Bortezomib, Dexamethasone, and Fibroblast Growth Factor ... · regulation of p44/42...

Bortezomib, Dexamethasone, and Fibroblast Growth FactorReceptor 3^SpecificTyrosine Kinase Inhibitorin t(4;14) MyelomaGuido Bisping,1DorisWenning,1Martin Kropff,1Dirk Gustavus,1Carsten Mu« ller-Tidow,1

Matthias Stelljes,1Gerd Munzert,3 Frank Hilberg,4 GeraldJ. Roth,3 Martin Stefanic,3

SarahVolpert,2 Rolf M. Mesters,1Wolfgang E. Berdel,1andJoachim Kienast1

Abstract Purpose: Novel drugs including targeted approaches have changed treatment paradigms formultiple myeloma (MM) and may also have therapeutic potential in the poor-prognosis t(4;14)subset; t(4;14) results in overexpressed and activated fibroblast growth factor receptor 3(FGFR3). Blocking this receptor tyrosine kinase (RTK) induces apoptosis in t(4;14)+ MM cellsand decreases adhesion to bone marrow stromal cells (BMSC). Using combinations of noveldrugs, we investigated potential enhancement of single-agent activities within the tumor cells,targeting of the marrow micromilieu, or circumvention of drug resistance in t(4;14)+ MM.Experimental Design: We tested effects on apoptosis and related signaling pathways in thet(4;14)+ MM subset, applying drug combinations including a FGFR3 tyrosine kinase inhibitor(RTKI), the proteasome inhibitor bortezomib, and dexamethasone.Results: RTKI, bortezomib, and dexamethasone were active as single agents in t(4;14)+ MM.RTK inhibition triggered complementary proapoptotic pathways (e.g., decrease of Mcl-1, down-regulation of p44/42 mitogen-activated protein kinase, and activation of proapoptotic stress-activated protein/c-Jun NH2-terminal kinases). Synergistic or additive effects were found bycombinations of RTKI with dexamethasone or bortezomib. In selected cases of t(4;14)+ MM,triple combinations were superior to dual combinations tested. Prevention from MM cell apopto-sis by BMSC or exogenous interleukin-6 was circumvented by drug combinations. In t(4;14)+,N-ras ^ mutated NCI-H929 cells, resistance to RTKI was overcome by addition of dexametha-sone. Notably, the combination of RTKI and dexamethasone showed additive proapoptoticeffects in bortezomib-insensitive t(4;14)+ MM.Conclusions: Combining novel drugs in poor-prognosis t(4;14)+ MM should take into accountat least bortezomib sensitivity and probably Ras mutational status.

Recently, the introduction of novel agents, especially theproteasome inhibitor bortezomib (Velcade), thalidomide, andits structural analogue lenalidomide (Revlimid), has changedtreatment paradigms for newly diagnosed multiple myeloma(MM), for therapeutic approaches at the time of MM relapse,as well as for maintenance therapy after stem cell transplan-tation (1–11).

Novel combinations implementing targeted drugs are cur-rently under evaluation in clinical phase I to III trials or havealready proven to be highly effective for MM treatment (1, 5–7,9–12). Nonetheless, there is evidence that clinical outcome canstill be determined by cytogenetically defined risk factors. MMharboring a translocation (4;14) or (14;16) is characterized bypoor prognosis (13, 14).

The t(4;14) involves the partner region fibroblast growthfactor receptor 3 (FGFR3)/MMSET at 4p16.3 and is related tooverexpressed and constitutively activated FGFR3 (15). Weand others have shown anti-myeloma effects of selectivesmall compound receptor tyrosine kinase inhibitors (RTKI)selectively targeting FGFR3 in t(4;14)+ MM. Blocking thekinase domain of FGFR3 has been shown to reduceproliferation and induce apoptosis in t(4;14) myeloma cells,to decrease adhesion to bone marrow stromal cells (BMSC),and to abrogate secretion of interleukin-6 (IL-6) from BMSC(16, 17).

Here, we addressed rationales for the combination oftargeted drugs in poor-prognosis t(4;14)+ MM (18) with orwithout mutated Ras or primary bortezomib insensitivity. Thisapproach included the application of a selective RTKI

Cancer Therapy: Preclinical

Authors’Affiliations: 1Department of Medicine/Hematology and Oncology and2Institute of Human Genetics, University of Muenster, Muenster, Germany;3Boehringer Ingelheim Pharma GmbH & Co. KG, Biberach an der Riss, Germany;and 4Boehringer Ingelheim Austria GmbH,Vienna, AustriaReceived 7/4/08; revised 8/20/08; accepted 8/21/08.The costs of publication of this article were defrayed in part by the payment of pagecharges. This article must therefore be hereby marked advertisement in accordancewith 18 U.S.C. Section 1734 solely to indicate this fact.Note: G. Bisping and D.Wenning contributed equally to this work.D.Wenning contributed experiments to fulfill requirements for her M.D. thesis.Requests for reprints: Joachim Kienast, Department of Medicine/Hematologyand Oncology, University of Muenster, Albert-Schweitzer-Str. 33, D-48129Muenster, Germany. Phone: 49-251-83-5-28-01; Fax: 49-251-83-5-28-04;E-mail: [email protected].

F2009 American Association for Cancer Research.doi:10.1158/1078-0432.CCR-08-1612

www.aacrjournals.orgClin Cancer Res 2009;15(2) January15, 2009 520

Cancer Research. on January 22, 2021. © 2009 American Association forclincancerres.aacrjournals.org Downloaded from

http://clincancerres.aacrjournals.org/

interrupting angiogenic FGF and vascular endothelial growthfactor (VEGF) signaling in MM cells and the marrow micro-milieu on the one hand and the proteasome inhibitorbortezomib selectively targeting the MM tumor compartmenton the other hand, both supplemented by dexamethasone as aclassic anti-myeloma agent (16, 17, 19–23).

Materials and Methods

Patients. Bone marrow samples from patients with active MM werestudied. Patients gave written informed consent before the samplingprocedure. The bone marrow aspirate study protocol was approved bythe Institutional Review Board of the University of Muenster.

Reagents. A 0.2 mol/L stock solution of the investigational small-molecule inhibitor BIBF 1000 synthesized in a medicinal chemistryprogram was prepared as previously described (16). Dexamethasonewas purchased from Sigma-Aldrich. Bortezomib (Velcade) wasdelivered by Ortho Biotech (Division of Janssen Cilag, Neuss,Germany). Recombinant human IL-6 was obtained from R&DSystems. Annexin V-FITC and propidium iodide (PI) were purchasedfrom BD Biosciences/Clontech, anti-CD38-phycoerythrin/cyanin5from Coulter-Immunotech, and anti-CD138-FITC from Serotec.CD138-labeled magnetic beads came from Miltenyi Biotec. Rabbitpolyclonal antibodies raised against phospho-mitogen-activated pro-tein kinase (MAPK; p44/42), phospho-stress-activated protein kinase/c-Jun NH2-terminal kinase (SAPK/JNK; Thr183/Tyr185), caspase-3,caspase-8, caspase-9 and poly(ADP-ribose) polymerase (PARP) aswell as the corresponding goat anti-rabbit or goat anti-mousehorseradish peroxidase – conjugated secondary antibodies wereobtained from Cell Signaling Technology. Mcl-1 antibody waspurchased from Santa Cruz Biotechnology. Monoclonal anti-h-actin(clone AC-15) came from Sigma.

Magnetic bead labeling and sorting of patient myeloma cells. Bonemarrow mononuclear cells from patients with active MM wereseparated by density gradient centrifugation using BIOCOLL SeparationSolution (Biochrom). Myeloma cells were isolated by CD138+ magneticcell sorting using Midi columns (Miltenyi Biotec).

Cell cultures. The human myeloma-derived cell lines RPMI-8226,U-266, OPM-2, NCI-H929, L-363, and LP-1 were obtained from theGerman Collection of Microorganisms and Cell Cultures. The KMS-11cell line was kindly provided by Takemi Otsuki (Kawasaki MedicalSchool, Okayama, Japan) and UTMC-2 by Leif Bergsagel (Mayo Clinic,Scottsdale, AZ). Cell lines and CD38high/CD138+-sorted marrowmyeloma cells from patients were cultured in RPMI 1640 (LifeTechnologies).

Cultures of BMSCs from MM patients were established from themononuclear cell fraction of marrow aspirates according to the methoddescribed previously (19) and maintained in MEM-a medium (LifeTechnologies). Contact MM-BMSC cocultures were established bydirectly seeding myeloma cells (2 � 105/mL) onto confluent BMSCs.

