Contents lists available at ScienceDirect

Biomedicine & Pharmacotherapy

journal homepage: www.elsevier.com/locate/biopha

Calcio-herbal formulation, Divya-Swasari-Ras, alleviates chronicinflammation and suppresses airway remodelling in mouse model of allergicasthma by modulating pro-inflammatory cytokine response

Acharya Balkrishnaa,b, Siva Kumar Solletia,1, Hoshiyar Singha,1, Meenu Tomera, Niti Sharmaa,Anurag Varshneya,b,*a Drug Discovery and Development Division, Patanjali Research Institute, NH-58, Haridwar, 249405, Uttarakhand, IndiabDepartment of Allied and Applied Sciences, University of Patanjali, Patanjali Yog Peeth, Roorkee-Haridwar Road, Haridwar, 249 405, Uttarakhand, India

A R T I C L E I N F O

Keywords:Divya-Swasari-Ras (DSR)Chronic asthmaAirway inflammationOxidative stressTh2 cytokine

A B S T R A C T

Asthma is a chronic allergic respiratory disease with limited therapeutic options. Here we validated the potentialanti-inflammatory, anti-asthmatic and immunomodulatory therapeutic properties of calcio-herbal ayurvedicformulation, Divya-Swasari-Ras (DSR) in-vivo, using mouse model of ovalbumin (OVA) induced allergic asthma.HPLC analysis identified the presence of various bioactive indicating molecules and ICP-OES recognized thepresence of Ca mineral in the DSR formulation. Here we show that DSR treatment significantly reduced cardinalfeatures of allergic asthma including inflammatory cell accumulation, specifically lymphocytes and eosinophilsin the Broncho-Alveolar Lavage (BAL) fluids, airway inflammation, airway remodelling, and pro-inflammatorymolecules expression. Conversely, number of macrophages recoverable by BAL were increased upon DSRtreatment. Histology analysis of mice lungs revealed that DSR attenuates inflammatory cell infiltration in lungsand thickening of bronchial epithelium. PAS staining confirmed the decrease in OVA-induced mucus secretion atthe mucosal epithelium; and trichrome staining confirmed the decrease in peribronchial collagen depositionupon DSR treatment. DSR reduced the OVA-induced pro-inflammatory cytokines (IL-6, IL-1β and TNF-α) levelsin BALF and whole lung steady state mRNA levels (IL-4, -5, -33, IFN-γ, IL-6 and IL-1β). Biochemical assays formarkers of oxidative stress and antioxidant defence mechanism confirmed that DSR increases the activity ofSOD, Catalase, GPx, GSH, GSH/GSSG ratio and decreases the levels of MDA activity, GSSG, EPO and Nitritelevels in whole lungs. Collectively, present study suggests that, DSR effectively protects against allergic airwayinflammation and possess potential therapeutic option for allergic asthma management.

1. Introduction

Asthma is a chronic allergic respiratory disease affecting more than300 million people worldwide [1] and its prevalence has been rising. Itis characterized by chronic airway inflammation, excessive mucusproduction, episodic airway obstruction and airway wall remodellingdriven by Th2 lymphocytes [2]. Pathogenesis of asthma involves acomplex interaction of genetic, environmental and immunologicalfactors [3]. Interaction between airway epithelium and components ofinnate and adaptive immune system play a very crucial role in or-chestrating the pathogenesis and progression of asthma [2,4,5].

Immunologically, allergic asthma involves infiltrating of a variety ofinflammatory cells, including eosinophils, mast cells, T-lymphocytes,neutrophils, and macrophages among others [2,5]. The Th2 cell biasedimmune responses in asthma includes, infiltration of Th2 cells into lungand secretion of cytokines like IL-4, -5, -9, -13 and -33 [4]. These cy-tokines call for eosinophilic inflammation, isotype switching of B cellsleading to allergen specific IgE production [6] and tissue damage, re-sulting in airway hyper responsiveness (AHR) and release of additionalinflammatory mediators [2,7].

