BROCK UNIVERSITYexams.library.brocku.ca/download.php?md=Biology/BIOL 1F90...BROCK UNIVERSITY Final...

BROCK UNIVERSITY

Final Exam: April, 2011 Course: BIOL lF90 Date of Exam: Thursday, April 21, 2011 Time of Exam: 1400-1700 Hrs

Instructions:

of21

Number of Pages: 21 Number of Students: Number of Hours: 3 Instructor: F. Hunter

D.Bruce

• Write your name and ID in the spaces prOvided on the exam script.

• There are two parts to this exam:

PartA.

PartB.

Multiple Choice. One mark each for a total of75 marks. Answer on the Scantron sheet provided using an HB pencil

Short Answer Questions. Total of 2 5 marks Answer on the exam script in the spaces provided.

BIOL 1F90 April 21, 2011 of21

NAME: STUDENT I.D.#

Lab Date & Time: _________ _ Week A orB: _______ _

PART A. Multiple choice questions (1 mark each, 75 marks total)

1) The nitrogenous base adenine is found in all members of which group? A) proteins, triglycerides, and testosterone B) proteins, ATP, and DNA C) ATP, RNA, and DNA D) alpha glucose, ATP, and DNA E) proteins, carbohydrates, and ATP

2) Using RNA as a template for protein synthesis instead of translating proteins directly from the DNA is advantageous for the cell because A) RNA is much more stable than DNA. B) RNA acts as an expendable copy of the genetic material, allowing the DNA to serve as a permanent, pristine repository of the genetic material. C) many mRNA molecules can be transcribed from a single gene, increasing the potential rate of gene expression. D) B and Conly E) A,B,and C

3) The anticodon of a particular tRNA molecule is A) complementary to the corresponding mRNA codon. B) complementary to the corresponding tripi,et in rRNA. C) the part of tRNA that bonds to a specific amino acid. D) changeable, depending on the amino acid that attaches to the tRNA. E) catalytic, making the tRNA a ribozyme.

4) What are the coding segments of a stretch of eukaryotic DNA called? A) introns B) exons C) codons D) replicons E) transposons

5) What type of bonding is responsible (01" maintaining the shape of the tRNA molecule? A) covalent bonding between sulfur atoms B) ionic bonding between phosphates C) hydrogen bonding between base pairs D) van der Waals interactions between hydrogen atoms E) peptide bonding between amino acids


NAME: STUDENT I.D.#


6) Choose the answer that has these events of protein synthesis in the proper sequence. 1. An aminoacyl-tRNA binds to the A site. 2. A peptide bond forms between the new amino acid and a polypeptide chain. 3. tRNA leaves the P site, and the P site remains vacant. 4. A small ribosomal subunit binds rih mRNA. 5. tRNA translocates to the P site.

A) 1,3,2,4,5 B)4,1,2,5,3 e) 5,4,3,2, 1 D) 4, 1,3,2,5 E)2,4,5,1,3

7) If proteins were composed of only 12 different kinds of amino acids, what would be the smallest possible codon size in a genetic system wiith four different nucleotides? A) 1 B)2 e)3 D)4 E) 12

8) Once transcribed, eukaryotic mRNA 1;ypicaUy undergoes substantial alteration that includes A) excision of introns. B) fusion into circular forms known as plasmids. e) linkage to histone molecules. D) union with ribosomes. E) fusion with other newly transcribed mRNA.

9) If the triplet CCC codes for the amino acid proline in bacteria, then in plants CCC should code for A) leucine. B) valine. e) cystine. D) phenylalanine. E) proline.

10) AU of the following are directly involved in translation except A)mRNA. B)tRNA. e) ribosomes. D) DNA. E) aminoacyl-tRNA synthetase enzymes.

11) We now know that the one gene-one enzyme hypothesis is not entirely accurate because A) many genes code for proteins that are not enzymes. B) a single gene codes for a single polypeptide chain, and many enzymes are made up of more than one polypeptide chain. e) many genes code for RNA molecules that have no enzymatic activity. D) A and B only E) A, B,and e

BIOL 1F90 April :21,2011 of21

NAME: STUDENT I.D.#


12) The last amino acid added in a polypeptide chain is said to be at the __ of the protein A) 5' end B) 3' end C) N terminus D) C terminus E) 60S side

13) The protein that promotes the termination of translation is called A) terminator B) polypeptidase C) release factor D) end factor E) telomere

14) RNA polymerase and DNA polymerase differ in that A) RNA polymerase uses RNA as a template. and DNA polymerase uses a DNA template. B) RNA polymerase binds to single-stranded DNA, and DNA polymerase binds to double-stranded DNA. C) RNA polymerase is much more accurate than DNA polymerase. D) RNA polymerase can initiate RNA synthesis, but DNA polymerase requires a primer to initiate DNA synthesis. E) RNA polymerase does not need to separate the two strands of DNA in order to synthesize an RNA copy, whereas DNA polymerase must unwind the double helix before it can replicate the DNA.