All culture media were supplemented with 10% FCS (Invitrogen),100 units/mL penicillin, 100 Ag/mL streptomycin, and 2 mmol/LL-glutamine (PAA). For stimulation or inhibition experiments, cellswere cultured in serum-free RPMI 1640. Cultures were maintained at37jC and 5% CO2.

RNA preparation and cDNA synthesis. Total RNA was extracted withthe QIAamp RNA Blood Mini kit (Qiagen) according to themanufacturer’s protocol. cDNA was synthesized for 1 h at 37jC using1 Ag total RNA, 40 units/AL RNA guard (Amersham Pharmacia), 100pmol/AL random hexamers (Amersham Pharmacia), 200 units Molo-ney murine leukemia virus reverse transcriptase (Life Technologies), 5�first-strand buffer (250 mmol/L Tris-HCl, 375 mmol/L KCl, 15 mmol/LMgCl2, 0.1 mol/L DTT), 80 mmol/L deoxynucleotide triphosphates(Amersham Pharmacia), and 1 Ag/mL bovine serum albumin (Serva).

Analysis of N-ras and K-ras mutations. The cDNA from myelomacells enriched by CD138+ magnetic bead cell sorting was amplified byPCR with primers spanning the mutation hotspots of codons 12, 13, and61. The following primers were used: N-ras, TTTCCCGGTCTGTGGT-CCTAAAT (forward) and CTTCGCCTGTCCTCATGTATTGG (reverse);K-ras, CGGCTCGGCCAGTACTCC (forward) and TCTTGCTAAGTCCT-GAGCCTGTTT (reverse). PCR products were verified by agarose gelelectrophoresis and purified. Direct cycle sequencing was done for bothstrands using the same primers as for PCR.

Quantitative Mcl-1 reverse transcription-PCR analysis. QuantitativePCR analysis of Mcl-1 RNA levels was done with the ABI Prism 7700sequence detector (Perkin-Elmer). To amplify Mcl-1 cDNA, thefollowing primer sequences were used: forward, 5¶-GGTGGCATCAG-GAATGT-3¶; reverse, 5¶-ATCAATGGGGAGCAGT-3¶ (primer design byPrimer Express 2.0, blasted by BlastN5). SYBR Green (AppliedBiosystems) was used as probe. 18S RNA served as housekeeping gene(PCR kit by Applied Biosystems). The ratio of Mcl-1 to 18S RNA wascalculated from the samples studied.

Fluorescence in situ hydridization analysis. Fluorescence in situhydridization was used to examine the samples for deletions of thechromosome region 13q14.3 or monosomy 13 as well as forrearrangements of the IgH gene locus. Fluorescence in situ hydridizationwas done according to the manufacturer’s instructions using commer-cially available probes. All probes were purchased from Abbott. Thefollowing probes have been used: LSI D13S319 (13q14.3) Spectru-mOrange TM Probe, LSI 13q34 SpectrumGreen TM Probe, LSI IGHDual Color Break Apart Rearrangement Probe, and LSI IGH/FGFR3Dual Color Dual Fusion Translocation Probe.

Quantification of apoptotic cells. Using 24-well culture plates, 2 �105 myeloma cells/mL were exposed to the novel indolinone BIBF 1000(25-1,000 nmol/L), dexamethasone (0.5-10.0 Amol/L), and bortezo-mib (0.1-4.0 nmol/L), either alone or in combinations in the presenceor absence of IL-6 (10 ng/mL) for 24 to 48 h.

Subsequently, cells were collected, pelleted, and resuspended inAnnexin binding buffer containing 10 nmol/L HEPES/NaOH,140 mmol/L NaCl, and 2.5 mmol/L CaCl2 (pH 7.4) and stained withFITC-conjugated Annexin V and PI. The quantification of apoptotic

5 http://www.ncbi.nlm.nih.gov/BLAST/

Translational RelevanceThe success of novel therapeutic approaches in multiple

myeloma (MM) suggests that treatment strategies will betested, which comprise combinations of bortezomib andother targeted drugs. With focus on the poor-prognosist(4;14)+ MM subgroup (over)expressing fibroblast growthfactor receptor 3 (FGFR3), we tested effects combiningbortezomib and a FGFR3-specific tyrosine kinase inhibitor(RTKI) supplemented by dexamethasone. Synergistic oradditive proapoptotic effects were found by combinationsof RTKI with dexamethasone or bortezomib activatingcomplementary proapoptotic pathways and thereby over-coming microenvironmental mediated drug resistance. Wefound that combining novel drugs in poor-prognosist(4;14)+ MM needs to take into account Ras mutationalstatus and bortezomib sensitivity. Ras-mediated drugresistance seems to be overcome by dexamethasone,whereas bortezomib insensitivity might be circumventedby combination of RTKI and dexamethasone. Here, weprovide rationales for the use of novel drug combinationswith respect to the poor-prognosis t(4;14)+ MM subgroupthat need to be validated in clinical trials.

TargetedTherapies in Poor-Prognosis t(4;14)Myeloma

www.aacrjournals.org Clin Cancer Res 2009;15(2) January15, 2009521



cells was done by flow cytometry using a Becton DickinsonFACSCalibur (BD Biosciences). CellQuest Pro software (BD Bioscien-ces) was applied for flow cytometric analyses. Data are presented as dotplots of at least 10,000 counted events per sample. All experiments weredone under serum-free conditions.

Determination of additive or synergistic proapoptotic effects of drug

combinations. To determine additive or synergistic proapoptotic effectswhen BIBF 1000 was combined with dexamethasone or bortezomib,OPM-2, NCI-H929, or U-266 cells were exposed to increasingconcentrations of BIBF 1000 (25-1,000 nmol/L) and dexamethasone

Fig. 1. Proapoptotic effects of drugcombinations in t(4;14)+ myeloma cells.A, in t(4;14)+ OPM-2 myeloma cells,apoptosis was induced by either BIBF 1000(500 nmol/L) or dexamethasone (Dex ;10 Amol/L) and was significantly enhancedby their combination (P < 0.01; blackcolumns). IL-6 (10 ng/mL; white columns)caused abrogation of dexamethasone-induced apoptosis, whereas induction ofapoptosis by BIBF 1000 was only partiallyreverted. Of note, apoptosis induced bybortezomib (Velcade, 2 nmol/L) and any ofits combinations (black columns) was not orfar less sensitive to IL-6 (white columns).Columns, mean of at least three independentexperiments; bars, SE. OPM-2 cells werecultured in the presence of the respectivedrugs or their combinations for 48 h underserum-free conditions. B, top four panels,differential cleavage of caspase-8,caspase-9, caspase-3, and PARP inOPM-2 cells exposed to BIBF 1000,dexamethasone, bortezomib, or theircombinations, respectively.Whereas BIBF1000 ^ induced and dexamethasone-induced apoptosis used the caspase/PARPpathways, apoptosis of myeloma cells bybortezomib was independent of it and ratherweakened the activation of the caspase/PARP pathway in drug combinations despiteadditive proapoptotic effects. Bottom,corresponding probing of h-actin forvisualization of equal protein load.Representative immunoblots out of fiveexperiments are shown. Proteins wereextracted after 16 h of drug exposure.FL, full-length; CF, cleaved fragment.C, down-regulation of p44/42 MAPKphosphorylation was exclusive to BIBF1000and any of its combinations.This effect wasobserved after 20 min and sustained,though weakening, throughout a 24-hperiod of drug exposure. It was paralleled byphosphorylation of the proapoptoticSAPK/JNK. Representative immunoblotsout of five experiments are shown. Proteinswere extracted after 20 min or 24 h of drugexposure.





(0.5-10.0 Amol/L) on the one hand and BIBF 1000 and bortezomib(0.1-4.0 nmol/L) on the other. Subsequently, the cell fractionsundergoing apoptosis induced by the respective drug combinationswere quantified by flow cytometric testing of increasing or decreasingconcentrations, vice versa. Finally, data were depicted as isobologramplots (isoeffect curves for the same percentage of induced apoptosis;e.g., 50% apoptosis) as described by Tallarida (24). Apoptosis-inducingeffects obtained with different combinations of BIBF 1000 anddexamethasone or bortezomib were additionally evaluated accordingto the method of Chou and Talalay (25, 26). Interactions between thedouble combinations were assessed by a combination index (CI). CIwas defined as follows:

CIAþB ¼ ½ðDA=AþBÞ=DA� þ ½ðDB=AþBÞ=DB� þ ½�ðDA=AþB �DB=AþBÞ=DADB�

where CIA+B = CI for fixed apoptotic effect (F) for the combinationof substance A and substance B; DA/A+B = concentration of substanceA in the combination of substance A and B giving the effect F;DB/A+B = concentration of substance B in the combination of substanceA and B giving the effect F;DA = concentration of substance A alonegiving the effect F; DB = concentration of substance B alone giving theeffect F; and a = parameter set 0 when A and B are mutually exclusiveand 1 when A and B are mutually nonexclusive. The CI indicatessynergism for results below 0.8 and additivity for values between0.8 and 1.2. Subadditivity (a nonadditive effect) is given for valueshigher than 1.2 (25, 26).