Oxidative stress plays a critical role in the pathogenesis of asthma[8] due to an imbalance between the production of pro-oxidants and

https://doi.org/10.1016/j.biopha.2020.110063Received 4 February 2020; Received in revised form 20 February 2020; Accepted 27 February 2020

Abbreviations: DSR, Divya-Swasari-Ras; OVA, Ovalbumin; HPLC, High-performance liquid chromatography; ICP-OES, Inductively Coupled Plasma-Optical EmissionSpectrometry; DEXA, Dexamethasone; BALF, bronchoalveolar lavage fluid; Ig, immunoglobulin; IL, interleukin; SOD, superoxide dismutase; CAT, Catalase; GSH,glutathione; GSSH, Oxidized glutathione; PAS, periodic acid–Schiff ;; CMC, Carboxymethyl cellulose; EPO, Eosinophil Peroxidase; MDA, Malondialdehyde

⁎ Corresponding author at: Drug Discovery and Development, Patanjali Research Institute, NH-58, Haridwar, 249405, Uttarakhand, India.E-mail address: anurag@prft.co.in (A. Varshney).

1 These authors contributed equally to this work.

Biomedicine & Pharmacotherapy 126 (2020) 110063

0753-3322/ © 2020 Published by Elsevier Masson SAS. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).

T

antioxidant defence mechanisms in the lungs. In asthma, oxidativestress can increase mucus hyper secretion, induce smooth muscle con-traction and airway hyper-responsiveness [9,10]. Oxidative stress ac-tivates various signalling pathways in immune cells resulting in pro-gression of asthma pathology [9].

While there is significant understanding about the pathophysiolo-gical processes underlying asthma, current treatments fail to cure thedisease, imposing high social and economic costs. Though, use ofcombination of an inhaled corticosteroids and β2-adrenergic agonistscan control the pathological features of asthma, in 5–10 % of patients,the disease is refractory to corticosteroid treatment, which leads tohospitalization [2]. Further, blocking antibodies against specific cyto-kines have recently been approved for patients with severe asthma withlimited responders [4]. Consequently, identifying new anti-asthmatictherapies that are cost effective, well-tolerated and effectively mitigatethe symptoms of asthma are needed.

The practice of complementary or alternative medicine as adjunct inasthma treatment and as anti-inflammatory therapy has been increasing[11]. Natural products contain structurally diversified bioactive che-mical combinations [12,13], offering valuable targets for novel drugdiscovery. Natural products and their derivatives account for 34 % ofnew medicines approved by the US Food and Drug Administration(FDA) between 1981 and 2010 [13]. A number of plant-based herbalformulations and purified natural compounds have shown promisingresults in preclinical and clinical studies of asthma in reducing clinicallyrelevant symptoms [14,15,11].

Divya-Swasari-Ras (DSR) is a calcium containing herbal formulationthat has been prescribed in India by ayurvedic practitioners, as a re-medy for common cold, chronic cough, asthma and phlegm accumu-lation in chest. However, its anti-asthmatic and anti-inflammatoryproperties have never been explored scientifically till date. In the pre-sent research work, we attempted to validate potential anti-asthmatictherapeutic properties of DSR in-vivo using mouse model of ovalbumin(OVA) induced allergic asthma. In addition, HPLC and ICP-OES analysiswere undertaken to identify chemical fingerprints present in DSR for-mulation and their co-relation with observed biological responses.

2. Methods

2.1. Experimental animals

All the animal care and treatment procedures were performed inadherence to the Committee for the Purpose of Control and Supervisionof Experiments on Animals (CPCSEA), Government of India guidelines;and were approved by the Institutional Animal Ethical Committee ofPatanjali Research Institute (IAEC approval number- PRIAS/LAF/IAEC-062). Male BALB/c mice (20–25 g) of 8–10 weeks’ age were procuredfrom Charles River Laboratory licensed supplier, Hylasco Biotechnology

Pvt. Ltd, Hyderabad, India and were housed in a vivarium facility witha 12:12-h light-dark cycle. The animals were supplied with standardpellet diet (Purina Lab Diet, St. Louis, MO, USA) and sterile filteredwater ad libitum.

2.2. Dose calculation for in-vivo experiments

The animal equivalent doses of DSR for mouse studies were esti-mated based on the body surface area of the animals. The human re-commended dose of the DSR powder is 1000 mg, twice a day.Accordingly, total human dose is 2000 mg/60 kg/day (33.33 mg/kg/day). Animal equivalent doses (mg/kg) for mouse were calculated bymultiplying human equivalent dose (mg/kg) by factor of 12.3 [16].Resultant therapeutic equivalent doses for mouse were found to be 410mg/kg. Therefore, 400 mg/kg (round off) has been taken as mousedoses (human equivalent dose), and taken as the mid-dose for phar-macological studies.

