BRZ - Motorwebspa.motorwebs.com/subaru/pdf/brz.pdf · Under $25,000 for 2017 by Kelley Blue Book.3...
-
Upload
nguyenkiet -
Category
Documents
-
view
221 -
download
0
Transcript of BRZ - Motorwebspa.motorwebs.com/subaru/pdf/brz.pdf · Under $25,000 for 2017 by Kelley Blue Book.3...
BRZ. Heart of a Subaru. Soul of a sports car.
BRZ
The joy of driving purified.
The 2018 Subaru BRZ
There are sports cars with rear-wheel drive. There are also sports cars
with responsive steering, a few with nimble handling, and some that
are lightweight. The BRZ has all of these characteristics—and more.
And with the supremely low and balanced 205-horsepower1 SUBARU
BOXER® engine, the experience is simply divine. This is how sports
cars should be built—and how driving should feel.
1 Manual transmission models only. 2 We do not recommend racing your vehiclhicle. Racinacing mamay voy void the vehichicle le warranty. See Warranty & Maintenance Booklet for details. If you do race the vehiclecle, do, it safeafely aly and lnd lawfuawfully lly on on approved racing tracks. Drive responsibly at all times and obey all traffic llaws.aws.
1
BRZ Limited in Pure Red with optp ional Performancce e PaPackckagage.e.
Performance Package—Ready for your best lap.
To push the BRZ harder so it can handle the demands of higher performance driving,
look no further than the Performance Package. With Brembo® performance brakes for
supreme stopping power, SACHS® performance dampers for enhanced stability,
and dark gray 17 x 7.5-inch, 10-spoke aluminum-alloy wheels for an exclusive look,
this BRZ is ready to perform, lap after lap.2
1
||2
01
82
01
72
01
7B
RZ
BR
ZB
RZ
With a ttrar ditiono al rear-wheel ddrive layout,
thee BRZ pays homage to cclaassic ssports
car iideals wwhile retaining moderrnn
neecessitiees. Itss ccomombib natiionon off traraitts—s
lighghtnnesess,s low ccenterr ooff graaviv ty, fullly
inndepep nddene tt ssusu peensn ioon,n tele epepathiicc
haandndliling—deliver aann unfinfiltl ere eded, uun-n
equivocacalllly enjoyabbleey drivivingg eexpx erieencn e.
Powered by a 205-hhpp1 direce t- and port-
injected 2.0-liter 4-cylinder SUBARU
BOOXEX RR®® eenggine, the BRZ hits all the right
notes in bothh pperfof rmance andd sound.
ThT ee ssono orous, higgh rpm symphp ononyy fromy
the tunedd exhauust systetem iss mmusu ic to
enenthussiaiasts s’s ears.
The ideal sports car driviv ng position
means you’ll find everything you need,
right where you need it. The bolsterrede ,
sport-design ffront seats keep youo
plana ted, whilel theh smamall-diameter,
leather-wrw apa ped steerining wwheel is
perfectlyy compleme ented by a point-
anand-d shhooo t 13.1:1 steering ratioio.
DDDDiiiaaaalllleeeeddd---iiinnnEEngaging PPoootteennnttt
11 ManManMannuaualualuaaa tratraaansmnsmismissssiossiossiss nnn modmodmodelselselss onlonlnlon y.y.yy 2222 ComComCompatipatipatipatibleblebleb smasmsmaartphrtphrtphrtpphrtpprr oneoneneoneee andandandand appapppppppp licalicationtiononon reqreqerequireuireireired.d.d.d ForForForFor appappappap licalicaicicaicicicc tiontiontiontiont sss totoo opeopeopeperaterateraterate,,, llatlatlata estestestts ververveevereevevere sionsionsionsionnn ofofof eaceaceacacccchhhfff appappappappplicalicalicaicationtioniontioni isisissiii rreqreqqqr uireuireuireuiuired.d.dd DatDattDattDatD aaaaa proprorororoproproovidevidevidevidedd dddd bybybbyyyyyy smasmasmasmasmaaartphrtphtprtphtptp oneoneoneeeo issis disdisdisdisplayplayplaypllapla edededed
ononon thethethhehh audaaudau ioioo syssssysssystemtemtemem scrscrsc een.eeeene SomSomSomS eee stastastst tetee lawlawwlawssss proproproproohibihibihibihibitttt hethethetheh opeopeopeop ratrationonon ofof hanhanhaa dheldheldheldhe ddddf eeleeleeee ctroctroctrotronicnicicnic devdedevdevicesicescescesss whiwhiwhihh leeee opeopeopeopepo ratiratratitingngng aaaaa vehvevehvehvehicleicleclecl . SmaSmaSmaSmartphrtphtprtphoneoneoneoneno appappapppap ss shoshoshoshoulduldulduldddd onlonlnonlyyyy bebebebee laulaulauaunchenchehnchenn dddd whewhewheehennnn vehvehvehvehicleicleiclecleclcl isissiis safsafafsaaa elyelyelyely parpappararrked.ked.ked.d.kkkk YoYouYouoYouo rrr
wirewwirewirelesslessless caracarrierrierrier’s’ss ratrattesess maymaymayma appapppplyly.. 33 ActActActActivivaivativa ionononon andandandand reqreqreqrequireuireuireuireddddd monmonmonthlythlythly subsububbscriscriscrisc ptioptioptioptionnnn solsolsolsolsolsolols dddddd sepsepsesepees aratarataaratately.ely.ely.ely. IncIncIncncludeludeludeludessss 4-m4-m4-m4-m-m-monthonthonthonth tritritritriiaalalalala subsubsubu scriscriscriscriicrcr ptioptioptioption.n.n. SeeSeeSeeSee youyououurrr retretretretaileaileaileler.r.
The open road is your canvas.
CCCCooooonnnnnneeeccteeddd
Everywhehere yyoou go in the BRZ, you’ll feel connected to your
world, thanks to standard SUBARU SSTAT RLINKK™ Multimem dia.a
It allows you ttoo cono neect via Bluetooth® or USBBr port to apps
like Pandora,® iHeH artRadio,®® Stitccher™ and Aha,™2™ fforo aalllr your
favorite news, music and podcasts. For a more engaged
experience, upgrade to the 7-incch STARLR INKK™™ Multimedia
system with standard Apple CarPlay™ and Android™ Auto2
integrg ation and a built-in, voicec -activateded navavigigation system
powew redd byy TTomTom.® BBoth sysystems offer HD RRada io® and
SiS riussXMX ®® All Accesesss RRadadioio3 ffor ttheher ultimate in ssououndnd qquaualiityty
and llisteeningg eenjn oyoymementnt.
BRBRBRBRBBBRBRB ZZZ LLLLimimimmitittittedededd iinnnn WWWWRRRR BBBlululuuuueeeee PPPPeaeaeae rrlrlrl wwwwititthhh ooooptptp ioionananalll PPPeererrfofformrmrmrrrmanananncececece PPPPPPaacacackakaakagegegege.
LED Taillights
Sport-design Gauges with Multifunction Display
LiL ghtwweight Alumiinunum RRear Spoilerr
Bremboo® Perfoformrmanana cec Brakekes
3
|222
01
8 B
RZ
1 BRZBB Limitedd and BRZBRZZ tStStStS momodmodmodelselsels onlonlon y.y. 222 ComComomCompatipapapa bleblebleble smasmasmasmartphrtphrtphrtphoneoneoneone andanan appappppppappappp licalicalicalicationtiontiontion reqreqreqreqquireuireuireuiredd.d FoFoForFor aappappapplicaicacacaaatiotiontionttitio sssssstototot opeopeopeop rateratee, lataa estt verveerersionn of eaceaca hhhh appappapppappapplicalicalicalical tiontiontiotionnn isisis reqreqreqreqequireiuireuired.d.d DatDatDataaa proprproprovidevidedd ddd bybybyyyyy smasmasmasmasss rtphrtphrtphrtphoneoneoneone isisisis disdisdisdisplayplayplayplayyedeeded onononoon theththee audauddioisyssyssystsys ememm scrcrscscreen.en.een.. SomSomSomSomeeee stastastatatetetete lawlawlawlawsss proproprprohibihibihibhi t thehetheth opeopeopeopeopeeratiratiratirationonn ofofofof hanhanhanhannndhedheldheldheldhed dddd eleeeleeleectroctroctroctronicnnicniccnn c devdevdevdevicesicesicesicescesces whiwhwhiwhiwhiileeelelelele oopeopopopopeopeperatratiratiratratiratingngnggngngn aaaa vehvehvehvehicleicleiclecle.SmarSmarSmarSmartphotphotphotptphonenenene appappappapppsssss shoshoshoh ulduldlduld onlonlononloo yyyy bebebebe laulaulauaunchenchnchencheddd whwhewhewhewhewheennnn vehvehvehvehehhicleclecleiclecleclecle isisisis safsafsafsafsafsafelyelyelyelyelye parparparaararked.kedked.ked.ked.ked. YouYYouYouYouYouYourrrr wirwirwirwirww eleseleseleselesl ssss carcarcarc rierrierrierier’s’’s’s’s ratratraratratesseses maymaymayma appappappa ly.lyy.
Itt oooonnnnnnnlllllyyyyy llllaaaaaccccccckkkkkksssss ooonnnneeee tthhhinnngggg—— you.
Leather-wrappeped Shifter
Applple CarPlPlayay™ andd ndrooiddAnn ™™ Auto
|2
01
8B
RZ
5
Everything is designed with the driver in mmmmmmmininnininnnddd.ddd FFFFrom the small-diameeteteteer,r,r lllleaeaeaeaeathththththhererererereerer-w-w-w-w-ww-wrarararararapppppppp ede steering
whheeeell tto the strategically placeceececeeddddddy pppppeddededals, obliging shifter andr low-mouountnteded pppereererfofofoooormrmrmrmrmrmrmananannanaa cecccecc -d-design front
sesesesesseseatataatatata ss wwwitthh deep bolstererereerersssss aaaaaandnd Alcantara® inserts1—it’s all perfectly aassememblblededy ttoooo ccccrerererereeeatatatatatateeeee tthe ideal sports
cacarr ddddriririririvivivvivivviingngngngngngnngrr pppppppososititioiooooonnnn.nn TThe 4.2-inch multifunction display1 keepsps yyouououou iiinfnfnffforororormemememeddddd wwwwwitititititthhhhhh aaaaaaa GGG-f-fororcec meter, lap
timer, engininee tttttttooooro que curve maps and more, wwhihhhileelee TTTTTTrarararackckckck MMMModododeekkk llletetss yyouou pushh tthehe limmititss ooff pperformancef
drivinngggggg eeeeeveveveevevevvennnn ffffffffurruruururthththththereererer.. TTTTThehehehehehe aaaaavavavavavaillilili ababaabaablelelele dddduauaauauall-l-l-zozozzozonenenene aaaaututututututomomomomomomatatatataticiccicic cccclililiimamm te control systemm kkeeeepsps yyou in the comfort
zozone, while standdara dd BBluluetetooo thh® allows for anr easy connectiiionnny tttttoooooo yyyyyyououououououo rrrrrrr ffffavaaa oriterrrrr appp s and content. Plus,
an updated 7-inch STARLINK™ Multimedia system with standard Apple CarPPlPlPlPllayayayayay™ aand Android™ Auto2
integration and a built-in navigation system is available.1 You’ll also have standard auto-on/off LEDf
headlights to keep you connected to the driving experience, even after dark.r
Driver-f-fococused Cockpit
BRB Z Limited with Black Leather and Alcantara.®
Every excess eliminated.
Every thrill amplified.
ENGINE PLACEMENT WEIGHT SPLIT: FRONT [ 55 ]
1 Base curb weight for BRZ Premium. 2 Manual transmission models only. 3 BRZPremium and BRZ Limited models only. 4 With automatic transmission. 2018 EPAhighway fuel economy estimates. Actual mileage may vary.
Lightweight—2,789 Pounds1
Lightweight sports cars can react more quickly,
accelerate faster, and stop with more authority. With
less heft, the 205-hp2 SUBARU BOXER® engine
becomes a powerhouse, and the available 12.8-inch
Brembo® performance brakes—world-beaters. High-
tensile steel makes it not only lighter but stiffer, too.
Also a priority was balance—so it’s rear-wheel drive
for better front-to-rear weight distribution.
Low 0.27 Coefficient of Drag3
To a sports car, wind is like weight—the more of
it you have to move, the more it takes from your
ability to perform. Features like a channeled roof,
aerodynamic underbody panels and a rear diffuser
help the BRZ cut through the air, sharpening the
performance you’ll feel.
[ 18.11˝ ]CENTER OF GRAVITY HEIGHT3
2,789-POUND CURB WEIGHT1
REAR [ 45 ]
BRZ Premium in Crystal Black Silica.
SUBARU BOXER® Engine
Low, stable, with immediate power delivery, the
SUBARU BOXER® engine with up to 205 hp2 is
the heart and soul of the BRZ. With port- and
direct-injection technology, its efficiency is
impeccable—up to 33 highway MPG4—and its
power easily harnessed with either the lauded
6-speed close-ratio manual transmission or a
quick-shifting 6-speed automatic transmission
with manual mode and paddle shifters.
Driver-centric Ergonomics
With design features like a small-diameter
steering wheel and optimally placed short-throw
shifter, your hands can fully capitalize on the
quick 13.1:1 steering ratio. And with sport-design
instrumentation, you’ll immediately get the
information you need most.