15) Which of these correctly illustrates the pairing of DNA and RNA nucleotides? A) GTTACG with CAATCG B) GTTACG with CAAUGC C) GTTACG with GTTACG D) GTTACG with ACCGTA E) GTTACG with UAACAU

16) Which of the following is not related to ribosomal activity? A) the A site B) spliceosome C) codon recognition D) peptide bond formation E) the P site

17) As a ribosome translocates along an mRNA molecule by one codon, which of the following occurs? A) The tRNA that was in the A site moves into the P site. B) The tRNA that was in the P site moves into the A site. C) The tRNA that was in the P site moves to the E site and is released. D) The tRNA that was in the A site departs from the ribosome. E) Both A and C are correct.

18) What is an anticodon part of? A) DNA B) tRNA C)mRNA D} a ribosome E) an activating enzyme


NAME: STUDENT I.D.#


19) The Hardy-Weinberg equation states ,that p2 + 2pq + q2 = 1; the genotype frequency of heterozygotes is represented by A) p2 B) 2pq C)q D) p2 +q2 E) p2 + 2pq

20) A mutation arises in an individual that ,can decrease that individual's Darwinian fitness. This means that this individual's A) stamina will increase.

B) ability to utilize food will remain the same.

C) ability to produce offspring and contribute to the gene pool of the next generation will decrease.

D) probability that it will face elimination by natural selection will increase.

E) ability to produce offspring and contribute to the gene pool of the next generation will decrease and probability that it will face elimination by natural selection will increase.

21. Below is a list of phenomena that can occur in a population, which of these would violate the conditions for the Hardy-Weinberg equation? A) The population is large. B) Mating is nonrandom. C) Migration does not occur between different populations. D) Natural selection is not occurring. E) No new mutations arise.

22. Factors that govern microevolution al'c rooted in two related phenomena as follows A) first, introduction of new genetic variation into a population and second, mutations. B) first, altering the prevalence of a given .allele or genotype in a population and second, mutations. C) first, introduction of new genetic variation into a population and second, altering the prevalence of a given allele or genotype in a population. D) first, splitting up a population and second, migration. E) first, nonrandom mating and second, no lIlatural selection.

23. Female peahens choose a male peacock for mating because of the male's long, colourful tail

feathers and their courtship display. This is which type of sexual selection? A) Intrasexual selection. B) Robustness selection. C) Intersexual selection. D) Cryptic selection. E) Balancing selection.

24. Fitness is a measure of reproductive success. If an individual with genotype BB produces 6 offspring, and a heterozygous individual (Db) produces 10 offspring, and a third individual with genotype bb produces 5 offspring, what is the fitness value for the individual with BB genotype? A) 1.0 B) 0.5 C) 0.6 D) 0.4 E) 1.1


NAME: STUDENT I.D.#


25. In humans, sickle-cell anemia is caused by an allele that results in abnormal hemoglobin that sickles red blood cells in certain situations. Individuals who are heterozygous for normal and sickle-cell alleles are protected from malaria; homozygous normal has no protection and homozygous sickle-cell has symptoms such as low tolerance for exertion and a shortened life span. This is an example of: A) stabilizing selection.

, B) directional selection. C) disruptive selection. D) balancing selection. E) cryptic selection.

26. Natural selection is one mechanism to ·change allele frequency in a gene pooL What is the name of the mechanism that fosters change in allele frequencies due to random chance? A) Genetic Drift. B) Natural selection also fosters these changes. C) Non-Darwinian evolution. D) Neutral variation. E) Gene flow from one population to anoth(~r.

27. Over generations in a population, ind~viiduals with higher Darwinian fitness values will: A) become less prevalent due to natural sel,e.ction against them. B) become more prevalent. C) stay at the same frequency in the population. D) become less prevalent due to their having (,ess stamina. E) become less prevalent due to intrasexual selection against them and a lack of physical strength.