Immunoblotting of signaling molecules, caspases, and PARP. Forcaspase cleavage assays, 1 � 106 myeloma cells/mL were subconfluentlycultured on six-well culture plates and exposed to BIBF 1000,dexamethasone, and bortezomib either alone or in combinations for12 to 24 h in accordance to the experimental setups of the assays forquantification of apoptosis by flow cytometry. Phospho-MAPK andphospho-SAPK/JNK immunoblots of OPM-2 cells were done after a4-h starvation period and subsequent exposure to BIBF 1000,dexamethasone, bortezomib, or their respective combinations for either20 min or 24 h.

Proteins were extracted using radioimmunoprecipitation assaybuffer [150 mmol/L NaCl, 1% NP40, 0.5% deoxycholate, 0.1% SDS,50 mmol/L Tris base (pH 8.0)] containing a protease inhibitor cocktail(Boehringer Mannheim) and the phosphatase inhibitors NaF(25 nmol/L; Sigma) and NaVO4 (2.5 nmol/L; Sigma). Proteins were

separated by SDS-PAGE and transferred onto polyvinylidene difluoridemembranes (Millipore) and subsequently blotted using 0.8 mA/cm2

current for 1.5 h. Membranes were blocked with 2% milk powder(Roth) and hybridized overnight at 4jC in the presence of therespective primary antibodies. Anti-rabbit IgG and anti-mouse IgGhorseradish peroxidase– linked antibody (Cell Signaling Technology)were used as secondary antibodies dependent on the source of the firstantibody. Finally, membranes were soaked in Luminol reagent (SantaCruz Biotechnology) and light emission was detected on high-performance chemiluminescence films (Amersham).

Statistics. Data other than immunoblotting results are presented asindividual data plots or as mean F SE. Statistical analyses were donewith Statistical Package for the Social Sciences package, version 14.0(SPSS). Statistical significance of overall differences between multiplegroups was analyzed by the Kruskal-Wallis one-way ANOVA. If the testwas significant, pairwise comparisons were done by the multiple-comparisons’ criterion. Differences between two independent groupswere analyzed by the Mann-Whitney rank sum test (27). A P value ofV0.05 was considered significant.

Results

Enhanced proapoptotic effects by drug combinations in t(4;14)+MM. As recently shown by our group and other investigators(16, 17, 28–30), targeted small molecules such as selectiveRTKIs are active in t(4;14) MM. Accordingly, we studiedwhether combinations of RTKIs with either bortezomib and/or dexamethasone are capable of additively or synergisticallyenhancing apoptosis in t(4;14) MM. In t(4;14)+ OPM-2 cells,overexpressing constitutively activated mutant FGFR3 (15), theselective RTKI BIBF 1000, dexamethasone, and bortezomibsignificantly induced apoptosis when used as single agents(Fig. 1A; Table 1). To a similar extent, the KMS-11 cell line,carrying translocations t(4;14) and t(14;16), was sensitive toinduction of apoptosis by BIBF 1000, dexamethasone, andbortezomib (Table 1). Another t(4;14)+ cell line tested, UTMC-2, overexpressing wild-type FGFR3 (15), was also susceptibleto BIBF 1000 and dexamethasone but largely resistant to

Table 1. Quantification of apoptosis induction in MM cell lines exposed to RTKI, dexamethasone, bortezomib,or their respective combinations

MM cellline

Chromosome 14 or16 translocations

FGFR3 Rasmutation

Apoptotic cells (%, mean F SE)

Control BIBF 1000 Dexamethasone Bortezomib

P1 P2 P3

OPM-2 t(4;14) + (K650E) — 11.6 F 1.4 38.0 F 2.2 <0.01 31.9 F 1.6 0.01 34.9 F 2.9 <0.01KMS-11 t(4;14), t(14;16) + (Y373C) — 11.4 F 1.4 26.6 F 4.2 <0.005 27.4 F 4.4 <0.01 32.4 F 6.2 <0.01UTMC-2 t(4;14) + (wt) — 27.7 F 2.6 38.6 F 3.4 <0.05 47.6 F 1.4 <0.005 29.9 F 4.0 n.s.NCI-H929 t(4;14) + (wt) + (N13) 14.9 F 2.3 17.3 F 2.5 n.s. 24.0 F 2.9 n.s. 41.0 F 2.4 <0.005LP-1 Complex; t(4;14) + (wt) — 12.8 F 1.0 12.4 F 1.5 n.s. 9.5 F 1.9 n.s. 19.6 F 5.5 n.s.L-363 — — + (N61) 8.8 F 1.8 9.4 F 1.3 n.s. 16.9 F 1.8 0.01 51.6 F 7.8 <0.005RPMI-8226 t(16;22) — + (K12) 17.0 F 1.7 16.7 F 2.4 n.s. 16.0 F 2.4 n.s. 61.3 F 6.4 <0.005U-266 — — — 17.6 F 3.8 17.5 F 3.7 n.s. 15.9 F 5.1 n.s. 55.4 F 2.4 <0.005

NOTE: Data represent at least five independent experiments for each MM cell line tested. Control DMSO vehicle control, BIBF 1000 (500 nmol/L);dexamethasone (10 Amol/L); bortezomib (2 nmol/L). P < 0.05 was considered significant (Mann-Whitney test). P1, BIBF 1000 versus control;P2, dexamethasone versus control; P3, bortezomib versus control; P4, BIBF 1000 + dexamethasone versus BIBF 1000; P5, BIBF 1000 +dexamethasone versus dexamethasone; P6, bortezomib + dexamethasone versus dexamethasone; P7, bortezomib + dexamethasone versusbortezomib;P8, bortezomib+BIBF1000versusBIBF1000;P9, bortezomib+BIBF1000versusbortezomib;P10, bortezomib+dexamethasone+BIBF 1000 versus BIBF 1000 + dexamethasone; P11, bortezomib + dexamethasone + BIBF 1000 versus bortezomib + dexamethasone; P12,bortezomib + dexamethasone + BIBF 1000 versus bortezomib + BIBF 1000.Abbreviation: n.s., not significant.





bortezomib (Table 1). As further shown in Table 1, in OPM-2and KMS-11 cells, the combinations of BIBF 1000 with eitherdexamethasone or bortezomib significantly augmented theproportion of apoptotic cells compared with the respectivesingle drugs alone. A triple combination of the aforementioneddrugs significantly enhanced apoptosis in KMS-11 cellscompared with the activities of dual-drug combinations butdid not prove to be consistently superior in the other t(4;14)cell lines tested. In UTMC-2 cells, apoptosis was significantlyenhanced by the combination of BIBF 1000 and dexametha-sone, whereas bortezomib was not active when given alone, nordid it add markedly to the activity of dual-drug combinations(Table 1).

In OPM-2 and KMS-11 cells, no significant increase inapoptosis was found when bortezomib was combined withdexamethasone in comparison with single-agent proapoptoticeffects of bortezomib (Fig. 1A; Table 1).Circumvention of antiapoptotic bone marrow microenviron-

mental survival signals by drug combinations in t(4;14)+MM. We also studied whether induction of apoptosis int(4;14)+ MM was reverted by exogenous IL-6, known topromote proliferation, to protect against apoptosis, and tomediate drug resistance in MM (31–34). Therefore, OPM-2 cellswere exposed to either BIBF 1000, dexamethasone, bortezomib,or the respective combinations in the presence of exogenousIL-6 (10 ng/mL). As depicted in Fig. 1A, proapoptotic effects ofBIBF 1000 and dexamethasone were partly reverted by IL-6,most pronounced for the combination of BIBF 1000 anddexamethasone, whereas bortezomib-induced apoptosis wasnot or only marginally altered by IL-6.