Performance-design Seats
When you’re deep in the corners, you’ll be glad
the BRZ comes standard with supportive front
seats with deep bolsters. They’re also available
with Alcantara® inserts, which provide extra grip
to help keep you in the pocket.
Low Center of Gravity
Not only was the engine designed to be compact,
allowing it to be mounted lower in the chassis,
every element of the BRZ was placed as low as
possible, from the roofline to the seating position.
This is what gives the BRZ its supercar-like center
of gravity measurement—18.11 inches3—that keeps
it firmly planted to the ground for otherworldly
composure and response.
|2
01
8 B
RZ
7
2018 BRZ tS
Tuned by STI—Subaru Tecnica International
If onef word could sum uupp SSTIT , it’sss ttthiisss:s:s:s perfeeectctcctccc ioi nism. With theeirir latestrr ccrererereatatatatatiooiooioionnn, they’ve
ssharrpepenenedd a rrazor bladee,,r eenhnhanancicingng ttheh aaaaalreadyyy pppppppoto enenttyyy BBRRZ sssooo iiiitttt lllloooooks and performs better
than ever before.r The BBRZRZRZ ttSS ccomomeses ddececkekekekkeeked out wwwititititithh exccluluusis vee SSTTI pararts and details you
wowo ’n’n’tt fififi dndnd on any other BBRZRZ tthih s sidee ooff TTTokokokokkokyoyy . Outsisiiidededdd , yyouou’ll seeeeee ccccussusustootommmm sstytyling cues,
iwitth a ffululll SSTITI aaero kitt tthat ffeeatutures aann iimpm oososinnninininnggg functionanananan l ccarra bobon fibeerr rreaarr wwing.g BButt
nothing will prepare yyou for howr it driivevess. WWitthh aaa sssstititittt fffff ene ed chaasssssssss isis, pprecicisis ono -tuned SACHS®®
suspension,, BBrembo® brakes, and 18-inch STI aalllllooooyyooy wwwwheelsyy fittedd wwwwith MMicichelin®® PPililoto ® Spoportrt
perforormmance tires, you’ll be treated to an unforgettaabbbleleele ddriving expererrrieieiei nce.
|2
01
01
88B
RZ
R
9
98% of Subaru vehicles sold in the last 10 years are still on the road today.4
IHS Markit
“What we have … is an affordable, tossable, tail-happy sports car: slick-shifting, hard-stopping, great-sounding, as much fun on a track as it is in the canyons as it is around town.”
Autoweek (March 6, 2017)
Subaru is the 2018 Top Brand for Residual Value,
according to ALG.1
The Subaru BRZ was namedone of the 10 Coolest Cars Under $25,000 for 2017 by
Kelley Blue Book.3
Subaru is the Best Performance Brand for three
years running, according to Kelley Blue Book.2
1 ALGGAL namamn edede SubSubaruaru thethet 20120188 TopTop Maiainstrnstreame BraBrandnd fororResiResidualdual Valallue.ueu ALGALG isisis thetheh indindustrustryy benbenchmachma krk forfor resresiduaiduallvaluvaluese and depdepd recirecirec atioatioonn datdata,a, wwwwww.alg.alg.com.com. 22 2012015–205–201717KellKelleyey BluBl ey BooBoB kk BraBBrandndk ImaImagege AwaAwardsrdsrd areare basbaseded ononn thethe BraBrandndWatcWatch™™ stustudydy frofrorommmyy Kelelleyley BluBlueey BooBookk StrStrategategicickk InsInsightights.s. AwaAwardrdcalccalculatteded amoam ng nonnn -luxuxuryuryry shoshoh pperppers.s.yy ForFor mormoreer infinformaormationtion,,visivisitt wwww .kbbb .como . KelKe leyley BluBluB eey BooBooB kkk isiskkk aaa regregisteisteredred tratrademademarkrkofof KelK leyey BluBlue Boook Co.CoC , IncIncn . 33 ForFor momorreee infinformaormationtion,,, visvisititwww.www.kbb.kbb.com.com KelKe leyey BluBluee BooBookk isis aa regregisteisteredred tratrademademae rkrk ofofKellKelleyey BluBlueey BooBookk Co.Co.,,kk IncIn . 44 Basaseded onono IHSIHS MarMara kitkit U.SU.S. vehvehicleiclessinin opeoperatirationon vs.vs totto al newne reggr istrstrst atioationsns MY2MY2M 007–007–20162016016 asas ofofJanuJanuaryary 2012017.7.
EnEnEnEnEnEnEnEngigggigigigigineneneneneneee aaaaaaaandndnddnddndd DDDDDDDDDriririririveveveveveveveveetrtrtrtrtrtrtrtraiaiiaiiiaiinnnnnnnn BRBRBRBRBRBRBRBRZ ZZZZZ
PowPowPoPowPowPowPowPoP er errerrer | T| T| T| T| T| T| T| Torqqueeueeueueueue 2.0-lililililililiiterterterterterteteter DODODODODODOOOHC HCHHHHHHH aluuuuuuuminminminminminminmiminum-m-m-um-um-m-um-m-aaaaallaaa oy yy 16-16-16-16-16-16-16-16-valvalvallvalvalve ve ve ve ve vevee 4-c4444444 yliiyliiiyy ndendendendendendendnde hr hr hr hr horioriorioriorioriorioro zontalalalalalalalallyly ly ly ly ly ly ly oppopppoppppoppposoososeososooo d SSSSSSSSUBAUBAUUBAUBUBAUBAUB RU RU RU RU RU RURU RUU BOXBOXERERERERERERERER®®®®®®
engengineineineineineineineinen wiwwiwwith th hhh th th h DuaDuaDDuaDuaDuDuD l AAl AAl AAAl Actictctctictictictict vevve vev ValValValValValValValValVa ve vevvvveve ConConCononConConConontrottrtrotrott l SSSSl SSSl Systystystystystystystys emem (DA(DA(DA(DA(DA(D(DA(D VCSCSCSVCSVCSCSCSS)))))).))
ManManManManMannManManuauuauaualuauaua transansansansansansnsansmismismissmismisissssiosisisisisisisi n: 20202020202020205 h5 h5 h5 h5 h555 p @p @p @p @p @p @p @@ 7,000000000000000 rprprrprprprprpm |m |m |m |m |m |m ||| 151515151515151 6 lb-fb-fb-fb-fb-fb-fb-fb-ft @t @t @t t t @tt @ 6,6,6,6,6,6,6,6 40040404040404040 -6,6 8008008080808008008000 rprprprpprprprpmmmmmmmm
Automaomomaomaomaomaomaomaticticticticticcictic trtrttttt ansmismismismismismismismism siosioiosioiosiosiosion:nnnnnnn 200 hhhhhhhhp @p @p p p @p @p @p @ 7,77,7,7,7,7,7,0000000000 rppppppm |m m |m |m |m m |m | 151551515155151 l1 l1 1 1 1 1 1 lb-ft @@@@@@@@ 66,66,6,6,6,6,400400400400400000400-6,-6-6-6--6--6 60000 rprprprprprprprpmmmmmm
FueFueFueFueFueFueFueFue Sl Sl Sl Systystystystystystystystemeemememe DirDDirDirDirDirectectectectectectectectc anand pd ppd ppd pd ppportortortorortortorto fuufufufuufuel el elel el el el el injini jininjini jectectecttttttionionionionionioionion
MaMaManMaMaMaMaMa ualalllallll TrTrTrTrTrTTrTransansansansansansanssmismimmmmmmi siooooonnnnnnnn FulFulFulFulFulFulFullyylylylylylyly synsynsynsynsynsysysy chrrhrhrrrhrronionionioniononiononizededzedzedzedzededzedd cccclcccc ose-ra-ra-ra-ra-ra-ra-ra-ratiottiottiotiotiotio 6-6-6-6-6-6-6-6-spspespespespespespsp edd manmmanmmmmanm ualualualalualualualuall wiwwwwwww th IncIncncncncIncIncnclinlinllinlinliline Se Se Se Se Se SSStartatatatttata t Assissississississississiststsstststst
AutAutAutAutAutAutAutAutomaomaomaomaomaomaomaomatictititttitt Transansnsnsnsnsansnsn mismismismismismissmissiosiosisisisisis n 6-speepeeeeeeeeeeeeeed ed ed ed ed ed ed elecleclecleclecleclecectronicc auauauauauauaaua tomtomtomtommmtomtommaaatatiaaaa c trananananannannnsmismismisssmismismissississississississisiooooono wittttth Sh Sh Sh Sh Sh Sh Sh Sporporrporporporrport mt mt mt mt mt mt t ode, m, m, m, m, m, m, m, manuanuanuuanuanuanuualalalalalalala moddde we we we we we we we we ithithithithithith papapapapapapapaddle sssssssshifhifhifhifhifhhhifterterrterterterrters,s,s,s,s,s,s,s,
revrevrevrevrevrevrev-ma-ma-ma-ma-ma-ma-ma-matchingingingngngngnging dodododododdod wnswnswnswnswnswnswnswnshift ccccccccontontontontontontontonto rolrolrolrolrololrol ananananananananand Incllclclcllcclineineineineineineineine SttStSttStStStartartartararartartart Assisissisisssist.t.t.t.tt.tt.
BRZBRZZBRZBRZZZRZ PrePrPPrePrePrePrePr miumiumiumiumiumiumiuiummmmmmmm andandandndandandandand BRBRBRBRBBBRB Z tZ tttZ tZ tZ ttS:S:S:S:S:S:S:S: NoNooNooNooot At At AAt At At At At Avaiiv ivaivailablabbablablabablabable.le.lelelele.le.le. BRZBRZRZBRZBRZBRZBRZBRZ LiLiLLiLiLimitmitmititmititmitited:ed:ed:ed:ed:edede OpOpOpOpOpOpOpOptiotiotiotitiotitiotionalllnalnal.
TrTrTrTrTrTrTrTrT acacacacacacacactitititiititionononononononon andndndndndndndnd SSSSSSSStatatatatatataabibibibibibibib lilililililitytytytytytytyy
DriDriDriDriDriDriDriDrivetvetvetvetv rairairairairairairairainnnnnnnnn ReaReaaaaReaRear-wr-wr-wr-wr-wr-wr-wr-wheeheeheeheeheeel dl dl dl dl dl dl dl ddrivrivrrrrivrr eee
ReaReReReReReReRe r Diffffffffffffffifff ereereereereeereeree ntintintintintntintintiiaaaaaala TORTORTORTORTORTORTORTORSSSSSENSESS ® liimitmitmitmitmimitmitmitededededdeded slislslslslislslisl pppp
VehVehVehVehVehVehVehVehicliclicllicle Se Se Se Se Se Se Se Stabiliilililililiiliity ty tyty ty ty tytyy ConnConConConCononontrotrotrotrotrtrotrtr (l (VSCVSCVSCVSCVSCVSCVSCVSCC)))))) Includlududududludududdes es eses es eees perperperpererperperperfofoforforfofofofo mananannanananance-ce-ce-ce-ce-cecce oririoriorioriorioririentenentenenenenten ed TraTraTraTraTraTraTraTrack ckck cck ck ModModModModModModModMo e
TraTraTraTraTraTraTraTractictiction on on on on on non ConConCCCCC trotrotrotrotrotrotrotrol Slll Slll Systystystystystystststem eem eeeee (TC(TC(TC(TC(TC(TCTCCS)SSS)SSS)
FuFuFuFuFuFuFuFuelelelelelelee
EcoEcoEcoEcoEcoEcoEcoEcoc nommnommomommnommyyyyyyyy iitititcity/hy/hy/hy/hy/hy/hy/hy/highighigighighighighighwaywaywaywaywaywaywayway/c/co/co/co/c/co/co/c mbimbimbimbimbimbimbimbib nednednenednednnned6
ManMananManManMananManualuuualualuu : 22: 222: 221/21/21/21/21/21/21/21/ 9/29/29/29/24 m4 m4 m4 m4 m4 m4 m4 m4 mpgpgpgpgg
AutAuttAutttomaomomomomomomomo titic: 2: 2: 222 2: 2 224/34/34/34/44/34/34 3/23/23/23/2/23/22/27 m7 7 77 m7 7 m7 pg
BRZRZRZRZRZRZRZZZ tStSttStStSttS: 2: 2: 22: 2: 2: 2220/20/20/0/0/0/0/0/ 7/23 m3 m3 m3 m m3 m3 mmmpgpgpgpgpgpg
FueFueFueFueFueFueFueFuel Rl Rl RRl Requequequequequequeqequireiirei emenmenmememenmememenm ttt PrePPreP emiumiumiumiumiumiumiumium m uum um um um um unlenlenlenlenlenlenlenlee dadedadeaded gd gd gd gd gd gd gd gasoaasoaasoaasolinlinlinlinlinlinlinlinne (ee (e (eee (e 93939393 ooctococtoctococtoctoc aneeneaneaneeanee))))))))
FueFueFueFueFueFueFueFuel Cl Cl Cl Cl CCl CCapapaapapaapaapapaap cityyyyyyy 13.2 g2 g2 g2 g2 g2 g2 g2 gaallallaallallallallonsonsonsonsnsonsonsns
ChChChChChChChChasaaaasaaa sisisisisisisisissssssss
SteSteSteSteSteSteSteStet erierierieririerierieringngngngngngngngg Electrctrctrtrtrtrtrtricic ic ic ic iic ic ic powpowpowowpowpowpowpowwer-assssssististististististististtededededededed quiququiquququququ ck ratttttatttioioio ioioioioioo racracracracracracrack-ak-ak-ak-k-ak-k-k-k- nd-pinpinpinpinpinpinpinpinnionionionionionoionion ststststststststeeeeeereee ing (E(E(E(E(E(E(E(E( PASPASPASPASPASPASPASPAS). ).). ). ). ). ).). RRatio:: 1313131313131313.1:.1:.1:1:1:1:1:1.1.1.1..1.1.1.