28. Which of the following CANNOT under;go microevoIutionary change? A) a poison ivy vine growing up a tree in SL Catharines B) the cactus finches of the Galapagos Islands C) the Venus Fly traps in Green Swamp in southeastern North Carolina D) the corals in a reef off the east coast of Australia E) the fire ants endemic to South America

29. Which of the following would most Iite~y result in a bottleneck event and why? A) A small population of geese migrates and joins a large nesting flock of the same species. This is a bottleneck event because the small population does not bring in any new alleles to the large flock. B) A mutation occurs in an individual poison ivy plant, doubling the number of seeds it produces. This is a bottleneck event because even though the mutation is passed down to the next generations, it does not change the frequency of any other alleles in the population. C) A hurricane blows through a coastal swamp, killing 98% of the snails in a population. This is likely a bottleneck event if the surviving 2% of the snails, by chance, have allele frequencies that are not characteristic of the original population. D) A large population of broomsedge grass in a field is determined to be in Hardy-Weinberg eqUilibrium. This is a population bottleneck event because there is no random mating going on which increases the likelihood that there will be a decrease in the number of alleles in the population. E) A small population of ducks with red b~uks join a large population of ducks that have no red beaks. After 5 generations the number of ducks wiah r:ed beaks is reaching 50% in the population. This is a bottleneck event because there is a decrease in the number of ducks without red beaks.


NAME: STUDENT I.D.#

Lab Date & Time: ________ _ Week A orB: _______ _

30. In the biological species concept, reproductive isolation: A) prevents one species from interbreeding successfully with another. B. separates males from females except durmng breeding season. C) is only considered relevant when it occms prezygotically. D) describes the separation of incompatible gametes E) none of the above is correct.

31. During spring time in Maine, male moose often enter a cow pasture and begin calling to the female cows. The moose may even try tODlonnt the female cow but the male moose's genitalia do not fit properly inside the female cow's genitalia. This is an example of: A) mechanical isolation. B. temporal isolation. C) habitat isolation. D) behavioural isolation. E) gametic isol~tion.

32. Frogs "croak" at night to allure fem:ales for mating. Females are attracted only to the song of con specifics. This is an example of: A) mechanical isolation. B) temporal isolation. C) habitat isolation. D) behavioural isolation. E) gametic isolation.

33. A Hger is a result of a mating betweeil.a male lion and a female tiger. Male ligers are usually sterile. This is an example of: A) a prezygotic mechanism. B) hybrid inviability. C) hybrid sterility. D) hybrid breakdown. E) mechanical isolation and hybrid sterility both playa role.

34. Approximately 3.5 million years ago the Isthmus of Panama formed. This new landmass severed the connection between the Pacific Ocealll and the Caribbean Sea. An ancestral fish popUlation (porkfish) was split in two by this event; ~h.e two populations no longer interbreed and are two distinct species. This type of speciation is ,ealled: A) allopatric speciation. B) parapatric speciation. C) hybridization. D) sympatric speciation. E) sexual selection due to ecological variation.

BIOL 1F90 April '21, 2011 of21

NAME: STUDENT 1.0.#

Lab Date & Time: _________ , Week A orB: _______ _

35. A storm blows a small group of mign~rtjng birds off course and they land on an island too far from the mainland for them to fly back on course. The birds remain on the island for 100 generations when a second storm blows more birds from the mainland to the island. The new birds cannot mate with the established birds, even though they are originally from the same population. What has occurred to bring about this speciation? A) Genetic drift. B) Doubling of chromosome number in the mainland birds. C) Geographical isolation resulting in reproductive isolation. D) Development of a reproductive isolating mechanism dealing with sperm count. E) All of these.

36. A population of mountain goats is split into two subpopulations because of the formation of a glacier. After 5000 years the glacier melts and the two subpopulations reunite. A potential hybrid zone may occur if A) both pre-mating and post-mating isolating mechanisms occur. B) reproductive isolation is incomplete. C) a geographic barrier is removed after repmductive isolation is complete. D. both pre-mating and post-mating isolating mechanism occur and reproductive isolation is complete. E) predators are abundant.

37. Sympatric speciation differs from aU()patric speciation because with sympatric speciation A) a population becomes geographically isolated. B) two populations of the same species me~ge to form a single population. C) polyploidy (changes in the number of sets of chromosomes) arises. D) hybrid zones form. E) temporal factors may arise without geographic isolation occurring and polyploidy may arise.