In addition, we applied selected drug combinations to acontact coculture system consisting of human BMSCs seeded atthe bottom of the culture dishes and OPM-2 cells directly grownon the adherent BMSCs. A significantly increased apoptosis ofOPM-2 cells was preserved under contact coculture conditionswhen OPM-2 cells were exposed either to the combination ofBIBF 1000 and bortezomib or to the triple combination of BIBF1000, dexamethasone, and bortezomib (Fig. 2). Of note, theaddition of neutralizing anti-IL-6 antibodies (3 Ag/mL) tocontact cocultures retrieved a significantly augmented propor-tion of apoptosis by the combination of BIBF 1000 anddexamethasone compared with the respective controls (Fig. 2).Activation of caspases and PARP by drug combinations in

t(4;14)+ MM. To further investigate proapoptotic pathways in

OPM-2 cells mediated by BIBF 1000, dexamethasone, andbortezomib or their respective combinations, immunoblotswere done delineating the activation of caspase-8, caspase-9,caspase-3, and PARP. In line with the data obtained fromquantification of apoptosis by flow cytometry, BIBF 1000 and

Table 1. Quantification of apoptosis induction in MM cell lines exposed to RTKI, dexamethasone, bortezomib,or their respective combinations (Cont’d)

Apoptotic cells (%, mean F SE)

BIBF1000 +dexamethasone

Bortezomib +dexamethasone

Bortezomib +BIBF 1000

Bortezomib + BIBF 1000 +dexamethasone

P4 P5 P6 P7 P8 P9 P10 P11 P12

83.9 F 5.3 <0.01 <0.01 40.1 F 6.2 n.s. n.s. 56.9 F 7.4 <0.05 <0.05 75.7 F 11.9 n.s <0.01 n.s.61.4 F 6.3 <0.005 <0.01 50.4 F 3.9 <0.01 n.s. 54.9 F 5.6 <0.005 <0.05 81.4 F 3.6 <0.01 <0.01 <0.0155.3 F 2.2 <0.005 <0.05 49.5 F 2.2 n.s. <0.01 35.6 F 4.4 n.s. <0.05 54.7 F 2.1 n.s. n.s. <0.0535.7 F 4.4 <0.05 <0.05 50.0 F 4.4 <0.005 n.s. 53.9 F 8.0 <0.005 n.s. 56.9 F 6.3 <0.005 n.s. n.s.11.0 F 2.6 n.s. n.s. 27.1 F 10.9 <0.05 n.s. 17.9 F 4.8 n.s. n.s. 28.6 F 9.2 <0.05 n.s. n.s.18.1 F 1.8 <0.005 n.s. 67.3 F 9.1 <0.005 n.s. 63.6 F 11.2 <0.005 n.s. 78.8 F 8.3 <0.005 n.s. n.s.17.3 F 2.6 n.s. n.s. 58.4 F 5.5 <0.005 n.s. 67.7 F 6.4 <0.005 n.s. 65.2 F 4.6 <0.005 n.s. n.s.20.5 F 6.2 n.s. n.s. 53.1 F 4.2 <0.005 n.s. 65.3 F 2.2 <0.005 <0.05 61.7 F 3.8 <0.05 n.s. n.s.

Fig. 2. Circumvention of antiapoptotic bone marrow microenvironmental survivalsignals by drug combinations in t(4;14) MM. In t(4;14)+ OPM-2 cells, apoptosis wasinduced by either BIBF 1000 (500 nmol/L) or selected combinations of the RTKI,dexamethasone (10 Amol/L), and/or bortezomib (2 nmol/L) using a contactcoculture setup with human BMSCs. A significantly increased apoptosis of OPM-2cells was preserved under contact coculture conditions when OPM-2 cells wereexposed either to the combination of BIBF 1000 and bortezomib or to the triplecombination of BIBF 1000, dexamethasone, and bortezomib (P < 0.05, comparedwith untreated contact coculture controls). Of note, the addition of neutralizinganti-IL-6 antibodies (3 Ag/mL) to contact cocultures significantly augmented theproportion of apoptosis induced by the combination of BIBF 1000 anddexamethasone compared with the respective control (P < 0.05). BMSCs (5 � 104)were seeded into 24-well culture dishes.When BMSCs had grown to confluency,they were cocultured with 2 � 105 myeloma cells. Experiments were done for24 h under serum-free conditions. Columns, mean of four independent experiments;bars, SE. *, P < 0.05.





dexamethasone used the caspase/PARP pathways with cleavageof the initiator caspase-8 and caspase-9 followed by activationof effector caspase-3 and terminal cleavage of PARP (Fig. 1B).Corresponding to the data illustrated in Fig. 1A, the highestdegree of caspase-3 and PARP activation in t(4;14) + OPM-2cells was observed in the presence of BIBF 1000 plusdexamethasone (Fig. 1B). However, apoptosis of myelomacells by bortezomib rather weakened activation of the caspase/PARP pathways in drug combinations despite additive proa-poptotic effects (Fig. 1B).Reverse regulation of phosphorylated MAPK and SAPK/JNK by

drug combinations. It has been previously shown that selectiveinhibition of tyrosine kinase sites of VEGF receptor (VEGFR)and FGF receptor by selective RTKIs decreases or abrogatesdownstream phosphorylation of MAPKs, signals that cruciallyaffect proliferation and survival of t(4;14) + MM (15, 16).

Consequently, we next studied effects on p44/42 MAPKphosphorylation patterns by combinations of BIBF 1000,dexamethasone, and bortezomib exposed to myeloma cells.As shown in Fig. 1C, down-regulation of p44/42 MAPK wasexclusive to BIBF 1000 and any of its combinations. This effectwas observed after 20 minutes and sustained, though weaken-ing, throughout a 24-hour period of drug exposure. It wasparalleled by phosphorylation of the proapoptotic SAPK/JNK(35), underscoring the specific molecular mode of action ofRTKIs interfering with constitutive FGFR3 signaling. As shownfor short-term exposure (20 minutes), phosphorylation ofMAPK was not altered by dexamethasone or bortezomib alone,whereas after 24 hours both agents slightly decreased MAPKphosphorylation, an effect that was most pronounced in thepresence of BIBF 1000 (Fig. 1C), thus reflecting its effects onapoptosis.Effects on Mcl-1 by drug combinations. Next, we studied the

modulation of antiapoptotic Mcl-1 on induction of apoptosisby targeted drugs in t(4;14)+ and t(4;14)- MM (36). Immuno-blots and quantitative PCR analyses on Mcl-1 expression weredone. As shown in Fig. 3A, Mcl-1 protein was decreased by BIBF1000 or dexamethasone either alone or, to a higher extent, bytheir combination. As expected, protein expression was notaltered in U-266 cells by exposure either to BIBF 1000,dexamethasone, or their combination (Fig. 3B). Coexposureto bortezomib and BIBF 1000 or BIBF 1000 plus dexametha-sone significantly enhanced Mcl-1 transcription (Fig. 3C). Aspreviously reported and shown here, the presence of bortezo-mib led to intracellular preservation of Mcl-1 protein (Fig. 3A;refs. 37, 38).Combination with dexamethasone overcomes ras-mediated

resistance to RTKI. N- and K-ras mutations occur in up to30% to 40% of MM and have been shown to correlate with anaggressive course of myeloma disease (39, 40). One of themechanisms recently described is induction of cyclooxygenase-2 and consecutively enhanced binding of myeloma cells toextracellular matrix proteins conferring resistance to conven-tional chemotherapy (41).

We found a significantly marked proportion of apoptosis int(4;14)+, N-ras–mutated NCI-H929 myeloma cells whendexamethasone was added to BIBF 1000 (Fig. 4A; Table 1).Of note, BIBF 1000 or dexamethasone alone did not induceapoptosis in NCI-H929 cells to a significant degree overcontrols (Fig. 4A; Table 1). A distinct cleavage of caspase-8,caspase-9, caspase-3, and PARP was correlated to induction ofapoptosis by RTKI and dexamethasone. In contrast, treatmentwith BIBF 1000 alone did not exhibit any cleavage of caspasesor PARP, whereas dexamethasone, however to a lesser extent,generated cleavage of caspase-8 and caspase-3. In this poor-prognosis MM subgroup, bortezomib also showed significantactivity (Table 1). Its dual combination with dexamethasonetended to be superior to single-agent proapoptotic effects.U-266 cells, known to be resistant to dexamethasone and usedas controls, did not show apoptosis or marked cleavage ofcaspases exposed to either BIBF 1000, dexamethasone, or theircombinations (Fig. 4B).Synergistic and additive proapoptotic effects by combination of

RTKI and dexamethasone or bortezomib in t(4;14)+ MM. Next,proapoptotic activities of targeted drug combinations weretested pairwise vice versa at defined subtherapeutic concen-trations according to the method described by Tallarida (24).