TTurTurTurTurTurnsnsnsnsnsnsnsns lock-tk-t-t-tt-t-t-to-o-lo-lo-lo-lo-lo-o-o ockckockockckkockockk: 2: 2: 2: 2: 2: 2: 2: 2.48. TTTTTTTTurnuurnuuruuru ingnggginginginging ciccccccc rcle: : : : : 3535.35.35.353535.35.3 4 f4 f4 f4 f4 feeteeteeteeteeteeteeteet.
SusSusSusSusSuSusSusSuspenenpenpenpenpenpennnsssisisiosioss n BRZRZZZZZBRZZ PrPrPPrPrPPrP emiemimimimiemiemimiuuuumuuuu annnnnndddddddd BRZBRZZBRZBBRZBRZ LiLiLiLiLiLiLiLi imited:ed:ed:ed:ed:ed:ed:ed:d SpSpSpSppppportortortortortortortortrt-tutunedededededednedd 4-4-444-4-44 whehewhewhehehewheheeeeleleeee i dindepeepeepeepeepeepeepeependendeeendeendeent.nt.ntntntntnt.nt FroooooFroontnt:nt:ntnt:nt:nt:ntn StStStStrutrututrututrutrutrut-tyttype e witwitwiwiwitwitwitwiw hhhh
lowlowlowlowlowlowwlowerereeerer erer L-arm.m.m.m.m.m.m.m. StStStStSStStStabiabiabiabiabiabiabiabilllllizl er barbarbarbarararbararr. ... . ReaReaReaaReaReaReaRearrrrrr:r Doublublblblublblblblb e-we-we-we-we-we-we-we wishishshishishishishishs bone we wwwwwwwithithiithithithithith shshshshshshshshooock abbbbbbbbsorsorsorsorsorsosorsors berberberbererberberber. S... tabiliililiiliiliiliiliiizerzerzezerzerzerzerzer babababababababarrrrr.rr
Perrforforforforforforforforfo manmannnmannnncece cececececece Pacccccccckagkakagkagkagkagkakageee44444444:::::::: SpSSSSpSSpSpSportt-tu-tu-tu-tu-tu-tu-tu-tun ddnedddned 4-4-44-4-4-4-4-wheelelelelelelelel indinindindindindindepepepeepepepepepeendennnnnn nt.t.nt.t.t.t.t.t. FroFroFroFroFFroFFront:nt:nt:nt:nt:nt:nt:nt: SACSSS HSHSHSHSHSHSHSHS®®®®®®® pepeeeerforforforforforforforfor rmancencencencencencencence tttststrututrutrutrutrututrutu --
typttt e we we we we we we we withithith looloolooooowerwwerwwwwew L-L-LL-L-armarmararmarmarmarar . SS. SSS. S. SStabtabtabtabtabtabtabtabiliiliiliilizerzerererzerererer bababbabbbab r.r.r. ReaReaReaReaReaReaReaRear: DoDoDoDoDoDoDoDoubluubluubluubu e-wwe-wwe-wwwwishisisishiishisishis bonbonnbonbonnnne we we e we e e we ithhhithhithh SACSASACSASASACSACS HSHSHSHSHSSSS®®®®®®® pepepep rfoforfoforfofoforformrmarrmarmrmrmr ncececencecececece shshsshockockckockockckckck
absabsabsbsabsabsssorborborborborborborbor er. StStStStStStStStabiabiabiabiaaabab lizlizlizlizzzer er erer er er erer bar.
BRZZZZZZZZ tStStStStStStStS444444:::: HiHiHiHiHiHiHiHigh-ggggggg perrrrrerrrforforforforforforforformanmananmanmananmanmancccce cccc STII spspspspspspspsportortortortortorttt-tu-tu-tu-tu-tu-tu-tu-tuned 4-4-4-4--4-4--whewhewwhewhewhewhewheelelelelelelelel iiiinindii epeeeeeeependendendndendendndendent.nt.t.nt.nt.nt.nt.t. FFFFroF nt::: STSTSTSTSTSTSTSTS I-tI-tI-tI-tI-tI-tuneununununeununun d Sd ACHACHACHACACHACHACHACHSSSSSS®®®®®®®®
perperrrperforforforforforforforformanmmance ce ce ce ce ce ce ce strstrstrs ut-ut-ut-ut-ut-ut-ut-t-typtyptyptyptyptyptytypt e wwwwwwwwithithithitithithithith STSTSTSTTTI cI cI cI c cI cI cI coilo spspspsppsppprinrinrinrinrinrinrinri g ag ag andnd nd nd nd ndnd nd d lower er er er er er er er L-aL-aL-L-aLL-aL-L rm.rm.m.m.m.m.rm.m.m StSSSS abibiibiiibiilizlizlizlizlizlizlizlizer eereer bararbarbarararbarar. S. . . . . . . TI dradradradradradradradraw sww sw stiftiftiftiftiftiftiftiffenfefefefefefefe er andandandandandandandan
frofrofrofroffront nt nt nt nt nt nt tt sstrstrsssstrss ttut towtowtowtowtowtowtowtowerererer V-bV-bV-bV-bV-bV-bV-bV-brace. eeeee ReaReReaReaRRRRear:r:r::r::r:: DoDoDoDoDoDoDD blbluble-we-we-we-we-we-we-we-wishishishishbonbonbobonbonbobonbone wwwithithithithithithithith STSTSTSTI-tI-tI-t-tI-t-t-t-tununeunuuuuu d Sd SSd SSSSSACHAAAACHACHACACHSSSSSSSS®®®®®®®® ppppepp rforfoorfoooooormarmarmrmarmrmrmrmancecencencencencececee shsssshshss ockkkockkkockk
absorborborborborborborborbererererer er andandandandandandandand STI ccccccccooiloiloiloiloiloioil spspspspspspspprinrinrinrinrinrinrinring. Statatatataataabilbilbilbibbilbilbbilizeizeizeizeizeizeer br br br br br br br bar.
BraBraBraBrBraBraBraBrakeseseskeseskeskeskes BRZZZZZZZZ PrPrPrPrPrPrPrP emimimiemiemimiemiemiiuuumuuuuu annnnnnnnddddddddd BRZBBRZBRZBRZBRZBRZ LLLLiLLiLiL mited:ed:ed:ed:ed:d:ed:ed: 4444-4-4 whewhewhewhewhewhewhewheh el dissssssssc, c, c,c, c,c, cc, venvennnvenventiltiltiltiltiltiltiltilateaaaaaaa d ffffffffronronronronronronronro t at att at and ndnd nd nd nd nd nd rear r. DuaDuaDuDuaDuaDuDuaDu l-pl-pl-ppl-pl-ppistististististististis on o frororororororoontnt ntntntntnnt anddanddanddandandd
siniii gleglegleglegleglegleglee-pi---pi-p-pi-pip stostootoostooston rn n nn rn rnn rear cacacacacacacacac lipliplilipilipl erssersserserserss. 4. 4. 4. 4. 4. 4. 4. 4-chhhhannannannannannannannannel,eel,el,el, 4-4-4-4-4-4-4-4-sessensesensenses sorororsororsororor ABABAABAABABA S wS wwwS wS wwwithithitithitithithith ElElElElectectectectectectectectronronrroronroronic ic cccicicc BraBrBraBraBrBrBraB ke-kekeke---forforforforfoforfoforfo cececece c DisDisDisDisDisDisDisDistrittrittritrit butttbutbutttbutionionionionionionionion (E(E(E(EBD)BD)BD)BD)BD)BDBD)BD)D).
BRZBRZZBRZRZBRZBRZZ tSttttttt andddddddd PePePePPPePeP rforforfoorforfooormrrmarrmrmrr ncececececececeee PaPaPPaPaPackackackakakckackakakage4: BrBrBrBrBrBrBrBrembembembembembembembemboooooooo®®®®®®®® perfofooooooormarmarmrmarmarmrmarm ncencencencencececece brakikikiiiiiingngngngngngngng syssyssyssysssyssyssystemtemtemtemtemtetemte . 4-wh-wh-wh-whwh-wh-wh-wheeleeleeleeleel dididdididididid ssc,s
ventiltillililtilililateateateateateateateat d fd fd fd fd fd fd fd ffronrorororororro t and nd dd d d d d rearearrearearearearearrrrr.r.r. 4-4-4-p4-444-4-4- istononnonnnnnn frofrofrofrofrofrfrofront ntntntntnttnt andaaaaaaa duuuual-al-al-al-al-al-al-al-pispispispispispispistontontontototototto rear calcalcalcalcalcacalcalipeipeipeipeipeipeeipersrsrsrs.rsrsrsrs 4-chahaahaaahahannennennennennennennen l,l,l,l,lll, 444-s44444 ensor or or or or or or or ABSABSABSABSABSABSABSABSS
witiwitwittwith Eh Eh Eh Eh Eh Eh Eh Electroorororoooonicninicnicnicnicnni rBrBrBrBrBBrrakeakakakakakakak -forcercercercercercercerce DiDiDiDi trstrtrstrtrtrstrstribuibibibibibiib tion (n (n (n (n (n (n (n (EBDEEEBDEBDEBDEEBD).).).).)).).).
BraBraBraBraBBraBraBraBrakekeekkeekeke DisDisDisDiDisDisDisDiscscscs css (fr(fr(fr(fr(fr(fr(fr(frf ontontontontoontonto /re/re/re/re/re/re/re/rear)ar)arar)araar)ar)aBRZZZZZZZZ PPrPrPrPPrPP emiemimiemimiemimimiumuuuuuuu andddddddd BRZBRZBRZBRZBRZZBRZ LLLiLiLiLiLL mited:ed:ed:ed:ed:ed:ed:ed: 111111111111.6 .6 .6 .6 .6 6 .6 .6 inincininininini hessssssss/11/1/1/11/11/11/11/11.4444.4 incincncincincincincinches.
BRZBRZBRZBRZBRZBRZBRZRZ ttttSttt anddddddddd PePePePePePePPeP rforforforfoforforforfoorrrmrrrmarr ncececeececececee PaPaPPaPaPaPaPackackackakackackackackage4: 12121212121212122.8 .88888.8 incincincinccincincincchhhhhhhesh /122222222.4 .4 .4 .4 .4 .4 .4 .4 incincincincincincincheshehehehehehehe .
BraBrBrBrBraBraBraBr keekee AssAssAssAssAssAssAssAssAs istististi ttisttst WheWheWheWheheWheWheWhen en n en en n en n emerermermermerermerergengengengengegengege cycycycy cyycycy brabrbrbrabrbrabrabrakinnking ig ig ig ig g ig ig is ds ds dsss dds eteeteeteeteeteeteeteetecteccctctectccted bd bbd bbd bd bbby hy hy hy hy y hy hy howwowwowow wow ququiququququiquiquq cklklckly ty ty ty ty ty ty ty the hehehhehheh brabrabrarabrabrabrabrar ke keke kke kekk pedededededpedpededdaalalalalalalal isiiisis prepreprepreprepreprepressessses d, d, d, d, d, d, d, d, maxmaxmmmmaxmaximuimumumumuimuimuimummm
brabrabrabraabrake keke ke ke ke keke pressusususususususuure rere re rer is isis issis immimmimimimimimim ediedididiididdiateateateateatateateately ly ly ly yy appapappappappappapapp llied.d
BrBrBraBrBrBrBrBr ke OveOveOveOveOveOveOveOverrirrirriiirriidedededede dedede Systemtemtemtemtemtemtemtem If IfIfIfIf botbotbotbotbotbotbotbothh bhhhhhh rakkkkkkkke ae ae ae ae ae e ae andnddndnddnd accacacacacacacacac eleratratratratratratratratoroororor pededpedpedpedpedpedpeddals arrrrrre pe pe e pe pe pe pe ressresressressedsesesesedsesedse simulmulmulmulmulmulmulmulttantantantttantaneoueoueoueoueoueoueououslyy, t, he he he he he he he he syssyssyssystemtemtemtemtemtemtemtem reducducducducucducducduceseseses e thehethehethethehethe
opeopeeopeopeeopeeratratratratratratratrattioniiionionionion ofofofofofofofof ththttthttht e ae aaae ae aaacceccecceccecceccecceccelerlllerlerleratoatoatoatoatoatoatoator pr pr pr pedaedadadadaedadaedal tl tl tl tll tll to ho ho ho hho hho helpelpelpelpelpelpelpelp prprprp eveeveeveeveeveeveeveevent ntntntntnnt uniuniuniuniuniuniuninintentenntentententn ntintintionaonaonaonaonaonaonaonal vllll vl vehiehiehihiehiehiehiehiclecleclecccclec acacccaccacccelcelcelcelcecelcelce eraeraeraaeraeraeraatiotiotiotiotiotiotiotion.n.n.