38. Allopatric speciation occurs because a population A) merges with another population of the same species. B) becomes geographically isolated and undergoes genetic change. C) becomes extinct and is replaced by a population of a different species. D. shows no genetic change from generation to generation. E) exhibits hybrid sterility.

39. Species evolve continuously over long spans of time according to the concept of A) punctuated equilibrium. B) gradualism. C) developmental evolution. D) anagenesis. E) sexual selection.


NAME: STUDENT I.D.#

Lab Date & Time: __________ _ Week A orB: _______ _

40. In comparing the development of tbe uDwebbed foot of the chicken and webbed foot of a duck A) BMP4 is expressed in the foot of a chicken and gremlin in the foot of a duck. B) BMP4 and gremlin are expressed in both chickens and ducks, but gremlin is expressed throughout the duck leg and not expressed between the toes of chickens. C) BMP 4 is expressed in the foot of a duck and gremlin in the foot of a chicken. D) BMP 4 is expressed between the toes of a Ichicken and gremlin between the toes of a duck. E) BMP 4 is not expressed in the chicken but is in the duck.

41. The study of biological diversity and evolutionary relationships among organisms is: A) nomenclature. B) taxonomy. C) ecology. D) systematics. E) biology.

42. Which of the following organisms wo~dd NOT be classified in the Domain Eukarya? A) Canis lupis (wolf). B) Loxodonta cyclotis (forest elephant). C) Salmonella enterica (bacteria that causes. food poisoning). D) Aleuria aurantia (ascomycete fungus). E) Sequoiadendron giganteum (Giant Sequoia tree).

43. Linnaeus began naming organisms that were alike by using Latin names. He gave each organism two names, such as Canis lupis, the name for a wolf. What type of naming system is this? What taxonomic group does "lupis" designate? A) Binomial nomenclature; genus. B) Binomial nomenclature; species. C) Zoological nomenclature; genus. D) Zoological nomenclature; species. E) Binomial nomenclature; dog family taxon.

44. Three living species X, V, and Z share a common ancestor, T. A grouping of species T, X, and Z (but not Y) makes up: A) a valid taxon. B) a monophyletic clade. C) an ingroup and an outgroup at the same time. D) a polyphyletic grouping. E) a paraphyletic clade.

45. How would one apply the principle of parsimony to the construction of a phylogenetic tree? A) Choose the tree that assumes all evolutionary changes are equally probable. B) Choose the tree in which the branch points ,are based on as many shared derived characters as possible. C) Base phylogenetic trees only on the fossH record, as this provides the simplest explanation for evolution. D) Choose the tree that represents the fewest evolutionary changes, either in DNA sequences or morphology. E) Choose the tree with the fewest branch points.

BIOL 1F90 Apri121,2011 of21

NAME: STUDENT LD.#


46. Of the following anatomical structur,es., which is homologous to the wing of a bat? A) dorsal fin of a shark B) tail of a kangaroo C) wing of a butterfly D) tail fin of a fish E) arm of a human

47. Which of the following is the primary site of nutrient absorption in the mammalian digestive system? A) pharynx B) stomach C) small intestine D) large intestine E) pancreas

48. Digestion of which major nutrient type .begins in the stomach? A) carbohydrates B) lipids C) nucleic acids D) proteins E) vitamins

49. The diarrhea that is a symptom of diseases like cholera is due to problems in the function of which digestive organ? A) stomach B) small intestine C) large intestine D) appendix E) gall bladder

50. Cows are able to survive on a diet consisting almost entirely of cellulose because A) cows are autotrophic. B) the cow, like the rabbit, ingests its feces. C) cows can manufacture all 20 amino acid..;; ·Qut of sugars in the liver. D) unlike humans, the saliva the cow produces has enzymes capable of digesting cellulose. E) cows have cel1ulose-digesting, symbiotic: microorganisms in their rumens.

51. What is peristalsis? A) A process of fat emulsification in the smaH intestine. B) Voluntary control of the rectal sphincters regulating defecation. C) The transport of nutrients to the liver thmugh the hepatic portal vein. D) Loss of appetite, fatigue, dehydration, and nervous disorders. E) Smooth muscle contractions that move food through the alimentary canal.