Fig. 3. Modulation of Mcl-1in myeloma cells by proapoptotic drugs. A,antiapoptotic Mcl-1protein expression in OPM-2 cells decreased on exposure toBIBF 1000 (500 nmol/L) or dexamethasone (10 Amol/L) either alone or incombination. As expected, exposure to bortezomib (2 nmol/L), either alone or incombination with the aforementioned drugs, resulted in intracellular preservation ofMcl-1protein. B, intracellular Mcl-1protein remained unaffected in U-266 cells. In Aand B, immunoblots after 6 h of drug exposure are shown that are representativeof at least three experiments. C, despite down-regulation of Mcl-1protein,counterregulatory increase of Mcl-1transcripts was evident in OPM-2 cells onexposure to either of the drugs but particularly on exposure to drug combinations.Ratios of Mcl-1over 18S RNA expression are shown as fold increase over theunstimulated controls (1.0). PCRs were done in duplicates. Points, mean of twoindependent experiments; bars, SE. *, P < 0.05; **, P = 0.001versus untreatedcontrol.





Fig. 4. The combination of BIBF1000 and dexamethasone overcomes ras-mediated resistance in t(4;14)+ myeloma cells. A, t(4;14)+, N-ras ^ mutated NCI-H929 cells wererelatively resistant to induction of apoptosis by BIBF1000 alone, whereas adding dexamethasone to BIBF1000 had significant additive proapoptotic effects (P < 0.005 versusuntreated control). Apoptosis induction by dexamethasone or dexamethasone/BIBF 1000 was associated with cleavage of caspase-8, caspase-9, caspase-3, and PARP.B, control experiments with U-266 cells, known to be dexamethasone resistant, showed no effects of BIBF 1000 or its combination with dexamethasone. C, induction ofapoptosis in dexamethasone-resistant, ras wild-type U-266 cells by targeted drug combinations. Apoptosis of U-266 cells increased significantly on exposure to bortezomib(P < 0.005). Although U-266 cells had been shown to be resistant to BIBF 1000 alone (see B), a further marginal but significant increase of apoptosis was observed whenU-266 cells were exposed to bortezomib plus BIBF 1000 (P < 0.05). The addition of BIBF 1000 was associated with activation of the caspase-8, caspase-9, caspase-3, andPARP pathways. Addition of dexamethasone had no effect and might even have weakened the effects of bortezomib plus/minus BIBF1000. However, these latter differenceswere not statistically significant.





Accordingly, MM cells were exposed to combinations of RTKIplus dexamethasone or RTKI plus bortezomib beginning fromsubtherapeutic concentrations of BIBF 1000 (range, 25-1,000nmol/L), dexamethasone (range, 0.1-10.0 Amol/L), or borte-zomib (range, 0.1-4.0 nmol/L) to map synergistic (supra-additive), additive, or subadditive (nonadditive) apoptoticeffects. Subsequently, isobologram curves showing isoeffectiveapoptosis were plotted for t(4;14)+ OPM-2 cells (Fig. 5A),t(4;14)+, N-ras–mutated NCI-H929 cells (Fig. 5B), or t(4;14)-,dexamethasone-resistant U-266 cells (Fig. 5C).

The combination of BIBF 1000 and dexamethasone gavesynergistic effects for OPM-2 (Fig. 5A) and N-ras–mutatedNCI-H929 cells (Fig. 5B), both being t(4;14)+. Additiveproapoptotic effects were shown in OPM-2 cells for thecombination of BIBF 1000 and bortezomib (Fig. 5A). Notably,no additive effects were found by the respective drugcombinations in U-266 cells (Fig. 5C).

These findings were confirmed by calculations of CIs forselected myeloma cell lines. CIs were calculated as described inMaterials and Methods (25, 26). Synergistic effects aboutinduced apoptosis (CI lower than 0.8) were validated for thedrug combination of BIBF 1000 and dexamethasone int(4;14)+ OPM-2 cells (CI at 50% = 0.41, CI at 75% = 0.21,CI at 90% = 0.12; Fig. 5A, .). Additive proapoptotic effects(CI between 0.8 and 1.2) were found in OPM-2 cells for thecombination of BIBF 1000 and bortezomib (CI at 50% = 1.17,CI at 75% = 0.87, CI at 90% was not achievable; Fig. 5A, 5).Likewise, synergistic effects (CI lower than 0.8) were shown int(4;14)+, N-ras–mutated NCI-H929 cells for the combinationof BIBF 1000 and dexamethasone (CI at 20% effect = 0.36, CIat 25% = 0.13, CI at 50%, 75%, and 90% not achievable;Fig. 5B, .). However, the combination of BIBF 1000 andbortezomib had a subadditive effect in Ras-mutated NCI-H929cells (calculated CI above 1.2; CI at 10% effect calculated 1.67,CI at 25% calculated 2.3, CI at 40% calculated 2.6, CI at 75%and 90% effect not achievable; Fig. 5B, 5). For U-266 cells,none of the combinations showed additivity or synergismabout drug-induced apoptosis (CI at 3.0; see Fig. 5C, . and 5).

In case of poor-prognosis MM, which in addition to a t(4;14)show a complex karyotype as shown for the LP-1 cell line, noneof the single agents tested revealed a proapoptotic activity.Nevertheless, the triple combination of RTKI, bortezomib, anddexamethasone significantly augmented the proportion ofapoptotic cells (Table 1).Enhanced apoptosis in dexamethasone-resistant, ras wild-type

MM by combination of bortezomib and RTKI. Ras wild-type andt(4;14)- U-266 cells, which showed primary resistance to BIBF1000, dexamethasone, or the combination of BIBF 1000 plusdexamethasone (Fig. 4B), were sensitive to bortezomib-inducedapoptosis (Fig. 4C; Table 1). Unexpectedly, apoptosis wassignificantly increased in U-266 cells when bortezomib wascombined with the RTKI BIBF 1000 but not when combinedwith dexamethasone (Fig. 4C; Table 1). Corresponding to thesefindings, cleavage of caspase-8, caspase-9, caspase-3, and PARPoccurred when BIBF 1000 was added to bortezomib (Fig. 4C).However, additive or synergistic proapoptotic effects could notbe shown in U-266 cells when exposed to subtherapeutic doselevels of bortezomib and BIBF 1000 (Fig. 5C).

In contrast and as expected, proapoptotic enhancement bybortezomib combinations as described above did not occur inK -ras – mutated and dexamethasone-resistant RPMI-8226.

However, RPMI-8226 were also apparently sensitive to borte-zomib-induced apoptosis (Table 1), but based on thisbortezomib backbone, neither dual (bortezomib plus dexa-methasone or RTKI) nor triple combinations (bortezomib plusdexamethasone and RTKI) could significantly increase proa-poptotic activity.

Another N-ras–mutated, t(4;14)-, and t(14;16)- L363 cellline exerted only weak proapoptotic effects to single-agentdexamethasone. In L363, significant sensitivity to single-agentbortezomib occurred comparable with RPMI-8226 (Table 1).Apoptosis was marginally increased by exposure to the triplecombination consisting of bortezomib, RTKI, and dexametha-sone. However, the triple combination was not statisticallysuperior to bortezomib alone (Table 1).Increased apoptosis by targeted drug combinations in CD138+

marrow myeloma cells of patients with poor-prognosis MM. Asshown in Table 2, apoptosis in CD138+ sorted marrow myelomacells derived from patients carrying a t(4;14) (patients 1-3) wasinduced to variable degrees by exposure to the FGFR3-selective,VEGFR1-selective, VEGFR2-selective, and platelet-derivedgrowth factor receptor a–selective RTKI BIBF 1000. Apoptosiswas consistently enhanced by the combination of BIBF 1000and dexamethasone (Table 2). Patient 1 showed a markedproportion of apoptotic CD138+ cells by exposure to bortezo-mib. Here, apoptosis was slightly increased by dual and triplecombinations containing bortezomib plus RTKI or dexameth-asone (Table 2). In contrast, two of three patients with t(4;14)+MM (patients 2 and 3; Table 2; Fig. 6) showed primary relativeinsensitivity to bortezomib. Here, a dual combination with RTKIand dexamethasone showed enhanced proapoptotic effectscompared with the respective drugs alone. These observationsobtained in CD138+ marrow myeloma cells from patientsharboring a t(4;14) (patients 2 and 3) can be exactly correlatedto the findings in the bortezomib-insensitive UTMC-2 MM cellline (Table 1). In case of patient 2, addition of bortezomib wasable to further increase the proportion of apoptosis when thecells were exposed to the combination of RTKI and dexameth-asone. Data obtained in myeloma cells of patient 3 fromsubtherapeutic drug titrations of BIBF 1000 and dexamethasoneor BIBF 1000 and bortezomib further indicate such an additivemechanism of action by these combinations (data not shown).