WhWhWhWhWhWhWhWhW eeeeeeeeeeeeeelslslslsslslsls andndnddddddd TTTTTTTTiriririririreseseseseseseses
WheWheWheWheWhWheWheWheelselselselselselselsls BRZZZZZZZZ PrPrPrPrPrPrPrP emiemimiemiemiemiemiemium umuuuuuu anddndnddndnddd BRBRBRBRBRBRBRB Z LZ LZ LZ LZ LZ LZ LZ Limim tededdeddededd::: :::: 1717 1717171717 x 7x 7x 7x 7x 7x 7x 7x 7.0-0. incccccccch mh mh mh mh mh mh mh mh ulttultultultultultulti-si-si-si-si-si-si-si-spokppp e ae ae ae ae ae ae ae ae lumlumlumlumlumlumluminuinuinuinuinuinuinuinum-aaallollollollollollollolloy.yyyyyyy
BlaBlBlBlack ck ck ck ck ckckck witwitwitwwith mh mh mh mh mh mh mh m hachhhachineineineineneneneine finfinfinfinfi ishshshishishshhishsh.
PerPererPerPerPererPerforforforfofofofofo mannnnce cece ce cece ce ce PacPacacPacPacPaccPackkkkagkkkk e44444::::: 17117171717171717 xxxx xx 7.57.57.57.57.57.57.57.5-inch hhhhhh mmulmulmulmulmmulmulti-ti--ti--ti-ti-ti-spospspspspspspsp ke alualualualualualualualuminminminminminmminum-umumumumumumumum alloy.y.y.y.y.y.y.y. DaDaDDaDaDaDDark rk k rk rk rk rk k graggggggg y fifinisnisnisnisnisnisnisnish.hh.hh.h.
BRZZZZZZZ tStStStStStStStS4444:::::: 181818181818188 x 7.5-in-in-in-in-in-in-in-inchch chchchchch STISTISTISTSTSTSTSTI alumimiimimimimiminumnumnumnunumnunumnumn -al-alal-al-al-al-al-allololololololoylo . Blacacacacaclacacacck fik fik fik fik fik fik fik nisnisnisnisnisnisnisnish.h
TirTirTirTirTirTirTirTirTi esees BRZBRZBRZBRZBRZRZBRZBRZ PrPrPrPrPPrPrP emimiemiemimiemiemimium,um,um,um,um,um,umum,m BRBRBRBRBRBRBRBRZZ LZ LZ LZ LZZZ Limiimiimiimimiimiimiimitedtedtedtetedtedtedtedt , P, P, P, P, P, PP, Perferferferferferferferformormormormmmmmancancancancancancancana e Pe Pe Pe Pe Pe Pe PPackackackacackackacac ageagegeageageagegege4::::::: 212121212121215/45/45/45/45/45/45/45/45 R5 R5 R5 R5 R17 17 17 17 17 17 17 17 87W87W87W87W87W87W87W87W susususususususummememememmemmememmer pr pr pr pr pr pr pr erferferferferferferfformormormormormormormormancccancanccanccce. e. e. e.e. e. e. ee
BRZZZZZZZZ tStStStStStStStS4444:: :: 2152152152152152151215215/40 R1R1R1R1R1R1R1R1R 8 88 88 88 88 888 88 5Y 5Y 5Y 5Y 5Y 5Y 5Y 5Y summermermemermermermermer pepepepepepeerforforforforforforforformancencececencececece...
BRBRZ tStS5
IncIncludes s BRZBRZ LiLimitedd keykey fefeaturess anand ad addsd :
• 18 18 x 7x 7.5-.5-inch S STITI liglightwht eigght ht alualuminminum-allalloy oy whewheels wiwith th blablack ck finish sh
andand 21215/45/40 R0 R18 18 MicMichelhelini ®® PiPilotlot® SpSportt susummemmer pr perfformrmancance te tireires
•• BreB mbobo®® peperforformancence brbrakiak ng sysystemtem
• HigHigh-ph-perfe ormmancance Se STIT spoort-rt-tuntuneded suspenpensiosion wn with SASACHSCHS®®
perperforformanm ce damdamperpe s
•• RedR -acaccenc tedted frontt grg illille
• FogFo lightght coververs
• CryCrystastal Bl lack Sk Siliilica ca folfo ding sg sideide mim rrors
•• STISTI frfrontont s, sideide anand rd rearear ununderder spspoiloilersers
• STITI cacarborbon fin ber rerear spospoiler
•• RedRed-accenentedted rerear a bummperper
•• BlaBlack ck reaar br badgadginging
• Alccantantaraara®® and leateatherher-tr-t immeded frofrontnt seats witwith rh reded bolsteters rs andand
stistitchtching, a, andnd embembroiderdereded loglogo o
•• LeaLeathet r-wwraprappedped steeringing whwheelee withh redred acacccents andand ststitcitching
• Doooor tr rimrim wwith reded accenents andnd sts itcitchinhing
• Reded frf ontnt ses at belbelts
•• AlcAlcanta ara®® ininstrstrumeum nt cluclustester mr meter vvisoisor wr withit red sstittitchichingng
• FraFramelmelessess rerearvarviewiew mimirrorrorr
BRBRZ Z PrPremiuiumm
• 205205-hp-hp didirecrect-it-injej ctictionon 2.02.0-li-litert 4-4-cylcylindinder er SUBSUBARUARU BOBOXERXER®® enenginginee
• CloClose-se-ratr io 6-s6-speepeed md anual al tratransmnsmissionon
•• SpoS rt-tuntuneded sussu pennsiosionn
•• MMulti-spospoke 17-17 inch ah aluminuinum-alloloy wy heeheels
• LEDLED heheadla ighhtsts
• TruTrunk nk spospoileilerr
•• HeaH tedd siside de mirm rors
• CloC th uphup olsstertery
• LeLeatheher-wr- rapppedped ststeeree ing whw eel wiwith aududioi andnd Bluettootoo h® cocontrolsls
•• SpoS rt-desdesignign gag ugees ws withith mum ltifunnctictionon disd playy
• ManM ualually ly adjadjustus able ae air ir conconditd ionninging sysystestem
• AutAuto-uo-up/dp/downown popowerwer wiwindondowsws
•• EleElectrc onic cc cruiruisese controoll
• Reaear-Vr-Visiisionon Cammeraera
• SUBUBARUARU STS ARLLININK™ 6.6.2-i2 nchh MuM ltitimedme ia SysSy temm wwith PanPandorora,a,®®
iHeiHearta Raddio,io,® StStitcitcher™r anand Ad Ahaha™ smartartphophone n appp inintegtegratration1,
highigh-rh-resoesolutlutionion LCLCD tD toucouchschscreereen ddispisplaylay, 8, 8 spspeakeakersers, A, AM/FM/FM/CM/CDD
plaayeryer, HHD RD adioo®® wiwithth iTuiT nes®® tataggiggingn capabiabilitlity,y, USBU poport/rt/iPoiPodd®
conontrot l, SirSiriusi XMM® All AAccec sss RRadio2, B, Bluetootooth® auaudiod ststreare minng ag nd d
hanands-d freee pe phonone ce onnnecectivity,ty, and 33.5-. mmm auxiliiaryary jaj ckck
• Cararpetpeted ed floofl r mmatsats wiwith th embbroiroiderdered ed BRZ lologogo andan red sstittitchichingng
BRBRZ LiLimimitetedd
IncIncludes es BRZBRZ PrPremium um keykey fef atuuresres anand ad ddss::
•• LEDL foog lg lighightsts
• AlcAlcantantaraa ® annd ld leateatherhe -trimmmmed d uphup olsterery
• CenC terer coc nsoole le andd lolower dodoor kneknee padsads with h redre ststitcitchingg
•• InsI trumenment ct cluslu ter memeterter vivisors with th redred ststitchingg
• SpoSport-rt-desde ignign gagaugeuges ws ithh 4.4.2-i2 inchnch, c, coloor mr multultifuifunctionon didisplsplayay
• HeaHeatedted front seseatsats
•• DuaD l-zzoneone auautomto atic dc digiigitaltal climaate te concontrotrol
•• KeyKeylesless As Acceccess s itwith Ph Pushush-Bu-Butttton Sn Startartt
• AntAntithithefeft secururityity sysystes m
• SUBUBARUARU STS ARLLINKINK™ 7.7.0-i0 nchh MuMultiltimedme ia NavNavigaigatiotion syststemem witwith h
AppApple CarrPlaPlay,™™ AnA droidd™™ AuA to,to, Pandodora,®® anand Ahaa™™ smartartphop ne e
appapp ini tegegratra ion,1 STS ARLRLINKIN ™ clcloudo -ba-baseds apapplicatcationio s, incincludinging Yelplp®®
andd iHiHeareartRat dio,,®® hihigh-gh-resr olutiotion Ln LCD CD touchshscrecreen en displalay, y, voivoice-c
actactivaiv tedd cocontrntrolsols, S, iriiusXusXMM®® AlAll Accecess ss RadRadio,,2 TrTraffiafficc®3®3 anand Travravel el
LinLink,k ®3 AMM/FM/FM ststeree o wwithith HDHD RaR dio,®® dudualal USBUS poort/rt/iPoiPodd®® contrtrol,ol,
andd BlBluetuetooto h® auaudiodio ststrear minng ag andnd hhands--frefree pe phonho e aandnd textextt
mesessagsaginging connenectictivitvityy
•• OptOptional PerPerforformmance e PacPackagka e4: Innclucludesdes Brembmboo®® peperfor rmaancence
brarakink g ssystys em,m, SACSA HSHS® perforformar ncence dampemp rs andand 177 x x 77.5-innchch
mululti-ti-spospoke k aluminminum-um-aalloy whewheelsels wiw th darark gk grayray finfi ish
Not equippedStandard Optional
2018 BRZ | Specifications2018 BRZ | Trim Levels
11
|2
01
8 B
RZ
2018 BRZ | Equipment
ExExExExExExExExtetetetettetet ririririororororororororBRZBRZBBRZBBRZB Z
PrePrePrePrePrePrePrePre imiummmmmmmmBRBRBBRBRZBRZBRB
LimLimLimLimLimLimLimLimiteiteiteiteddddBRZBRZBRZBRZBRZBRZBRZBRtStStStStStStStSt
LEDLEDLEDLEDLEDEDLEDED prprprprojeojeojeojeojeojeojeojector low-ow-owow-ow-ow-owow annanananannnd d hd d dd d d igh-be-be-bebe-be-be-be-beamamamam heheheheheahehehee dlightghtghtghtghtghthtghtsssssss
LEDLEDLEDLEDLEDLEDLEDLED ffffog lg lg lg lg lg lg lg lighighighighigighighig tstststsss
LELELELELEDLEDLELE taillllllllighighigighighighighighttstttsts
ReaReaReaReaReaReaReaRear br br br br bumpumumumumumumpum er witwitwitwitwitwitwitwitth ih ih ih ihhhh intententeententeteegrgrgggggragr tedddddteddted diddiddidididid ffuffuffuffuffuserserersersersererser
STISTISTISTITISTISTISTI frfrffrfrfrontontntontontntontnt, s, s, s, s, s, , s, side anananananananand rd rd rdd rd rd rd earararearearararar unuu derrrrererrerr sspspsspssps oiloililoiloiloilersersersersersersersers
TruTruTruTruTruTruTruTru knk spopopopopopopopoileiileileileiilerrrrr
STSTISTISTISTISTISTISTI carbobobobobobobobon finn finn fin fin fin fiberberberberberberberer rerr ar spospospospospospospspoileililileileilerrr
BlaBlaBlaBlaBlaBlaBlaBlack ccckckckcck BRZBRZBRZBRZBRZBRZBRZBRZ and Sd SSd Sd Sd Sd Sd SUBAUBAUBAUBAUBAUBAUBARU RU RURURURURURU adddddbadbaddgingigingingingingingi gggggg
DuaDuaDuaDuaDuaDuaDuaDuall sl sl staitaitaitaiaiaiaiainnlennnnnn ss-stestestestestestesteste lelel el exhexhexhexhexhexhexhexhaust ooooooooutlutuutluutlutlu etsetssssetsetss
BodBodBodBodBodBodBodBody-coloolooloolooloolooloolor pr pr pr prr ppoweoweoweoweoweoweowower sideidedededededee mimimmimimmim rrorroorrorroorroorsrsrsrsrsrsrsrs
CryCryCryCryCryCryCryCryr stal BBBBBBBBBlalaclaclalaclalalack SSSk SSk SSk Siliiliiliiliiliiliiliilica c powpowowowpowowpowowwer erer sidididsidsidsidsidside meeeeeee irrrrorsorsorsororsorsorsorsrs
HeaHeaHeaHeaHeaHeaHeaHeatedtedtedtedtedted sisisisisisisside ddddddd miriririrmirmiririrrorrorrorororrorrorrorssssss
SeSeSeSeSeSeSeSeatataaaaata inninning ggggggg ananananananand d d d ddd d TrTrTTTrTTT imimmmimmmm
6-w6-w6-w6-w-w6-w6-w-way ayayay ayayay manmamamamamamama ually y y y yy y y adjadjadjadjadjadjadjadjustustusttustuststustustaaabaabablabaa e drivrivrivivrivrivviver’er’er’er’er’er’er’er’s ss ss ss ss ss sss seaeaeaeateaeaeaea . 4-wawawawawawawaway myy my my my my my manuananananananuan ally aaaaadjudjudjudjudjudjudjudjustaastastastastastastableblebleblblebleblebl frontnttttttt-pa-pa-p-pa-pa-pa-pa-passessessessesseessesseennnnnngenn r’s seseseseseseseseat.atat.at.atatat.