BIOL 1F90 April 21,2011 of21

NAME: STUDENT I.D.#


52. How does the digestion and absorption of fat differ from that of carbohydrates? A) Processing of fat does not require any digestive enzymes, whereas the processing of carbohydrates does. B) Fat absorption occurs in the stomach, wBcl!eas carbohydrates are absorbed from the small intestine. C) Carbohydrates need to be emulsified befor.e they can be digested, whereas fats do not. D) Most absorbed fat enters the lymphatic system, whereas carbohydrates directly enter the blood. E) Fat must be partially digested by bacteri~k in the large intestine before it can be absorbed, which is not the case for carbohydrates.

53. Cats cannot synthesize the amino acidltaurine. This means that in cats, taurine A) is not a required nutrient. B) is an essential amino acid. C) is a nonessential amino acid. D) must be stored in cellular compartments., E) is not present in their normal diet.

54. Humans are susceptible to scurvy becftlftse A) they cannot synthesize amino acids. B) they do not have enough adipose tissue for vitamin A storage. C) they cannot synthesize vitamin C. D) they have a high incidence of fruit allergies. E) constant seasickness and nausea on long voyages leads to weakness and anemia

55. Salivary glands secrete ____ to start the digestion of ____ --: A) amylase, starch B) trypsin, proteins C) amylase, fats D) pepsin, proteins E) lactase, milk

56. The surface area of the small intestine is dramatically increased due to the presence of ____ on the luminal surface. A) villi and microvilli B) lacteals C) capillaries D) hydrolytic enzymes E) smooth muscle

57. Which of the following is NOT a fate of glucose entering the body during the absorptive state? A) used as fuel immediately by body cells B) stored as glycogen in the liver C) stored as glycogen in muscles D) converted to triglycerides and stored in fat cells E) converted into the hard extracellular matrix of bone


NAME: STUDENT I.D.#


58. Triglycerides enter the blood circulatlion as A) chylomicrons. B) micelles. C) lipid rafts. D) globules. E) lipoproteins.

59. Which of the following is NOT TRUlE of the absorptive period? A) Glucose absorption from the gut is high. B) Glucose utilization by cells is high. C) Fat utilization by cells is high. D) Synthesis oftriglycerides is high. E) Breakdown of glycogen is low.

60. Where are most glucose transporter proteins ("GLUTs") located when levels of the hormone insulin are LOW? A) inserted into the plasma membrane B) in the membranes of intracellular vesicles-C) inserted into the nuclear membrane D) in the endoplasmic reticulum E) in the liver-They are transported to other cells when glucose levels rise.

61. The most common measurement of energy in biological systems is the kilocalorie. This is the amount of energy that would be required to raise the temperature of what quantity of water one degree Celsius? A) 0.1 g B) 1 g C) 10 g D) 1.000 g E) 10.000 g

62. The energy expenditure of a mammal at rest, in the postabsorptive state, and at a standard temperature is referred to as its A) basal metabolic rate. B) nonstandardized metabolic rate. C) baseline metabolic rate. D) activated metabolic rate. E) total metabolic rate.


NAME: STUDENT I.D.#


63. Which of the following animals would you predict would have the highest mass-specific metabolic rate? A) a lizard B) a squid C) an elephant D) a goose E) a hummingbird

64. Increases in leptin levels will __ appetite and __ metabolic rate. A) decrease, increase B) decrease, decrease C) increase, increase D) increase, decrease E) increase, not change

65. Most body heat in endotherms is derived from __ while most body heat in ectotherms is derived from

---'

A) metabolic processes, metabolic processes B) metabolic processes, their environment C) their environment, metabolic processes D) their environment, their environment E) fur, insulating scales

66. The best terms for a fish whose body temperature varied between 4°C during the day when it is in deep, cold ocean waters and 26°C duriRg the night when it comes to the surface to feed would be A) endothermic and homeothermic. B) endothermic and heterothermic/poikilothell'mic. C) ectothermic and homeothermic. D) ectothermic and heterothermic/poikilothennic. E) ectothermic and endothermic.

67. is the study of how behavi,our contributes to the differential survival and reproduction of organisms. A) Behaviour B) Behavioural Ecology C) Evolution D) Population Ecology E) Community Ecology

68. The immediate causes of behaviours, such as genetic and physiological mechanisms are caned ____ causes. A) proximate B) ultimate C) internal D) physiochemical E) internal and physiochemical


NAME: STUDENT I.D.#


69. Behaviours that appear to be genetically programmed are caned A) innate. B) ultimate. C) fIxed action pattern. D) voluntary. E) standard deliverance.