In line with the data obtained from N-ras–mutated NCI-H929 and N-ras–mutated L-363 cells, we found similar pro-apoptotic effects by the combination of dexamethasone andBIBF 1000 or bortezomib in a patient with complex chromo-somal aberrations and additional Ras mutation (patient 4;Table 2).

A series of CD138+ marrow myeloma cells obtained frompatients with or without deletion 13 were predominantlysensitive to bortezomib-induced apoptosis. Addition of dexa-methasone led to enhanced apoptosis, although to a variabledegree (patients 5-7; Table 2). As shown for the respective celllines above, addition of RTKI to such a dual combinationsurprisingly tended to augment apoptosis induction in patients6 and 7 who did not carry a t(4;14).

Discussion

From previous reports, several lines of evidence suggest arationale for combining different targeted drugs and addingdexamethasone in poor-prognosis t(4;14)+ MM.





Translocations of the IgH locus leading to dysregulation ofthe oncogenic partner regions FGFR3/MMSET at 4p16.3 arepresent in t(4;14)+ MM and are associated with poor prognosis(13, 15, 18).

Preclinical and clinical studies have been launched targetingFGFR3 by RTKIs, such as CHIR-258, PD173074, PKC412, andSU5402, or by the anti-FGFR3 antibody PRO 001 in thet(4;14)+ MM subgroup (17, 28–30, 42). We have previouslyshown proapoptotic effects of BIBF 1000, a novel selectiveRTKI, in t(4;14)+ MM (16). Furthermore, enhanced proapop-totic effects in t(4;14)+ MM by the combination of RTKIs anddexamethasone have recently been reported by our group andothers (16, 17, 43).

Very remarkable anti-myeloma activity has also been shownfor the proteasome inhibitor bortezomib, targeting the ubiquitin-

proteasome pathway as well as the marrow microenvironmenteither alone or combined with other anti-myeloma agents (21,22, 44–49).

In addition, dexamethasone is widely used as a partner fornovel targeted strategies. Induction of apoptosis by dexameth-asone leads to consecutive down-regulation of MAPKs andp70S6K (23). Its effects can be reverted by IL-6 that seems to beinvolved in the development of secondary dexamethasoneresistance (23, 31). Conversely, it has been shown thatbortezomib either alone or in combination can overcomedexamethasone resistance by abrogation of IL-6 signaling (45).

In our present series of t(4;14)+ MM cell lines and CD138+

isolated marrow myeloma cells from t(4;14)+ MM patients, asignificantly increased induction of apoptosis was consistentlyfound for the combinations of RTKI (BIBF 1000) with

Fig. 5. Isobolograms and Fa/CI plots for OPM-2, NCI-H929, and U-266 cells indicating synergistic (supra-additive), additive, or subadditive effects of either dexamethasoneor bortezomib combined with BIBF 1000. Titrations of subtherapeutic concentration ranges of BIBF 1000 (25-1,000 nmol/L), dexamethasone (0.1-10.0 Amol/L), andbortezomib (0.1-4.0 nmol/L) in t(4;14)+ OPM-2 cells (A), t(4;14)+, N-ras ^ mutated NCI-H929 cells (B), or t(4;14)-, dexamethasone-resistant U-266 cells (C). The CIs andthe fraction affected by apoptosis (Fa) were calculated and isobolograms were plotted as described in Materials and Methods. A, plotted isoeffective data pairs indicatesynergistic proapoptotic effects in OPM-2 cells by combinations of BIBF 1000 and dexamethasone and additive effects by combinations of BIBF 1000 and bortezomib.Synergistic effects (CI lower than 0.8) were observed in t(4;14)+ OPM-2 cells for combinations of BIBF 1000 with dexamethasone and additive effects (CI between 0.8 and1.2) for combinations of BIBF 1000 with bortezomib. B, to a similar extent as in Fig. 4A, synergistic proapoptotic effects were evident in N-ras ^ mutated NCI-H929 cellsfor combinations of BIBF 1000 and dexamethasone, whereas BIBF 1000 in combination with bortezomib had no additive effects. Synergism (CI lower than 0.8) inN-ras ^ mutated NCI-H929 cells was reached by the combination of BIBF 1000 with dexamethasone and subadditive effects (CI above 1.2) were found for combinations ofBIBF 1000 with bortezomib. C, notably, no additive effects were found in t(4;14)-, dexamethasone-resistant U-266 cells for the respective drug combinations. Data werederived from a series of three independent experiments for each cell line, including 36 drug dose level pairs. Representative plots are shown.





dexamethasone or bortezomib. We used concentrations ofthe novel RTKI BIBF 1000 (25-1,000 nmol/L) that werepharmacodynamically comparable with effects reached in vivoin mice and rats administrating 25 to 100 mg/kg orally daily,which were shown to be safe and well tolerable.6 Forbortezomib, concentrations from 0.1 to 4.0 nmol/L were appliedto cell cultures reflecting drug effects achievable in vivo (e.g., byadministration of V0.5 mg/kg bortezomib in mice; ref. 50).

The effects of such combinations were synergistic or additive[RTKI and dexamethasone: synergistic in OPM-2 and NCI-H929, additive in t(4;14)+ CD138+ MM cells; RTKI andbortezomib: additive in OPM-2 and t(4;14)+ CD138+ MMcells]. These results would support the administration of dual-drug (or even triple drug) combinations involving a selectiveRTKI in t(4;14)+ MM. As shown for OPM-2 cells, dexameth-asone-induced apoptosis was almost completely reversed byIL-6, whereas IL-6 had only marginal effects in the presence ofBIBF 1000 or bortezomib. These findings not only strengthenthe rationale for combining dexamethasone with either of thesesubstances but also corroborate data from previous reportsindicating that bortezomib as well as BIBF 1000 abrogateparacrine IL-6 signaling (16, 45). Furthermore, there is strongevidence from our contact coculture data of MM cells andBMSCs that circumvention of survival signals from themicroenvironment can be achieved by combinations of theabove targeted drugs (32).

In line with the findings on the cellular level, our data ondrug-mediated signaling support the rationale of such drugcombinations. We found, in line with other reports, thatdexamethasone induced apoptosis via caspase-9. In turn, theextrinsic caspase-8 pathway was preferentially activated by theRTKI BIBF 1000, whereas bortezomib used both caspase-8 andcaspase-9 routes (45, 47). These findings would also explainovercoming of dexamethasone or RTKI resistance by combina-tions including bortezomib. In addition, constitutive MAPKphosphorylation in t(4;14)+ MM was not significantly alteredby dexamethasone or bortezomib, at least after short-time

exposure. In contrast, MAPK was markedly down-regulatedwhen exposed to RTKI. These findings suggest that RTKinhibition is essential in disrupting MAPK proliferation andsurvival signals in t(4;14)+ MM. Further substantiating theseobservations, up-regulation of proapoptotic JNK/SAPK phos-phorylation occurred in the presence of RTKI, whereas it wasrather independent of dexamethasone or bortezomib treatment(23). Down-regulation of antiapoptotic Mcl-1 protein was alsoobserved in the presence of RTKI, whereas Mcl-1 was preservedunder exposure to bortezomib in t(4;14)+ MM (36–38). Takentogether, the data clearly favor the implementation of selectivetargeting of FGFR3 into combinations with dexamethasone orbortezomib for treatment of t(4;14)+ MM (3).

Another major concern, recently studied by Hoang andcoworkers (41), is that Ras mutations have been associated withenhanced adhesion to fibronectin and chemoresistancethrough the induction of cyclooxygenase-2. We could showthat resistance to RTKI (BIBF 1000) in t(4;14)+ NCI-H929 cellsthat may be due to mutated Ras can be overcome by theaddition of dexamethasone (40). Of note, bortezomib alonewas markedly active in this t(4;14)+ MM subgroup. Thus, itseems to be important that t(4;14)+ MM with mutated Ras betreated with bortezomib or in combination with dexametha-sone when RTKIs are to be used. However, isogenic myelomacell lines with and without mutated Ras, as these exist for thecolorectal HCT116 cell line, are not available to explicitlyattribute these observed in vitro effects to Ras mutational status.