PerPerPerPerPerPerPerPerP forforforforfformanmanmanmanmanmanmanance-cecce desdesdesdesdesdesdesdesigniiignign frfrfrrfrfrfrfrontononontontontonont seseeseeeseeatsatsatsatsatsatsatsats wiiiwiwithththththththth heiheiheiheihheihh ghththtghtghtghthtght-ad-ad--a-ad-a-ad-ada jusjusjusssjussjustabtabtabtabtabtabtabtabt lelele le heaheaheaheaheaheaheahead rddd rd restesteststestestestests rairarairarairairaraintssntsntssntsntss
HeaHeHeHeHeHeHeHeated frfrfrfrfrfrfrfroontontoontontontont seseseseseseseseatsataaaaaa
FlaFlaFlaFlaFlaFlaFlaFlat-ft ft fttt oldoldddddolddinginginginginginginging rerererear ar ar ar ar arar ar seaseasssseass tbatbababatbabababackckckcckckcc
LeaLeaLeaeaeaeaeaeathethethethethether-wr-wr-wr-wr-wr-wr-wr-wrappedededededededed 3-333-3-3 spospospospospospospopoke k steeeeeeeeerierierierierierierer ngngngngngng whewhwwwwhww el witwitwitwitwitwitwitwith rhh rh rh rh rh rh ed ed eded d ed ed ed d sssstis tchingingngngngingingngng
LeaLeaLeaLeaLeaLeaLeaLeaathetheththththether-wr-wr-wr-wr-wr-wr-wr-wraprapraprrraprr pedpedpedpedpedpedpedped 3-333333 spospopospospospospopooke ke kkkeke k stestetetestetetesteerierierierieriererieringngng whewhewhwhewhewhwhwh elelel el witwitwitwitwitwitwitwith rh rh rh rhhhh red edededdedededd accaccaacaccaccaca entntententntntentnts as as asss s as ndndndnddddnd stistististististististist tchtchtchtchingngingingingingngng
LeaLeaLeLeaLeLeLeLe ther-wr-w-wwwwwwrrapraprapraprapraprappedpedpedpedpedpedpedped shiftter er er er er er er er hannhanhannhanhanndledledldldledldldl
CloCloCloCloCloCloCloClothththtththth uphuphuphuphuphuphphuphp olsolsolsolsooolso terertertertertererteryyyyyyyy
AlcAlcAlcAlcAlclclclcantantantantantantaantaraaraaraaraaraaraaraara®®® and l l lllllleateateaeateateateateatherherherherherhererher-tr--t-t-t-t-t-t immeded ed ed ed ed ed ed uphuphuphhuphuphuphuphoololsooooo tery wy wy wy wy wy wy wy withithithithithithith rererererererered-eddddddd mbrbrbrrrrbroidoidoidoioidoidoidoiderereereereereereereedddd d d Bdd RZ loglogloglogloglogloglogo aao ao ao ao aao aandndndndndndndndn stitchchhhhhchhhingingingingingingining
AlcAlcAlcAlcAlcAlcAlcAlcantanttantaraaraaraaraaraaraarara®®®®®®®® anand ld ld ld ld ld ld ld leateateateateaeee herhererhererererher-tr-tr-tr-tr-t-tr-tr-trimmmimmmmimmmmed ed ededed edededd uphhuphuphhhupholsolsolsolsolsolsolsolso tertertery wy wy wy wy wy wy wy wi hithithith reerererereeed d d bd bd d bd d olsssolsssolssterterterterterterterters andndndndndndndndd stisstisstisss tchhhhchtchtchhingingingingingininging, and nd nd nd nd nd ndnd embembembembembembembembroiroiroiroiroiroroiroiderderddddd edededededededed logloglolologloglolo oo o
AluAluAluAluAluAluAluAluminum-um-m-m-m-m-m-m-allallllllallallalloy oy oy oy oy oy oy oy pppedppppp al covcovcovcovcocovcovcoversersersersrsersersers
CoCoCoCoCoCoCoConnnnnvnvnvenenenenenennenieieieieieieiei ncncncnccncncceeeeeeeee FeFeFeeFeeFeeatatatatatatataturururururureseseseseseseses
KeyKeyKeyKeyKeyKeyKeyKeyless As As AAAAAAcceccceccceccec ssssssssssssssss witwwwwww h PPPPPPPPushushushususushusush-BuBu-BuBu-Bu-Bu-BuBButtotttttttttt n SSSSSSSStartartartartartartartarttttt
AutAutAutAutAutAutAutAutu o-oo-oo-oo-oo-oo oo on/on/on/on/on/on/on/on/ooff f heaeaaaaaadlidlidlidlidlidlidlid ghtghtghtghtghtghttghtssssssss
PowPowPowowPowPowPowPower erer frofrofrofrofrofrofrofront nnn winnnnnnnndodowdodowdodowdodows w wws ws ws ws ws wwithiii auuuuuuuuto-to-to-toto-toto-to up///up///up/up/dodododowdodododod n
EleEleEleEleEleEleEleElectroninininininininic cc cc ccc c cc c cruiruiruiruiiruise sesesesesesese controtrotrorotrorororollllllll
3-s3-s3-s3-s3-s3-s3-s3-spokpp e se se se se se se se steeteettteeteeteet rinininrinrinrinnring g wgg g wg g g heeeeeeeeeeeeeeeel wl wl wl wl wl wl wl withhhithhithithith ininininininininntegttttegratatatatatatatateded ededed ed ed ed aududaudaudaududaududioioioioioioioio sysssy temtemtemtemtemtemtemtem BBB, BBBBBlueluelueluelueluelueluetoothhhhhhhh®®®®®®®® ananananana d cd cd ccd cd cd cd cruirurrrrrr se conconconconconcoconcontrotrotrotrooootrol bl bl bl bl bl bbl buttuuuuu onssssssss
TilTilTilTilTilTilTilTilt/t/tt/t/tt/tt/tt/tt/t/ eleeleeleeeleeleeleescoscscscscscscoscos ping sg sg sg sg sg s sg steetteeteeteetteeteerinrinrinrinrinrinrinring cggggggg oluumnmnmnmnmnmnmnmnm
RemRemRemRemRemRemRemRemovaovavaovavaovaovaovablbbblbleblblbl duual-al-al-al-al-al-al-al-cupcupcupcupccupcup hohohohohohohoholderssssssss inininininininin cencencencenncencenntertetertertetetete consonsonsonsonsonsonsonsolelelelelele
SinSinSinSinSinSinSinSingle boboboboboboobottlttlttlttttlttlttltt e he he he hhe he holdoldoldoldoldoldololder in nn eaceaceaeaceeaceaceace h dh ddh ddh dh dh doooorooooo paanenelnelnelnenelnelnele
12-12-12-12-12-12-12-12-volv t ppt pppt pppoweoweoweoweoowowower or or ooor or ooutlutututuuuu etss inininininninin cececececentententententetenteter cr rrr r rr onssnssssssoleoleoleoleoleoleoleole anannannanannd gd gd gd gd gd gd gd gd loveboeboeboeboeboeboeboeboe xxxxx
ClClClClClClClClimimimimimimimimattatattttee e e e e e e CoCoCoCooCoCoontntntntntntntntrolllll
MaMaManManManMaMaMa ually ly ly ly ly ly ly ly adjaaaadjadjadja uststustustststuststabababablablababab e CCe CCCCFC-FCFCFC-FC-FCFC-FC ffreefrefreee ae ae ae ae ae ae ae aair concononnnonnnditditdditditdididi iionnionionnninginginginginginginging syyyystestetetesteteteem wmm wm wm wm wmm ithithiththithhthth aiaaiaaaaa r filtrltrtrtrtrtrrratiatiatiatatatatatia ononononon andandandandandandandand rotartararararararary cy cy cy cy cy y y y onttntontontntontntrolrolrororororolrols for or r r r r temtemtetemtetemtetet perperperperpererereratatatatuatuatatat re,,,
4-s4-s4-s4-s4-s4-s4-s4-s- peep d fd fd fd fd fd f fffan an an an an aan ana andandandandndandandand airflow dw dw dw dw dw dw dw dw ireireireireireireirectictictictictictictictioooono
DuaDuDuDuDuDuDuDuD l-zonenenenenenenene auauauauauautomomtomtomtomtomomtomatic ddddddddigiigigiigiigiigigiigitaltaltaltaltaltal clclclclclclclc iiiiimai te conconcoconconconconco trotrotrootrotrotrool sl sl sl sl sl sl sl system m mm m m m m wwitwitwitwitwwitwith ah ah aah ah ah aaiiiiir ii filtrattttttttionionionionioionionio annananananannd d d d d d cd d ontrolololololololols fs fs fss fs fs orororororor tetetetemtetetete peratuatuatuatuatuatuatuature,re,rerere,re, 7-7-7-7-7-7-7-7-speed dd d d d d d
fanfanfanfanfanfanfanfan a, airflirflflflirflflflflow ow ow owow ow owow dirdirdirdirrdirectectectectectectectectiiiiiion, d dd, d, d, dd, dualualuaualualuuual-zoo-zo-zo-zo-zooonenenenene ne nenn lllloclockoukoukoukoukoukoukokout at at at at andndndndndndndnd CFCCFCCFCCFCCFCCFCCFCCFC-fr-fr-fr-fr-fr-fr-fr-freeeeeeeeeeeee airairirairairairairir cocococccccc ndidindindindiddndiditiotiotiotiotiotiotiotioninninninninnningggggg
InInnInInInInInststststsstststruruururuuumememememememementntttntntnttatatatatatatatatioiioiioioi nnnnnnnnBRZBRZBBRZBRZBBB
PrePrePrePrePrePrePrePre imiummmmmmmmBBBRZBBBBRB
LimLimLimLimLimLimLimLimLimiteiteiteiteddddBRZBRZBRZBRZBRZBRZBRZBRtStStStStStStStS
SpoSpoSpoSpoSpSpoSpoSport-rt-rt-rt-rt-rt desdededesdedesdede ign gagagagagagagagauugeugeuguugeugeuges ws ws ws ws ws ws ws with annnnnaloaloaloaloaloaloaloalol g sg sg sssg sg sspepepepeepepepepe dommmmmmmmeteeteeteeteteeteteeterrr,rr, cocococoocoocococoo lant ttttttttempempempempempempeem eraeraeraeraeraeraeraerature, fuefuefuefuefuefuefuefuel gl gl gl gl gl gaugaugaugaugaugaugaugauge and d d d d d dd cencencencencenccce tertertererterereterter--mountntntntntntntted ed ed ed eded eded
tactactactactactactactachomhomhomhommhomhomhometeeteeteeteeteeteeteeter withithithithithithithith innininini tegtegtegegteggegteggratratratratratratratrat ddddddded digdigdigdigdigdigdigdigdigitaititaitaitaiital ssl ssl sl sl sspepepepeepepepepe domomdomdomdomomdomdommeteeteteeteteeteeteet rrr
SpoSpoSpoSpoSpoSpoSpoSport-rt--rt-rt-rt--rt desdesdesdesdesdesdedesigni gagagagaaagaaugeugugeugeugeugugeuges ws ws ws ws ws ws ws wii hith annnnnnnaloaloaloaloaloaloaloaloa g sg sg sg sssg sg speepepepepepepepe dommmmmdommmeteteeteeteeteeteeteter,r,r,rrr, coocoocoocococococo llant tt tttttttempempempempempempempemperaeraeraeraeraeraeraeratttttturtt e, fuefuefuefuefuefuefuefueu l gl gl gl gl gl gaugaugaugaugaugaugaugauge, cenenenenennnnterterterteteterterter-mo-mo-momo-mo-momo-mountuuuuuuu eddddded dd
tactactactactactactactachommmmmmmeteeteeteeteeteeteeteeter wwr wr wwwithithithithithithithith integggteggtegeggratratratratratratratrat ded ededededed digdigdigdigdigdigdigdigital sssssssspeepeepepeepeepepeepe omdomdomdomdomdomdomdommeteeeeeee r aaaaaaaaand nd nd nd ndndnd nd 4 24 24.224 24 22-in-in-in-in-in-in-in-inch LCDLCDCDLCDLCDCDCDCDCD coococolororlorlorlorlorlorlor multiititititit funfunfunfunfunfunfunfunctitictictictiction on on on on on onon displalalalalalaplalay fy fy fy fy fy fy fy fororor
G-fG-fG-G-G-G-fG-G- orce me mmmmmmmeteeteeteeteeeteeter, r, r, r, r, r,r,r, sststoststsss p wwwwwwwatcatcatcatcatcatcatcatca h,h,h,hh, engenenenenenenen ine totototototototorqurqurqurqurqurqurqrque ce ce ce ce ce ce ce cuuuuuuurve mmmmmmmmmap ap ap ap ap ap ap apap andandandndandndndand otherr vevevevevevevevev hichichichichicle le le le le le e e funfffffff ctiiionsonsonsonsonsonsonsons
AuAuAuAuAuAuAuAudididididididd oooooo anananananaana d CoCoCoCoCoCoCoCommmmmmmmmmmmmmmunu iccccicciccatatatatatatatatioioiooioiooion n n n nn nn Syyyyyststststststststememememememeemssssssss
SUBSUBSUBSUBSUBSUBSUBSUBARURUARUARUARURURUARUU STSTSTSTSSTS ARLARLARLARLARLARLRLRLR INKINKIINKINKINKINKINK™™™™™™™™ 6.66.6.6.6.6.6.6 2-i2-i2-i2 i222 inchnchnchchnchnchchnchc MMMMMMu itiltiltiltiltiltiltimedmemedmedmedmemedme ia iaiaiaia witwitwitwitwitwitwitwi h Phhh Ph Ph Pandandandandandandandandandoraoraoraoraora,,,,,,®®®®®®®® iHiHiHiHiHiHiHiHeartRatRatRatRatRatRatRatRaadiodiodiodiodddio,,,,,,®®®® StStStStStStStStiiiititcitcherererherherherherer™™™™™™™ ananananand Ad Ad Ad Ad Ad Ad Ad AAhahhhhahaha™™™™™ smsmsmsmsmsmsmsmartartaartartaarta phophophophohophophohonne nnn appppppppppppppppp
