ConTra v2: a tool to identify transcription factor binding 

sites across species, update 2011

Stefan Broos

Prediction of functional regulatory units in non­coding regions

● Look for consensus sequence in certain genomic regions

● Example TATA­Box consensus sequence TATA(T/A)A(A/T)(A/G)

● >chr1:23756967­23757090_hg18_1000_+TTAGTACTTAATGGAGACGGGTGTCATCATATACACAAGTGTTTAAAAATCGTTTATTATGCAAAATGTTAACTTTTATAAAAAGTTTAATATACATCGCATTGTTACAGAAAGTCAC

● Problem: does not take into account the nucleotide frequencies

Prediction of functional regulatory units in non­coding regions

● More advanced way to represent binding sites (and most popular way) is the positional weight matrix (PWM)

● 4xL matrix with L being the length of the binding site

● Each element of the matrix represents the frequency of a certain nucleotide (the 4 rows) at a given position of the binding site

Prediction of functional regulatory units in non­coding regions

● Example of the positional weight matrix of the TATA­Box:

A  [ 61  16 352   3 354 268 360 222 155  56  83  82  82  68  77 ]C  [145  46   0  10   0   0   3   2  44 135 147 127 118 107 101 ]G  [152  18   2   2   5   0  20  44 157 150 128 128 128 139 140 ]T  [ 31 309  35 374  30 121   6 121  33  48  31  52  61  75  71 ]

Prediction of functional regulatory units in non­coding regions

Prediction of functional regulatory units in non­coding regions

● PWMs provide a more natural way to represent and search for binding sites

● Problem: motifs tend to be short and degenerative. No positional dependencies are taken into account...

● Although this is the most popular method, most of the predicted sites are false positive predictions with no known real in vivo functionality (~ Futility theorem) 

Prediction of functional regulatory units in non­coding regions

● Solutions:– Use information of flanking sequences

– Use more complex models (biophysical models)

– Use sequence conservation across species (if a site is conserved across species, there is a higher probability the site is functional)

– ...

Prediction of functional regulatory units in non­coding regions

● Solutions:– Use information of flanking sequences

– Use more complex models (HMMs and biophysical models)

– Use sequence conservation across species (if a site is conserved across species, there is a higher probability the site is functional)

– ...

What is ConTra?● A tool to visualize predicted and conserved 

transcription factor binding sites in a region of interest

● A tool to explore the regulatory potential of a set of binding sites in a region of interest

● Focus on ease of use● Free access to the latests and most up­to­date 

versions of the TRANSFAC and JASPAR PWM libraries

What is ConTra?

First version of ConTra

● Published in 2008 by Hooghe, Hulpiau et al.

● Popular tool, cited 23 times

● Had some limitations

ConTra update

What is new?● Update of PWM libraries● More reference species were added

What is new?● Users are no longer restricted to the promoter 

region. One can search for binding sites in 5'­UTR, 3'­UTR, promoter and intron regions

● Users can upload their own matrices (it is as simple as uploading a multifasta file!)

● Users can upload a custom alignment● Non­coding genes are no longer excluded from 

the analysis

PWM libraries● TRANSFAC version 2010.04● Jaspar update 2010● Phylophacts 2010● All protein binding microarrays from Berger et 

al. Cell, 2008● These PWM libraries are used in combination 

with the match scan tool

Alignments in ConTra● Alignments generated using MULTIZ● Downloaded from UCSC genome browser

How does it work?● The analysis consists of a four step process

Step 1– Select type of analysis: visualization or 

exploration

– Select species 

– Select gene of interest using the gene name or symbol, Ensembl gene ID (ENSG), entrez gene ID, RefSeq (NM_|NR_) or Ensembl transcript ID (ENST)

How does it work?● The analysis consists of a four step process

Step 2– All possible matches with your search term are 

listed. Search term is highlighted

– Select 1 transcript of your gene of interest

How does it work?● The analysis consists of a four step process

Step 3– Select a genomic region of interest (promoter, 5'­

UTR, 3'­UTR, intronic regions)

How does it work?● The analysis consists of a four step process

Step 4– Select up to 20 PWMs from the TRANSFAC 

library, JASPAR library, phylophacts or PBM

– Select a cutoff (to minimize false positive predictions or to minimize false negative predictions)

– Run ConTra ...

Who should use it and where to find it?

● You!● To get an indication how your gene is regulated● To create publication ready graphics● To get a quick and easy visualization of some 

transcription factor binding sites● http://bioit.dmbr.ugent.be/contrav2/index.php

Questions & Examples● Analyse gene of interest● Explore gene of interest● Download and upload own alignment● Make your own PWM● Make beautiful publication graphics using 

ConTra and Jalview