In case of bortezomib-insensitive t(4;14)+ MM, we alsofound additive effects for the combination of RTKI anddexamethasone. Finally, in dexamethasone- and RTKI-insensi-tive t(4;14)- MM harboring Ras wild-type, a significant,although limited, increase of apoptosis occurred by theaddition of RTKI to bortezomib, although the FGFR3 target ofthe kinase inhibitor was absent. This effect was associated withadditional activation of caspases and PARP and could bemeaningful, although additive mechanisms were not confirmedby subtherapeutic dose titrations (44, 46, 47).

In summary, from our data, potential treatment perspectivescan be derived for t(4;14)+ MM with or without Rasmutations and for selected t(4;14)+ MM that show primary

Table 2. Quantification of apoptosis induction in CD138+ sorted marrow myeloma cells obtained from MMpatients exposed to RTKI, dexamethasone, bortezomib, or their respective combinations

Characteristics Patient 1 Patient 2 Patient 3 Patient 4 Patient 5 Patient 6 Patient 7

MM patientsKaryotypic

abnormalitiest(4;14), del(13) t(4;14), del(13) t(4;14), del(13) Complex

hyperdiploidNone del(13),

del(14)del(13)

FGFR3 + + + - - - -N-ras/K-ras mutation - - ND + ND ND ND

MM patients (apoptotic cells, %)Control 12.6 10.2 24.9 35.1 15.6 18.4 22.7BIBF 1000 26.2 21.3 28.3 38.9 14.3 14.1 15.5Dex 15.5 23.7 24.1 58.3 11.3 23.4 29.0Bzb 78.4 17.9 15.7 41.4 39.8 59.8 65.1BIBF 1000 + Dex 30.4 36.5 49.0 68.9 18.8 28.9 27.2Bzb + Dex 86.9 37.4 22.6 72.8 53.3 77.5 69.8Bzb + BIBF 1000 88.4 21.7 38.4 57.4 34.5 69.8 72.4Bzb + BIBF 1000 + Dex 90.4 48.6 49.0 74.7 39.1 85.0 79.9

Abbreviations: ND, not determined due to limitations of the number of cells that have been isolated; Dex, dexamethasone; Bzb, bortezomib.

6 Unpublished data.





insensitivity to bortezomib as well as for dexamethasone-resistant MM with or without t(4;14). It can be inferred thatdirect proapoptotic effects on t(4;14)+ MM cells as well asspecific multitargeting of myeloma-marrow stromal cellinteractions can be significantly enhanced by combinationsof the novel drugs studied. Furthermore, Ras-mediated drugresistance might potentially be overcome by addition ofdexamethasone, whereas bortezomib insensitivity could becircumvented by the combination of RTKI and dexamethasonein t(4;14)+ MM. Our in vitro data provide the rationale for theuse of targeted drug combinations with respect to the t(4;14)+

MM subgroup and, in turn, warrant validation in t(4;14)+subgroups in clinical trials (1–3).

Disclosure of Potential Conflicts of Interest

J. Kienast: commercial research grant for myeloma research. Boehringer IngelheimAustria GmbH, Vienna, Austria.

Acknowledgments

We thankTakemi Otsuki for kindly providing the KMS-11myeloma cell line, LeifBergsagel for supplying the UTMC-2 line, and Christina Burhoi for excellent techni-cal assistance.

Fig. 6. Additive effects of BIBF 1000, dexamethasone, and bortezomib in t(4;14)+ cells isolated from the marrow of myeloma patients. Apoptosis was quantitated by flowcytometry in CD138+ sorted cells from the marrow of a patient with t(4;14)+ myeloma (compare patient 3 inTable 2). Early (AnnexinV+/PI-) and late (AnnexinV+/PI+)apoptosis by BIBF 1000 (500 nmol/L), dexamethasone (10 Amol/L), bortezomib (2 nmol/L), and their combinations are depicted in rows 1and 2.

References1. HideshimaT, Chauhan D, Richardson P, Anderson KC.

Identification and validation of novel therapeutic tar-gets for multiple myeloma [review]. J Clin Oncol2005;23:6345 ^ 50.

2. Bruno B, Giaccone L, Rotta M, Anderson K,Boccadoro M. Novel targeted drugs for the treatmentof multiple myeloma: from bench to bedside [review].Leukemia 2005;19:1729 ^ 38.

3. Fonseca R, Stewart AK. Targeted therapeutics formultiple myeloma: the arrival of a risk-stratifiedapproach. Mol CancerTher 2007;6:802^ 10.

4. Palumbo A, Falco P, Corradini P, et al. GIMEMALItalian Multiple Myeloma Network. Melphalan, predni-sone, and lenalidomide treatment for newly diagnosedmyeloma: a report from the GIMEMALItalian MultipleMyeloma Network. J Clin Oncol 2007;25:4459 ^65.

5. PalumboA, Bringhen S, CaravitaT, et al. Italian Multi-

ple Myeloma Network, GIMEMA. Oral melphalan andprednisone chemotherapy plus thalidomide comparedwith melphalan and prednisone alone in elderlypatients with multiple myeloma: randomised con-trolled trial. Lancet 2006;367:825^ 31.

6. Facon T, Mary JY, Hulin C, et al. Intergroupe Fran-cophone du Mye¤ lome. Melphalan and prednisoneplus thalidomide versus melphalan and prednisonealone or reduced-intensity autologous stem celltransplantation in elderly patients with multiple mye-loma (IFM 99-06): a randomised trial. Lancet 2007;370:1209 ^ 18.

7. Mateos MV, Herna¤ ndez JM, Herna¤ ndez MT, et al.Bortezomib plus melphalan and prednisone in elderlyuntreated patients with multiple myeloma: results ofa multicenter phase 1/2 study. Blood 2006;108:2165 ^ 72.

8. Kumar SK, Rajkumar SV, Dispenzieri A, et al. Im-proved survival in multiple myeloma and the impactof novel therapies. Blood 2008;111:2516 ^ 20.

9. Richardson PG, Mitsiades C, Schlossman R, MunshiN, Anderson K. New drugs for myeloma [review].Oncologist 2007;12:664 ^ 89.

10. Kropff M, Bisping G, Schuck E, et al. DeutscheStudiengruppe Multiples Myelom. Bortezomib incombination with intermediate-dose dexamethasoneand continuous low-dose oral cyclophosphamide forrelapsed multiple myeloma. Br J Haematol 2007;138:330 ^ 7.

11. Kropff MH, Lang N, Bisping G, et al. Hyperfractio-nated cyclophosphamide in combination with pulseddexamethasone and thalidomide (HyperCDT) in pri-mary refractory or relapsed multiple myeloma. Br JHaematol 2003;122:607 ^ 16.





12. Catley L,TaiYT, Chauhan D, Anderson KC. Perspec-tives for combination therapy to overcome drug-resistant multiple myeloma [review]. Drug ResistUpdat 2005;8:205 ^ 18.

13. Bergsagel PL, Kuehl WM. Critical roles for immuno-globulin translocations and cyclin D dysregulation inmultiple myeloma [review]. Immunol Rev 2003;194:96 ^104.

14. Avet-Loiseau H, Facon T, Grosbois B, et al. Inter-groupe Francophone du Myelome. Oncogenesis ofmultiple myeloma: 14q32 and 13q chromosomal ab-normalities are not randomly distributed, but correlatewith natural history, immunological features, and clini-cal presentation. Blood 2002;99:2185 ^ 91.

15. Chesi M, Brents LA, Ely SA, et al. Activated fibro-blast growth factor receptor 3 is an oncogene thatcontributes to tumor progression in multiple myeloma.Blood 2001;97:729 ^ 36.

16. Bisping G, Kropff M,Wenning D, et al. Targeting re-ceptor kinases by a novel indolinone derivative inmultiple myeloma: abrogation of stroma-derivedinterleukin-6 secretion and induction of apoptosis incytogenetically defined subgroups. Blood 2006;107:2079 ^ 89.

17.Trudel S, Li ZH,Wei E, et al. CHIR-258, a novel, multi-targeted tyrosine kinase inhibitor for the potentialtreatment of t(4;14) multiple myeloma. Blood 2005;105:2941 ^ 8.

18. JaksicW,Trudel S, Chang H, et al. Clinical outcomesin t(4;14) multiple myeloma: a chemotherapy-sensitivedisease characterized by rapid relapse and alkylatingagent resistance. J Clin Oncol 2005;23:7069 ^ 73.

19. Bisping G, Leo R, Wenning D, et al. Paracrineinteractions of basic fibroblast growth factor and in-terleukin-6 in multiple myeloma. Blood 2003;101:2775 ^ 83.