intntntntntntntnttegregregregegregeegratiatiatiatiatiatiatiationoonononon,onon1 high-gh-gh-gh-gh-gh-gh-gh-resresresrresresoluoluoluoluoluoluoluolul tiottt n LLLCD CD CDCDCD CD CDCD C tououtoutououtoutououchschchchchchchchc creeen en en enen en enen disdisdisdisdidisdisdisplaplaplaplaplaplaplaplal y,y,y,yy,yy 8 sspeapeapeapepeapeapeapeakerrkerkerkerkers,s,s,s,s,s,s,s, AM/FM/FM/M/FM/FM/FM/FM/FM/M CDCDCDCDCD plaplaplaplaplaplaplaplap yeryyy , H, H HH H H H HDD RD RD RDD RD RD adiadiadiadiadiadiadad o® wiwiiiith th th th th th th th iTuiTuiTuiTuiTunesnesnenesnesnesnesnes®
tagtagtagtagtagtagagaggingingingingingingg g cg cg cg cg cg cg cg capabilbilbilbilbilbilbilbilityityityityityityityity, UU, U, U, U, USB SBSBSBSBSBSBSB port/it/it/it/it/it/it/it/iPodPodPodPodPPodPod®®®®®®®® cccocccccc ntrol,ol,ol,ol,ol,ol,ol,ol, SiSiSiSiSSSiriuriuriuuriuriuusXMsXsXsXsXsXsXsX ®®® AlAlAlAlAlAlAlAll Al All Al Al Al Al Acceecceccececcecceessssssss ssss Raddddddddio,io,ioio,io,io,io,io 22 BlBlBllBlBluetuetuetuetueuetueuetoothhhhhhhh®®®®®®®® auauauauaaaudiodioodiodioodioo sststsstsss reaminminminminminminminmini g ag ag ag ag ag andndnddndndndndnd
hahahanhahanhanhanha ds-frefrefrefrefrerefrefree pe pe pee pe pee phonhonhonhonhonhonhonhone ce onnnnnnnnnnnnnnnnectectecteectecteectiviiviiviiviiviviiviivityty,ty,ty,ty,ty,ty,ty and 3 33d 3d 3d 3d 3d 3 55.5-5-5-5-55 mm mmmmmm mm mm mm mm auxa iliilililiiiliaryaryaryaryaryaryaryary jajajajajajaaackckckckckckckckc
SUBSUSUBSUSUSUSUSUBARURURURURUARURURU STSSTSTSSTARLARLRLARLARLARLARLARLINKINKININK™ 7.7.7.7777.7.0-i0 i00 i0 inchnchnchchnchnchnchnchc MuMMuMultiltiltiltitiltiltiltimedmedmedmemmemedm ia iaiaiaiaaaia NavNavNNavNaNaNN igagaigagagaigaigaatiotiotiotiotiotiotiotion sn ssn systystystystystystystysts emeemeeeem witwitwitwitwitwitwitwith Ah Ahhhh Ahh Applpplplpplpplpplplple Ce ee e Ce Cee arPrParParParPrPrPrPPlaylaylallaylaayla ,™™™ AnAnAnAnAnAnAnAndroddrodd idddiddddd™™™™™™™™ AuAAAAuAAAuto,to,o,to,ooto,o,
PanPaPaPaPaPaPaPa dora,a,a,a,a,a,a,a,®®®®®®®® ananaananana d Ad Ad Ad Ad Ad Ad Ad Ahah ™ smmmmmsmsmmmartartartartaaartartphophophophophophophophoh ne appppppppppppppp ininiinininintegtegtegegtegtegtegegratrarrarararra ion,11111 STSTSTSTSTSTSTSTARLARLRLARLARLRLARLRLLINKININIININII ™ clclclclclclclcloudoudououdoudoudoudouo -ba-ba-baba-ba-ba-ba-babased apapapapapppppliplipplipliplpliplicatcattcatcatcatcattioioionioioioioio s, incncnccccccludludluludludludludlu inginggingingingingng YYYYYeYY lp®
andandandandandandandand iHHiHHHiHeareareareareareareareartRatRatRattRatRatRatRadiodiodiodiodiodiodiodioo,®®®®®®® hihihihihigh-gh-gh-gh-gh-gh-gh-gh-resresresrrresre oluoluoluluoluoluoluolutiotiotiotiotiottiotion Ln Ln Ln Ln LLLLCDCDCDCDCDCDCDCD toutouutouutoutouuchschschschschschschsch crecreeeeeen en en en en en en en disdisdisdissplaplaplaplaplaplaplaplayyyyyyy, y voivoioivoivoivoiiice-ce-ce-ce-ce-cece-ce actactactactctivaivaivaivaivaivaivaivav tedt dtt dtt dted cocococococococontrntrnnntrnntrntrolsolssolsolslssols, S, S, S, S, S, S, S, Sirii ii ii iiriusXusXusXusXsXusXsXsXMMMMMMM® AlAlAlAlAlAlAlAllllllllll
AccAccAccAccAccAccAccAccesssessessessessesss RaRRRRRRR dio,222 TrTrTrTrTrTrTrTraffiffiaffiaffiaffiaffiaffiafficccccccc®3®3®3®3®3®3®® and TTTTTTTTravraravraravraravravellelelelelell LinLinLinLinLinLinLinLink,®3 AMAMAMAMAMAMAMAM/FM/FM/FM/FM/FM/FM/FM ststsssssstereo wwwwwo wwwithithithithithtithith HDHDHDHDHDHDHDHD Radioooooooo,,,,,,,®®®®®®®® dudduddududual al al al alal al al UUUUSBUUUU popopopopopopopoort/rt/rt/rt/rt/rt/rt/iPoiPoiPoiPoiPooiPoiPodddddddd® contrtrtrntrntrntrntrtrol,ol,ol,ol,ol,ol,ol,o annnanananannd d d dddd d
BluBluBluBluBluBluBluBluetoetoetoe oetoothothothothothothothoth®®®®®® audiodiodiodiodiodiodiodioo ststststreaeareaeaeareareareaminmmminminmmm g aaaaaaaandnndnndndndndn hananhanhanananhanandsddsds-dds-ds-d freeefrefreeee pe pe pe pe pe pe pe pe honhonnnhonnnhone ae e e e e e e ddddnd textextextextextextextext mt mtt mtt messessessessessessessess iiagingggggggg cconconcconcocconnececnecececnececnectivtivtititittt ityyitttity
SeSeSeSeSeSeSeSecu iriiiiitytytytytytytyty
KeyKeyKeyKeyKeyKeyKeyKeyleslesleslessless es es es es es es es ttttntry sy sssssssystystystystystystystysy em mem memmemm witwitwitwitwitwwitwithhh ahh ah answnswnswnswnswnswnswnswer-errererr bacbacbacbacbacbacbacbackkkkkk eleclecleclececleclecectrotrotrotrottttr nicicnicnicniccnicnic chchchcchchchchiiiiiirp
AntAntAntAntAntAntAntAntithithithithiithiththefteftefteftefteftefteftft securrrityityityityityityityity sysysysysystestestestestestestestemm
EngEngEngEngEngEngEngEngiiine imimimimimmimmmobmobmobmobmobmobmobmobiliiliiliiliiliiliiliilizerzzzzzzz
SaSaaSaaSaaafefefefefefefef tytytytytytyyty
ACTACACTACACACACAC IVEEEIVEEVEE
VehVehVehVehVehVehVehVehiclicle Se Se Se Se S Se SStabttttatabtabt iliiliility ty ty ty ty ty ty ty ConCCCConCCC trotrotrotrotrotrotrotrol (l (lll (l (l SCCSCCVSCSCVSCVSC)))))))))
TraTraTraTraTraTraTraTraacticcticticctictionononononnonn CCCCConCCCC trooooooool Sl Sl Sl Sl Sl Sl Sl Systystystystystysttystemem emememememeem (TCS)S)S)S)S)S)S)S)S
4-w4-w4-w4-w4-w4-w4-w4-wheeheeeheeh eel al al al al al al a antinntinn lococcococcoclocck bkkk bk bk bkkk rakkrakkkrakkkingingingingingingngingg sysysyyyyystestestestestestesteste ((m (m ABSABSABSABSABSABSABSABSS) w) w) w) w)) ithithithththiththith EEElElEElE tecttecttttroronronronronronroronic ic BraBraBraBraBraBraBraBrakkkkke-forororfororforfororcececececcecce DisssDisssDisstritritritritritritritr b tb tbutionioniononionononon (E(E(E(E((( BD)BD)BD)BD)BD)D)BD)D)
BrBrBrBrBrBraBrBr ke AssAssAssAssAssssAssAssistististististtist
BraBraBraBraBraBraBraBrakekekkeke OveOveOveOveOveOveOveOve irridedeeeede ee SysSySysSysSysSysSysSyS tememtememtemememtemm
TirTirTirTirTirTirTirTiree Pe Pe Pee Pe Pe Presresresresresresresresssursssss e MMMMMMMMonionionioniononiononitortorortortortorortoringinginginginginginging Syyyystestestestestestestestem (m (m (m (m (m (TPMTPMTPMTPTPMTPMTPTPMP S))
LEDLEDLEDLEDLEDLEDLELEDL DaDDaDaaaytiytiytiytiytiytiytiytit memmememe RunRuRunRuRunRunRunRu ining Lg Lg Lg Lg Lg Lg Lg Lighighighighighighighg ts s ts tsts ts tss (D(D(DR(D(DR(DR(D( L)))L)))L))
ReReReReReaReReRe r-Visisisisisisisisionononon onononon CamCamCamCamamCamamCama era
PASPASPASPASPASPAPASPASA SIVIVSIVSIVSIVVSIVVSIVEEEEEEEE
SubSubSubSuSubSubSubSubaruu adadadadadadadadvanvanvanvanvanvanvanncedcedcedcedcedcedcedcedce frfffff ontontontontontontontontntal al al al al alalal airairairairairairairrbagbagbagbagbagbagbagbagb systestestestestestestestet m wm wm wm wm wm wm wm withithithithithithithith ddrddddd iveiveiveiveveiveveiver’sr’sr’sr’sr’sr’sr’sr’s ananananananand fd fd fd fd fd fd fd frrrroront-pt-pt-pt-pt-p-pt-p-passassassassassassasassa engengengengengengengnger’er’er’er’er’’eer s ffffffronronronronronronronronro t at at at at at att airbirbirbirbrbirbirbirbaagaagsagagaag (S(S(S(S(SS(SSRS)RS)RSRS)RS)RS)RS)RS)R 7
SidSidSidSidSidSidSidSidS e-curtrtrtrtrtrtrtrtainainainainainainaiain aiaiaiaiaiaiaiairbrbrbarbrbrbrbrb gs proproproproproproproprotectectectectectectectectintintintintintintiningg fgggggg ront at at at at at at at andndndndndndnd rearearerereareaearear occucucucuucuuupanpanpanppanpanpanpants tsts sts tsts ts (S(((S(SR(S(S( S)777777
SeaSeaSeaSeaSeaSeaSeaSe t-mt-mt-mt-mmt mt mmounounouououououounu tedt dtedtedt ddtedd frfrfrfrfrfrfrfrontontoontontontonto sisisisisisisiside-de-de-de-de-de-de-ded impimpimpimpmpimpmpimpactactactactactacacact aiaiaiaiaiaiairbarbarbarbarbarbarbarbab gs (SR(SR(SR(SR(SR(SR(SRSRRS)S)S)S)SS)SS)7
WhiWhiWhiWhiWhiWhiWhiWh plaplaaplaplaplaplaplash-shshshshshshsh protececececececececctiotitiotiotiotiotioti n fn fn fn fn fn fn ffronrororrorororo t seatatatateatatatatssssssss
HeiHeHeHeiHeiHeHeiHe hthtght-ad-ad-ad-ad-ad-adad-adjusjusjujusjusjusjusj tabtabtabtabtabtabtabtable llelellel frooooofront-nt-nt-nt-nt-nt-nt-nt-seaseaseaseaseaseaseaseat ht ht ht ht ht ht ht headee de rerererererereestrstrstrstrstrstrststrainainainainnainainntstststststststs
HeiHeHeHeHHeHeHe ght-adadadadadadadaddjusjusjusjusjusjusjusju tabtabtabtabtabtabtabtabble 3-ppppppppoinoinoinoinoinoinoinoint ft ft ft ft ft fft fronronronronronronrononront seatttttttbelbelbelbelbelbelbebelb tststststststs witwitwitwitwitwitwitwith pretetetttttetensensensensensenensensionionioniononionionioneeeeeeerse and fd fd fd fd fd fd fd forcorcorcorcorcorcorco e le le e le le le le liiiiiimiimi terssssssss
3-p3-p3-p3-p3-p3-p3-p3-poinoinoinoinoinoinoint st st st st st sst seateeeateeee belelbelbelelelelelts ts ts ts ts tsts tst at at at aatataat allallallallallallallall rrrrrer ar seaseaseaseaseaseaseaeatintintinttintinting pg pg pg pg pg ppg poooosiosiosoo tioootiooooonsnsnsnsnsnsnsns
LATLATLATLATLATLATLATLATCH CHCHCHCHCHCHCH syssysysysysysysys temmm: L: L: L: L: L: L: L: Loweoweoweoweoweoweoweeer Ar Ar Ar Ar Ar r Ar Anchorsorsorsorsorsorsorsorso ananananananannd Td Td Td Td Td Td Td Tethersrsrsrsrsrsrsrs fofofofofofofof r Cr Cr Cr CCr Cr Cr CHHHilHHHHH drenn
OpOpOpOpOpOpOpOpttitittittiononononononnonalalaaalaala EEEEEququququququququipipipipipippmememememememementtnt
PerPerPerPerPerPerPerPere forforforforforforforformanmamammamammm ce PacPacPacPacPacPacPacPackagkagagkagkagkagagkaggeee: Incluluuuuuuudesdesdedesdesdedesdes BrBrBrBrBrBrBrBrreembo®®®®®®®® peppeppepepeperforforforforforfooformrmrmrmrmarmrmrm nceeeeeee brbrbrbrbrbrbrbbrakiakiakiakiakiaking ngngngng ngngngg systemememememememem, , , ,,,, SACSACSACSACSACACSACACCHS® pepepepepeepeperforforrrforforforformarmarmarmamarmamarmance dadadadadaaaampempempempemmpempem rsrsrsrsrsrsrsrss
andandandandandandandanda 1717171717177 x x x x x x xx 7.5777 57777 5-inn-in-inn-in-innchchchchchchchchc mulmulmulmululmulmulmulti-ti-ti-titi-ti-ti-ti-t spospoke ke keke ke ke ke ke alualualualualua minminminminminminminminnuumum-allallallallallallallalloy oy oy oyoy oy oyoy whewhewhewhewhewhewheheeelselseelelseee wiwiiwiwiiwiiththththththththt dardardardardardark gk gk gk gk gk gk gk grayray finfinfinfinfinfinfinfinishishishishisishisish..... 4
2018 BRZ | Equipment
13
|2
01
8 B
RZ
Not equippedStandard Optional Available retailer-installed accessory
|2
01
8 B
RZ
15
2018 BRZ | Accessories 2018 BRZ | Owner BenefitsForForForForForFForFor aaaaaaaa ccccomplepleplepleplepleplepletetetetete lislislislislislislislist ottttttt f af avaivaivaivaivaivaivavailablablablablablablabblelelelelelelele accessessessesesessesssss oriorioriorioriioriories,esesesesesesese ivisitsititititsititt yoyoyoyoyyyoyour ur urr urrur
