAGTACAAGTCCAAGGCTGTTTAGAAATTTAGAGAGTATAAGAATGAAGTGGAGAACCAGACTGGAACGAGTATCAAGACTCTTTAATTAGATCGAAGAGGTGAGTACTAGAGTATAGAGTTCATCCATTTCCTCAAGGACCATGGGATTCTATCCCAATGGACACCTCCTTACACATCTCAGCTCAATGGTATATCTGAAAGGAGGAATCGTACATTGTTAGACATAATGCGGTCCATGATGAGTTTTGCCGACACCTCCCATGCC
OPPORTUNITIES AND PROSPECTS FOR
ABACA
The abaca industry is expected to continue making a stronghold in both the domestic and international markets.
Strong demand for abaca as a result of the expanding market for specialty papers for food packaging as in tea bags and meat casings, filter papers, non-wovens and disposables.
Growing demand to conserve forest resources and to protect the environment from problems posed by non-biodegradable materials, particularly plastics, contributed to the growing demand for natural fibers like abaca.
Due to the environmental degradation, Japan, which is one of the major abaca consumers, is now replacing PVC with natural fibers or materials free from chlorine.
Development of new uses for abaca such as textile materials for the production of pinukpok or as blending material, with silk, piña or polyester, in the production of high-end fabrics.
Growing demand for handmade paper as art media, photo frames, albums, stationery, flowers, all purpose cards and decoratives.
By 2020—when farms expand to 32,600 hectares—abaca fiber production should reach 152,000 metric tons.
Fiber yield is expected to increase from 565kg per hectare per year to 900kg per hectare.
Thank you very much!