20. Dankbar B, PadroT, Leo R, et al.Vascular endothelialgrowth factor and interleukin-6 in paracrine tumor-stromal cell interactions in multiple myeloma. Blood2000;95:2630 ^ 6.

21. Altun M, Galardy PJ, Shringarpure R, et al. Effects ofPS-341 on the activity and composition of protea-somes in multiple myeloma cells. Cancer Res 2005;65:7896 ^ 901.

22. Orlowski RZ, Kuhn DJ. Proteasome inhibitors incancer therapy: lessons from the first decade. ClinCancer Res 2008;14:1649 ^ 57.

23. Chauhan D, Pandey P, Ogata A, et al. Dexametha-sone induces apoptosis of multiple myeloma cells in aJNK/SAP kinase independent mechanism. Oncogene1997;15:837^ 43.

24.Tallarida RJ. Drug Synergism: its detection andappli-cations. JPharmacol ExpTher 2001;298:865 ^ 72.

25. Chou TC, Talalay P. Quantitative analysis of doseeffects relationships: the combined effects of multiple

drugs or enzyme inhibitors. Adv Enzyme Regul 1984;22:27 ^ 55.

26. Reynolds CP, Maurer BJ. Evaluating response toantineoplastic drug combinations in tissue culturemodels. Methods Mol Med 2005;110:173 ^ 83.

27. Siegel S, Castellan JN. Nonparametric statistics forthe behavioral science. Singapore: McGraw-Hill BookCo.; 1988. p. 190.

28. Chen J, Lee BH,Williams IR, et al. FGFR3 as a ther-apeutic target of the small molecule inhibitor PKC412in hematopoietic malignancies. Oncogene 2005;24:8259 ^ 67.

29. Grand EK, Chase AJ, Heath C, Rahemtulla A, CrossNC. Targeting FGFR3 in multiple myeloma: inhibitionof t(4;14)-positive cells by SU5402 and PD173074.Leukemia 2004;18:962^ 6.

30. Paterson JL, Li Z, Wen XY, et al. Preclinical studiesof fibroblast growth factor receptor 3 as a therapeutictarget in multiple myeloma. Br J Haematol 2004;124:595 ^ 603.

31. Hardin J, MacLeod S, Grigorieva I, et al. Interleukin-6 prevents dexamethasone-induced myeloma celldeath. Blood 1994;84:3063 ^ 70.

32. Mitsiades CS, Mitsiades NS, Munshi NC, Richard-son PG, Anderson KC. The role of the bone marrowmicroenvironment in the pathophysiology and thera-peutic management of multiple myeloma: interplay ofgrowth factors, their receptors and stromal interac-tions. Eur J Cancer 2006;42:1564 ^ 73.

33. Chauhan D, Uchiyama H, Akbarali Y, et al. Multiplemyeloma cell adhesion-induced interleukin-6 expres-sion in bone marrow stromal cells involves activationof NF-nB. Blood 1996;87:1104 ^ 12.

34. Hazlehurst LA, Damiano JS, Buyuksal I, PledgerWJ, Dalton WS. Adhesion to fibronectin via h1 integ-rins regulates p27kip1 levels and contributes to celladhesion mediated drug resistance (CAM-DR). Onco-gene 2000;19:4319 ^ 27.

35. HideshimaT, Hayashi T, Chauhan D, Akiyama M,Richardson P, Anderson K. Biologic sequalae of c-JunNH(2)-terminal kinase (JNK) activation in multiplemyeloma cell lines. Oncogene 2003;22:8797 ^ 801.

36. Zhang B, Gojo I, Fenton RG. Myeloid cell factor-1isa critical survival factor for multiple myeloma. Blood2002;99:1885 ^ 93.

37. Nencioni A, Wille L, Dal Bello G, et al. Cooperativecytotoxicity of proteasome inhibitors and tumornecrosis factor-related apoptosis-inducing ligand inchemoresistant Bcl-2-overexpressing cells. Clin Can-cer Res 2005;11:4259 ^ 65.

38. Derouet M,Thomas L, Cross A, Moots RJ, EdwardsSW. Granulocyte macrophage colony-stimulatingfactor signaling and proteasome inhibition delay neu-trophil apoptosis by increasing the stability of Mcl-1.J Biol Chem 2004;279:26915 ^ 21.

39. Neri A, Murphy JP, Cro L, et al. Ras oncogenemutation in multiple myeloma. J Exp Med 1989;170:1715 ^25.

40. Corradini P, Ladetto M, Voena C, et al. Mutationalactivation of N- and K-ras oncogenes in plasma celldyscrasias. Blood 1993;81:2708 ^ 13.

41. Hoang B, Zhu L, Shi Y, et al. Oncogenic RAS muta-tions in myeloma cells selectively induce cox-2 ex-pression, which participates in enhanced adhesion tofibronectin and chemoresistance. Blood 2006;107:4484 ^ 90.

42. Trudel S, Stewart AK, Rom E, et al. The inhibitoryanti-FGFR3 antibody, PRO-001, is cytotoxic tot(4;14) multiple myeloma cells. Blood 2006;107:4039 ^ 46.

43. Bisping G, Wenning D, Kropff MH, et al. Enhancedanti-myeloma activity by combination of receptor ty-rosine kinase (RTK) inhibition, proteasome inhibition,and dexamethasone: therapeutic implications fort(4;14) and t(14;16) multiple myeloma (MM) sub-groups. Blood 2005;106:A112.

44. Hideshima T, Richardson P, Chauhan D, et al. Theproteasome inhibitor PS-341 inhibits growth, indu-ces apoptosis, and overcomes drug resistance in hu-man multiple myeloma cells. Cancer Res 2001;61:3071 ^ 6.

45. HideshimaT, Chauhan D, HayashiT, et al.Proteasomeinhibitor PS-341 abrogates IL-6 triggered signalingcascades via caspase-dependent downregulation ofgp130 in multiple myeloma. Oncogene 2003;22:8386 ^ 93.

46. Ma MH, Yang HH, Parker K, et al. The proteasomeinhibitor PS-341 markedly enhances sensitivity ofmultiple myeloma tumor cells to chemotherapeuticagents. Clin Cancer Res 2003;9:1136 ^ 44.

47. Mitsiades N, Mitsiades CS, Richardson PG, et al.The proteasome inhibitor PS-341potentiates sensitiv-ity of multiple myeloma cells to conventional chemo-therapeutic agents: therapeutic applications. Blood2003;101:2377 ^ 80.

48. David E, Sun SY,Waller EK, ChenJ, Khuri FR, LonialS.The combination of the farnesyl transferase inhibitorlonafarnib and the proteasome inhibitor bortezomibinduces synergistic apoptosis in human myeloma cellsthat is associated with down-regulation of p-AKT.Blood 2005;106:4322^ 9.

49. Pei XY, Dai Y, Grant S. Synergistic induction of oxi-dative injury and apoptosis in human multiple myelo-ma cells by the proteasome inhibitor bortezomib andhistone deacetylase inhibitors. Clin Cancer Res 2004;10:3839 ^ 52.

50. Chauhan D, Singh A, Brahmandam M, et al. Combi-nation of proteasome inhibitors bortezomib and NPI-0052 trigger in vivo synergistic cytotoxicity in multiplemyeloma. Blood 2008;111:1654 ^ 64.





2009;15:520-531. Clin Cancer Res Guido Bisping, Doris Wenning, Martin Kropff, et al. Myeloma

Specific Tyrosine Kinase Inhibitor in t(4;14)−Receptor 3 Bortezomib, Dexamethasone, and Fibroblast Growth Factor

Updated version

http://clincancerres.aacrjournals.org/content/15/2/520

Access the most recent version of this article at:

Cited articles

http://clincancerres.aacrjournals.org/content/15/2/520.full#ref-list-1

This article cites 49 articles, 31 of which you can access for free at:

Citing articles

http://clincancerres.aacrjournals.org/content/15/2/520.full#related-urls

This article has been cited by 3 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. (CCC)Click on "Request Permissions" which will take you to the Copyright Clearance Center's

.http://clincancerres.aacrjournals.org/content/15/2/520To request permission to re-use all or part of this article, use this link



http://clincancerres.aacrjournals.org/content/15/2/520.full#ref-list-1

http://clincancerres.aacrjournals.org/content/15/2/520.full#related-urls

http://clincancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]



Bortezomib, Dexamethasone, and Fibroblast Growth Factor ... · regulation of p44/42...

Documents

Transcript of Bortezomib, Dexamethasone, and Fibroblast Growth Factor ... · regulation of p44/42...