local lll l SubSubSubSubSubSubSubSS aruaruaruaruaruaruaruaru retaiaiaiiiiiiilerlerlerlelerlerlerler orororororororr vvvivvvvv sit wwwwwwwwwwwwwwww sw sw.sw.ssw sw sw.subaububububububub ru.comcomcomcomcomcocomcomo | FFFor adadadadadadadadditditditditditdditditionionionionionionionon lal SubSubububububSububaruaruaruaruaaru rerererererererer sourcercercercercercercercec s,s,s,s,s,, incincincincincincincincl dlludingingingingingngngngi owwwowowowowownernnnnenenen ’’s manmanmanmanmanmamamanualualualualualalualuals, sssssss maiaiaiaiaimaiiaintententententntententn nannannannannannanana ce
schschschschschschsscheduedededededededd les, r, r, r, r, r, r, r, roadoadoadoadoadoadoadoadsidsisisssisisi e assissississississississistastastastastastastancennncnncnn annnnd md md md md md md d moreoreorereoreoreoreore, logg onononononononon tototototototo wwwwwwwwwww .mymymymymymymymysubsubsubsubsubsubbsubaruaaaaaaa .coooommmmmmmm|
WaWaWaWaWaWaWaWarrrrrrrrrrrr anananananananantititttititt esssssss99999999
NewNeNeNeNeNeNeNe Caaaaaaaar Lr Lr Lr Lr Lr Lr Lr Lr imiimiimiimiimiimimiimitedtetetetetette WaaaaWaaarrarrarrarrarrarrarrarrar ntyntyntyntyntyntyntynty 3 yearearearearearearearearea s os os os os os os oor 3r 3r 3r 3r 3r 3r 3r 366,000 0 000 0 00 milmilmmilmilmilmilmiles,eses,es,es,es,es,es, wwwwwhww ichheveeveeveeveeveeveeveever cr cr cr cr ccr cr comeomomomomomomom s firstrstrstrstrstrststrsts ..
PowPowPowPowPowPowPowPowertertrtertrtertertertrairarrarrararar n Limimimimimiimiimiimitedteddtedtedtedtedted WaWWWWWWW rrantyntyntyntyntyntyntynty 5 y5 y5 y5 y5 yyy5 yeareaeaeaeeeaeae s or 6r 6r 66r 66r 6r 600 000,00,00,00,00 000 00 00 00 00 00 00 00 milmmm es,,,,, whwhwhwhwhwhwhwhichhichchichichichicheveeveveevevevev r comeomeomemeomememeomes fis fis fis fis fis firstrstrstrsrstrstrstrst.
WeaWeWeaWeaWeWeWeWWe r Ir IItemtemtemtemtemtemtetem LiLiLiLiLimitmitmitmitmitmitmitmi eded ed WarWarWarWaWarWarWaWarrannanranranrannntytytytytytytytyt 3 y3 yyy3 yy3 yyeareareareareareaearea s os os os or 3r 3r 3r 3r 3r 3r 3r 3r 6,06,06666,06,000 00 0 00 000 0 milmmilmilmmmmiles,esessses whwwwwhwwhw ichhhhichchhheveeveeveeveeveveeveever cr cr cr comeomomomomeomeomomes fis firstrstrstrstrstrstrstrst.
RepepepepepRepppairairaaairairaairs ts tts to to to to to to to to the hhhhhhh folololfolollllowlowlowlowlowlowlowlowo inginginginggngging ititititititititeems wiwiwiwiwiwiwiwill ll llllllllll alsalssalso bo bo bo bo bo bo bo be
covcovcovcovcovcovovcovovereeeeeeee d uundendendendendendendender Wr Wr WWr Wr Wr Wr WWeeeareeeeee Item m mmm m mm m LimLimLimLimLimLLimLimiteiteiteiteiteiteitetedddd Wd arrrrrrrrrrrrantantantantanantantanty:y:y:y:y:y:y:
• B• Brakrakrakrakrakrakrakrake Peeee Pe Pe Padsadsadsadsadsadsdsdsds
WW• WWWipeipeipeipepeipeipeiper Brr Br Br ladadadladladadadadeeeeeees
• C• C• C• C• C• C• Clutlutlutlutlutlutlutlutch Linnnnnnningingingingingingingingsssssss
• Tranananananananansmismismissmismismis tettettettettettetteteer Br rrrrr r atterierierierierierierierieseseesesees
RusRusRusRuRusRuRusRusR t Pt PPt PPPPt Perferferferferferferferforaoraoraoraoraaoratiotiotiotiotiotiotiotioi n LLLLn Limiimiimiimiimiimmiimitedtedtedtedted WaWaWaWaWaWaWaWarrarrarrarrarrantyntyntyntyntyntyntynt 5 y5 y5 yy5 yyyyeareareareareareareareae s, s,s,s, , unlunlunlunlunlunlnunlimimiimiimiimiimitedtedtededteddededed mimimmimmmm lealeaaaleaaaage.ge.ge.gegege.ge.ge
24-24-24-2424-24-24-24-houuhouhouhououhouur r Rr Rr Rr Rr Rr r oaddddddddsisidsidsidsisidsidss e AAe AAAe Ae AAssssssssssissss staaaaancncencncencenncencenc 3 yy3 y3 y3 y3 y3 yyeareaeaeaeaeaeaea s or 3r 3r 3r 3r 3r 3r 3r 336,066,06,06,06,06,06 00 00 00 00 00 00 00 0 milmmmmm es, whwhwhwhwhwhwww ichichichichhichhcheveeveveveveveveve r comeomeomeomeomeomeomeomm s fis fis fis fifirstrstrstrstrstrstrstrst.
1 Compatible smartphone and applications required. For applications to operate, latest version of each application is required. Data provided by smartphone is displayed on the audio system screen. Some state laws
prohibit the operation of handheld electronic devices while operating a vehicle. Smartphone apps should only be launched when vehicle is safely parked. Your wireless carrier’s rates may apply. 2 Activation and required
monthly subscription sold separately. Includes 4-month trial subscription. See your retailer. 3 Activation and monthly subscription sold separately. Includes 3-year trial subscription. See your retailer. 4 Not available with
automatic transmission. 5 Limited availability. See your retailer. 6 2018 EPA fuel economy estimates. Actual mileage may vary. 7 The Supplemental Restraint System (SRS) (airbags) affords the driver and the front
passenger additional protection in moderate to severe frontal and side-impact collisions and outboard 2nd-row passengers additional protection in moderate to severe side-impact collisions. This system provides
supplemental protection only, and seatbelts must be worn in order to avoid injuries to out-of-position occupants upon airbag deployment and to provide the best combined protection in a serious accident. Children
should always be properly restrained in one of the rear seats. See Owner’s Manual for recommended seating position. 8 Based on IHS Markit U.S. vehicles in operation vs. total new registrations MY2007–2016 as of
January 2017. 9 All Subaru vehicles sold by Subaru of America, Inc. are designed and built for normal driving conditions. The Subaru Limited Warranty, as well as the Subaru Added Security program, excludes damage
or failure resulting from modifications or participation in competition or racing events. See the Subaru Warranty and Maintenance booklet for further details.
PrPrPrPrPrPrPrPrototototototototeccecececececectitititititititingggggggg YYYYYYYYYououououoouoourrrrr rr InInInInInInInInI vestststststststststmemememememementntntntntntntnt SuSuuSuuSuSuSubababababbbabaru BBBBBBBBBadadadadaadada gegegegegegegege of OwOwOwOwOwOwOwOwnenenenenenenenerrsr hipppppppp
DuDuDuDuDuDuuDurrrararrararabibibibibibibibililllllll tyyyy
Once you’re part of our family, we’ll be there for you. Every Subaru comes with 24-hour
roadside assistance for 3 years or 36,000 miles. If you have trouble on the road, a tow to
the nearest Subaru retailer and other services are just a phone call away. And to protect
you over the long haul, we offer Added Security® ...ask for it by name—extended service
agreements and maintenance plans that will help protect your car for up to 7 years or
100,000 miles. They’re the only mechanical and maintenance plans backed by Subaru,
and because we’ve been backing them for more than 30 years, they’re agreements you
can trust. Your retailer has full coverage details.
ItItItItIttItIt’s’s’s’s’s’s’s’s’s nnnnotototottototot ddddddddisisisisssispopopopopopopopoosasasasablblblblblblblblble.eeeeeee IIIIIIIt’t’t’t’t’t’t’t’sssssssss fafafafamimimimimimimimimilyllylyllyll .
Liffffffe me me me me me me me me oveoveveoveoveoveveovees fss ast. D. D D D D D D Don’on’on’’on’on’on’o t st st st st st st st slow it dodododododododown wnwnwnnwnn wwwwwitwww h a cacacacacacacacar yr yr yr yrr yr ououououuououou canc ’t trutrutrutrutrutrutrutrust.ststtst.stst AtAtAtAtAtAtAtAtA Subarararrararrru,u,u,u,u,u,u,u, we we we we ewewee buibubbbbbb ld eacacacaceacacacacch oh ohh oh oh of of of of of of of of our vehhhhhhhhhiciclicliclicliciclicleseseseses witwiwwwwwiwi h the e e e e e e e
highigighighighighighiggheshhhhhhh t sssssssstantatantantantantantandardardardardardarrrdsds dsdsdsdsdsdsd of manmanmanmanmanmanmanmanufafufaufaufaufactuctuctuctuctuctuctucturing aaaaaag aandndndndnndndnd wittwitwitwittwitwith dh h hh h dh h h esignsgnsgnsgnsgnsgnsgnsgns hthththththatat at at at at atat areaaaaaaa inherherherherherherherhere enttentententently ly ly ly ly ly y y touttottttt gh h h h h h gh andandanandandanandand reeereereeresilsisisisisilsisi ient. It’It’It’It’It’It’It’It s ws ws ws wsss hy hy hy hy hyhy hy hy ouroooooo veveeveeeeehichichhhichichichicleslesslesllesless
excexcxcexcexcxcexcxcelel elelelellel in iiiiii thethethethethethehethe exexexextretrereretrereretrememe mmemmmem rigrigrigrigrigrigrigrigorsorsoroorsorsorsor ofofffofof rararararararararallyllllylllllllll raaraararaaacincincincincincincincing.g.g.g. AndAndAndAndAndAndAndAnd whhhhhhhhy 9y 9y 9y 9y 9y 9y 9y 98% 8% 8% 8% 8888 of of of of of ofof of SubSubSubSubSubSubSS baruaruaruaruaruaruaruaru vevevevehichicicichicichicicleslelesleslesleslesles sooosososoooldldldldldldldld inininin thethehethethehehehe lalallalall st ttttt 10 10 101010 10 1010 yeayyeayeayeay rs rs rs rs rs rsrs rs areareaaaarearea stststststtststillillillillillillillill onononoonoo
theeeheehehehe rororororororooadadadaddad adad todtodtotototototo ay.8yy ItIttItItItItIt’s ’s ’s’s ’s’s’s ’s alsalsalsalsalsalsalso wo oo wo wo wo o wo hy SubSubSubSubSubSubSubSubaruaruaruaruaruaruaru owowowowowowoo ners as as as as as as as arerererere re re so so soso so so so o liklikliililii ely toototototototo stststsststststay ay ay ay y ayay ay SubSuSuSuSSuSuSS aruuuuuu owowowowowowowownernernernernernernerers s sss s s fs or yeaeaeaeaeaeaeaearsrsrsrrsrsrsrs andandandndandandandandd yearssssss. W. W. W. W. W. W. W. Whathathathathathathatat’s ’s’s’s ’s’s’s’s more, e, e, e, e, e, e, e,
keekeekeekeekeekeekeekeee pinpppp g ccccccccararsarsarsarsarsarsars onononononononon ththtttttt e roadadadadadadadadd memememememeanananananansansan they y y y y y yy stastastaststastastastay oy oy oy oy oy oy oy outuuuuuuu of lananannanannndfildfildfilddfildfildfildfills lsllsllsls lolololololonlolo ger. AAAAAAAAnndndndndndndd if ifififififif wwe wwwwww can mamamamamamamamake kekekekekeke ththththethththth worldrldldrldrldrldldrldd aaaaa cleclecleclecleleclecleaaneaaaaaa r aaandndndndndndndnd
greregrereregregregreeneeeneeeneeneener pr pr pr pr pppplaclalalalalalaa e wwwwwwwwhilhilhilhilhilhilhilhi e me me me me makiakiakakiakakakiaking ng carcarcarararararars ts tsss tsss thathathatathatattt ininininininininspip reeeeeeee anandandaandandana momomomomomomomom tivtttt ateeeeeeee ththththththththeireireireir drdrdrdrdrdrdrdriveiviiviviviv rs,,,s,, wewewewewewewewe’ve’ve’ve’ve dodododododododone ourourourourourourourur jojjojojjobb.bb
STI Front Under Spoiler. STI Front Under
Spoiler gives the BRZ a mean, ground-
hugging look.