70. What tissues in an animal's body are the targets of genes for behaviour? A) axial skeleton B) forebrain and liver C) nervous system and musculature D) reproductive and urogenital E) innate and instinctual

71. An egg rolling out of its nest is a(n) ___ to a nesting goose. A) conditioned response B) reproductive habituation C) sign stimulus D) gene expression E) operant conditioning

72. Lions in east African safari parks learn to ignore the presence of safari vehicles. This form of learning is A) compensatory. B) operant. C) cognitive. D) sign stimulus. E) habituation.

73. Classical conditioning such as the salivatiing of Pavlov's dog in response to a metronome is based on a(n) A) operant condition. B) sign stimulus. C) involuntary response. D) dishabituation. E) None of the choices are correct.

74. Rats learning to press a lever to receive food is an example of A) avoidance. B) operant conditioning. C) habituation. D) inoperant conditioning. E) negative reinforcement.

BIOL IF90 Apri121,2011 of21

NAME: STUDENT I.D.#


75. What is the process through which maay animals develop irreversible species-specific behaviour patterns? A) altruism B) taxis C) operant conditioning D) cognitive learning E) imprinting


NAME: STUDENT I.D.#


PART B. Short Answer questions (3 marks each)

1. Dr. Bruce's telomeres are shorter than 97% ofthe students in Bio11F90. What does this say about him and why are his telomeres sborter?

2. The following piece of mRNA codes for what sequence of amino acids? Make sure you label the "C" terminus and the "N" terminus of your oligopeptide. You can find the genetic code on the last page of the exam.

5' UUGAUGCGGCCGGUUACGGGCGUUUAGCAAG 3'

BIOL 1F90 April :21,2011 of21

NAME: STUDENT I.D.#

Lab Date & Time: __________ _ Week A orB: _______ _

3. The error rate for transcription is about 100,000 times higher than the error rate for replication. Why can this high error rate be tolerated for RNA synthesis but not for DNA synthesis?

4. Why are aminoacyltransferases (the enzymes that put the amino acid onto tRNA molecules) important? What special features must these enzymes have to allow them to do their job?

BIOL lF90 April 21, 2011 of21

NAME: STUDENT 1.0.#


5. Fill in the missing traits in the following table:

Trait Marine Moss Fern Conifer Flowering Red I (Gymnosperms) Plant Algae - I (AngiosperlI!l

Chlorophylls a & b No Yes Yes Yes Yes

Vascular tissue No Yes Yes Yes

Seeds No No No Yes Yes

Flowers No No No Yes

Based on the table (above), and using red algae as the outgroup, which tree (below) is likely to be the best supported hypothesis for the evolution of plants? Tree# ___ _

How many evolutionary steps are required for the tree that you have selected? __ _

1.-00#1


NAME: STUDENT I.D.#


6. Calculate the p and q values for a population in which the genotype frequencies are:

2 AA 36 Aa 162 aa

7. The characteristics that a biologist uses to identify a species will depend, in large part, on the species in question. However, there are five commonly used characteristics. Provide three (3) of these:

(1)

(2)

(3)


NAME: STUDENT I.D.#


8. Fill in the following:

a. Gastrin b. Cck and secretin c. Gallbladder d. Bile e. Blood f. Bicarbonate ions and

enzymes g. Small intestines

contractions

Chyme enters

Final Question (1 mark): In ONE SENTENCE only, what is the most interesting thing you learned this year in BIOL 1F90?


NAME: __________________ _ STUDENT I.D.#

Lab Date & Time: _______ _ Week A orB: _________ _

UAU} =}Cys Ser

UAC 1Yr UM Stop Stop

UCG UAG Stop Trp

CCU CAU} CGU cec

Pro CAe Hs CGC

kg Leu CCA eM} CGA

I ;! CCG CAG Gin eGG a i AUU} ACU AAU}Asn AGU} I u: AGC Ser AUClIe ACC

Thr MC

AUA ACA AM} AM} AUG Met ACG AAG Lys AGG Arg

GUU GeU GAU} GGU QUC

Val GCe GAO Asp GGC

GUA GOA AJa GM} GGA

GUG GOG GAG Giu

BROCK UNIVERSITYexams.library.brocku.ca/download.php?md=Biology/BIOL 1F90...BROCK UNIVERSITY Final...

Documents

Transcript of BROCK UNIVERSITYexams.library.brocku.ca/download.php?md=Biology/BIOL 1F90...BROCK UNIVERSITY Final...