Rear Bumper Diffuser. Lower rear body panel
helps to direct airflow and adds a sculpted
finishing touch to the BRZ lower rear body line.
STI Side Under Spoiler. Continue the mean
ground-hugging look down the rocker panels
of the BRZ. Kit includes both left and right
side under spoilers.
STI Short-Throw Shifter. Significantly
reduces shift throw lengths for crisper shifts
and sportier driving feel.
Footwell Illumination Kit. Casts a soft blue or
red glow onto the front floor area.
Rear Bumper Appliqué. Clear, scratch-
resistant vinyl film helps to protect bumper
upper surface and leading edge. Includes a
discreet pearl-colored Subaru logo.
LED Upgrade - Dome Light. The LED dome
light offers brighter, whiter and crisper interior
lighting than the standard equipment lighting.
Auto-Dimming Mirror with HomeLink.®
This upgraded Auto-Dimming Mirror detects
glare and darkens automatically to protect
your vision while featuring an 8-point digital
compass. Three backlit HomeLink® buttons
can be programmed to operate most garage
doors, security gates, home lighting and
more. Can also provide you with the last
status of your garage door (open or closed) if
programmed to a compatible opener featuring
two-way communication.
10-inch Powered Subwoofer. Provides
powerful, deep bass and also assists in clean
sound reproduction from all vehicle speakers.
This is achieved by its integrated 100W
amplifier and a passive crossover network.
The self-contained unit mounts in the trunk.
Manufactured for Subaru of America by Kicker.®
Cannot be installed with Cargo Tray.
STI Alloy Wheels. The 17-inch 15-spoke
STI alloy wheel set helps to give the BRZ the
perfect blend of attitude and style, combined
with improved handling performance and
steering precision due to the reduced weight
of the alloy when compared to the stock alloy
wheels. The wheels are finished in black and
finished off with STI-branded center caps.
STI Rear Quarter Under Spoiler. Complete
the look on the side of the BRZ with the addition
of the rear quarter under spoilers. Kit includes
both left and right rear quarter under spoilers.
Sunshade. The foldable sunshade offers a
triple layer of protection to help reduce vehicle
temperature up to 40 degrees. Custom-cut to
fit properly, it includes a handy storage bag.
SubbbbbSubSubbaruaruarararararar owwwwnernenernernernernenee s as as are re re re re re re re driddridddridddrivennnnnnnn bybybybybybybyby thhththeireireireireireireireir passisissisississisis onononsoononsonso . WWWW. W. WWWhehehehhethethethethererherherherererr hihhihhhhihikinkkinking tg tg tg tg tg tg tg too soooooo ee
a sunsnsnsnsnsnsnsnssetetetetetetet or oror oror r or or skisssss ing ththththththththhrourourourrourourourough gh gh gh gh gh ghgh h fffref sh powpowpowpowpowpowpowppowderderderdererderderder. P. . . . . . adddddlinlinlinlinlinlinining tg tgg tg tg tg tg throhrohrohrohrorohrohrouuuuuuugh raaaaaapidpidpidpidpidpidpidpidp s os os os os os oos orr r r r r r r
plaplalllplayinyinyinyinyinyinyinyini g fg fggggg etcccccccch wh wh wh wh wh wh wh withithithithithhithth thtthththththt eir fuuuuuuurryrryrryrryrrrryrryrryr frfrffffrienenienenienienieniendd. ddddd Forrrrrr mamammmammam ny,ny,ny,y,ny,y oououooooo r exclclclclxclxclclclusiusiuusiuusiusiusiveve ve e veeee BBBBadBaBBB ge ge e e
ofof of OwnOwOwnOwnOwnOwnOwOwnersershiphiphiphiphiphiphiphip leleletsss ts s ts thethethethethethththem ppm pppm ppperserserserserserserer onaaaonaaonaaalizlizlizlizlizlizlizlize teee te theieiheieieiheieieir vr vr vr vr vr vr vr ehiehiehicleclecleclecleclecleclel anand e eed eeeed exprxprxpxpxprxpxx essssssesssssssess thttthththththeirieir
iintererererererererestsstssssstsstss . O. OOOO. O. OOOwwwwwwwneww rs cancancacancancancacaa gogogogogogg totototototototoo b dbaddddbadgeogeogeogeogeogegeogeofowwwfowfowfowwwnnennernnnn shihiiiishiip.cp.cp.cp.cp.cp.cp.cp.commmomommm totototototototo orderererererdererer FREFFFREFFFFREEEEEEEEE
SubSubSubSubSubSubbbaaaruaaaaa Badgedgedgedgedgedgedgedge ofofofofofof OwOwOwOOOOOO nershishishishishishihishih p lp lp lpp lp lp lp ifeifeeifeifeifeifeestyststststyststst le icoooooooons.ns.ns.ns.nsns.ns.nss
166.7" 69.9"
101.2"
29.9"41.9"
37.1
"
35.0
"
60.6"
6.9 cu. ft.
50.6
"/52
.0"1
59.8"
77.8"
2018 BRZ | Colors2018 BRZ | Dimensions
Headroom (front/rear)
Legroom (front/rear)
Shoulder room (front/rear)
Passenger volume
Trunk volume
37.1 inches/35.0 inches
41.9 inches/29.9 inches
54.5 inches/51.7 inches
76.5 cubic feet
6.9 cubic feet
Ice Silver MetallicCrystal White Pearl
Crystal Black Silica
Pure Red
WR Blue Pearl
Preproduction vehicles shown, production vehicles may vary. Some images shown are for illustration purposes only. Specifications in this brochure are based on the latest product information available at the time of
publication. For the most up-to-date and detailed product information, log on to www.subaru.com. Some equipment shown in photography in this brochure is optional at extra cost. Specific options may be available
only in combination with other options. Specific combinations of equipment or features may vary from time to time and by geographic area. Certain accessories and equipment may not be available at the time of
publication. Subaru of America, Inc., reserves the right to change or discontinue at any time, without notice, prices, colors, materials, equipment, accessories, specifications, models and packages without incurring
any obligation to make the same or similar changes on vehicles previously sold. Colors shown may vary due to reproduction and printing processes.
This brochure was prepared by Subaru of America, Inc. A warranty from Subaru of America, Inc., is available only on cars sold to the first retail purchaser through an authorized Subaru retailer in the continental
U.S. or Alaska. Subaru, SUBARU BOXER and BRZ are registered trademarks of SUBARU CORPORATION. Added Security is a registered trademark of Subaru of America, Inc. Confidence in Motion and STARLINK
are trademarks of SUBARU CORPORATION. Apple®, iPod® and iTunes® are registered trademarks of Apple Inc. Alcantara® is a registered trademark of Alcantara S.p.A. and Alcantara is produced by Toray Group.
Aha™ is a trademark of Harman International Industries, Inc. SiriusXM® is a registered trademark of SiriusXM Radio Inc. TORSEN® is a registered trademark of JTEKT Torsen North America, Inc. Bluetooth® is a registered
trademark of Bluetooth SIG, Inc. HomeLink® is a registered trademark of Gentex Corporation. Kicker® is a registered trademark of Stillwater Designs and Audio, Inc. HD Radio® is a registered trademark of iBiquity
Digital Corporation. iHeartRadio® is a registered trademark of Clear Channel Communications, Inc. Pandora® is a registered trademark of Pandora Media, Inc. Stitcher™ is a trademark of Stitcher, Inc. Brembo®
is a registered trademark of Brembo S.p.A. SACHS® is a registered trademark of ZF Sachs AG Corporation. Michelin® is a registered trademark of Michelin North America Inc. For more information, contact your
Subaru retailer or log on to www.subaru.com.
166.7 inches/69.9 inches (77.8 inches,
including mirrors)/50.6 inches (52.0 inches,
including antenna)
101.2 inches
59.8 inches/60.6 inches
BRZ Premium: 2,789 lbs/N/A
BRZ Limited: 2,798 lbs/2,840 lbs
BRZ tS: 2,842 lbs/N/A
0.272
PaPaPaPaPaPaPaPainiiiniinii tttt
UpUpUpUpUpUpUpUphoh lslslslslslslssteteteteteteteteryryyryryyyy
CoCoCooCoCoCoCololollolololoor rrrrrrr CoCCCCCoCCC mbmbmbmbbmbmbmbbinininininininnatatatatatatattioiioioioioiionsBRZRZRZRZRZRZRZRZ
PrePrePrePrePrePremiumimimimiumimimi mBRZBBBB
LimLimLimLimLimLimLimLimiteiteiteiteiteiteddddddddBRZRRZBRZBRZBRZRZBRZRZtSSSSSSS
CryCryCryCryCryCryCryCrystastasstastastastas l Wl W Wl Wl Wl Wl Wl Whithhhithhh e PPPPPe PPPPeareareareaeaearearearlllll BCBCBCBCBCBCBCBC BABBBABBB RBRBRBRBBRBRBBRB
IceIceIceIceIcIceIceIceIce SiSiSiSiSiSiiSilvelvelvelvevelvelvelver Metaetaetaetatatatatallillillillillillilliccccccc BCBCBCCCCCBC BA ———————
PurPurPure Re Re Re Re Re Re Re Rededee BCBCBCBCBCBCBCBC BABABBBB ————————
WR RRRRRR BBlBluBlBluBluBluBlue Pe Pe Pe Pe PPe Pe Peeearl BCBCBCBCBCBCBCBCC BABBABBABABAB RBRBBBBBBBB
DaDaDaDaDarDarDaDa k GGrayrayrayrayrayrayrayray MeMeMeMeMeMeMeetaltatatatatatata lic BCBCBCBCBCBCBCBC BABBABABABABA ——
CryCryCryCryCryCryCryryystasssstal Bl BBBBBl BBBlalaclaclallalala SSSSk Sk Sk SSiliililiiliilililiil cacac BCBCBCBCBCBCBCBCC BBBBBBABA RBBRBBBRBRBRB
— N— N—— N— N— N— N— ot ototot ototot ot ot availaaaaaaaableblebleblebleblblebl
1 50.6" without antenna, 52.0" with antenna. 2 BRZ Premium and BRZ Limited models only.
Dark Gray Metallic
Black Cloth
(BC)
Black Leather /
Alcantara®
(BA)
Red Leather /
Black Alcantara®
(RB)
Length/Width/Height
Wheelbase
Track (front/rear)
Base curb weight
(manual/automatic)
Coefficient of drag
(Cd)
Love. It’s what makes a Subaru, a Subaru.
Find out more about our efforts to
keep it cleaner and greener.
subaru.com/environment
These brochures were printed with vegetable-based inks and produced using a “Green Printing Process.” The Forest Stewardship Council® (FSC®) is an international organization that brings people together to find solutions which promote responsible stewardship of the world’s forests and environments. By producing these brochures in a green way rather than by traditional methods, we saved 19 trees preserved for the future; 9,115 gallons of wastewater flow saved; 611 lbs solid waste not generated; 1,680 lbs net greenhouse gases prevented; 9,000,000 BTUs energy not consumed. Calculations provided by Environmental Paper Network. FSC® is not responsible for any calculations on saving resources by choosing this paper. This brochure is printed in the U.S.A. on 10% recycled paper. ©2017 Subaru of America, Inc. 18BRZ.SRB.525 (S-21419, 50K, 1/18, CG)
Online: tour.subaru.com/BRZ2018
It’s the ultimate way to get to know the BRZ
on your terms. Get up close and personal with
color configurators, videos, 360-degree views,
interactive content and so much more.
Take a Guided Tour