2.3. Establishment of asthma model and drug treatment

Healthy mice were selected and randomized based on body weightand divided into six different (Fig. 1) groups namely,

1. Normal Control (NC); 2. Disease Control (DC); 3. 0.5 mg/kgDexamethasone (DEXA); 4. 135 mg/kg Divya-Swasari-Ras (DSR); 5.400 mg/kg DSR; and 6. 1200 mg/kg DSR.

All groups except the Normal Control (NC) mice were sensitized byintraperitoneal (i.p.) injection of 25 μg and 100 μg OVA (emulsifiedwith 2 mg Aluminum hydroxide in 200 μl phosphate buffered saline(PBS) (pH 7.4)) on day 0 and day 7, respectively. Subsequently, micewere challenged with intra-nasal (i.n.) installation of 100 μg OVA in 25μl PBS on day 14, 21, 28, 35, 42, 49, 54, 56 and were euthanized on day58. Whereas, mice in NC group were sensitized and challenged withequal volume of PBS only.

Corticosteroid drug, Dexamethasone (DEXA), has been used forpositive control as standard for inhibiting features of allergic asthma[17]. OVA-sensitized mice were treated with DSR, orally, from day 11till the end of experiment and DEXA (0.5 mg/kg) by i.p., 2 h before OVAchallenge, respectively. The mice in OVA-challenged (DC) group andthe NC group were treated with carboxyl methyl cellulose (CMC) onlyby oral administration, similar to DSR group.

2.4. Broncho alveolar lavage (BAL) phenotyping and harvesting lungs

The mice were humanely sacrificed, and the left lung was ligatedand the right lung was subjected to broncho-alveolar lavage with 3 vol(1 ml / 25 g of ice-cold PBS by inserting a catheter in the trachea. TheBAL fluid collected from the lungs of the mice was centrifuged 3000rpm for 3 min at 4 °C, and the supernatant was retained for further

Fig. 1. Schematic representation of the in-vivo study designand ex-vivo measurements.All groups except the Normal Control (NC) Mice were sensi-tized by intraperitoneal (i.p.) injection OVA +2 mg Aluminumhydroxide in PBS on day 0 (25 μg) and day 7 (100 μg) re-spectively. Subsequently, mice were challenged with intra-nasal (i.n.) installation of 100 μg OVA in 25 μl PBS. Mice in NCreceived only PBS. OVA-sensitized mice were treated withthree different doses (135–1200 mg/kg) of DSR orally and (0.5mg/kg) Dexamethasone i.p. The mice in DC and NC receiveonly with CMC. Mice were sacrificed at the end of experimentand BAL and lungs were harvested and used for cellular phe-notypes, protein and gene expression analysis, oxidative stressparameters and histological assessment of pathology.

A. Balkrishna, et al. Biomedicine & Pharmacotherapy 126 (2020) 110063

2

analysis [18]. The red blood cells in cell pellets were lysed in 1% aceticacid, and BAL cells were re-suspended in PBS. Subsequently, the dif-ferential leukocyte counts were measured after Wright's staining [19].The lobes of right lung were resected; and flash-frozen in liquid ni-trogen for RNA and protein isolation later.

2.5. Determination of cytokines levels

Enzyme-linked immunosorbent assay (ELISA) of BALF was per-formed to determine the levels of IL-6, TNF-α (BioLegend Inc., SanDiego, USA) and IL-1β (Invitrogen, USA), according to the manufac-turer's instructions. ELISA plates were read at 450 nm using theEnvision microplate reader (Perkin Elmer, USA).

2.6. RNA isolation and real-time quantitative RT-PCR of lung tissue

Resected lung samples were homogenized in TRIzol regent(Invitrogen, USA), and total RNA was extracted according to themanufacturer’s protocol. Tissue RNA was re-purified and renderedDNA-free using the RNeasy mini kit (Qiagen, USA). RNAs were reverse-transcribed using the Verso cDNA synthesis kit (Thermo FisherScientific, USA). Quantitative real-time PCR (qPCR) analysis was per-formed using the TProfessional thermocycler (Biometra, Germany)using SYBR green chemistry probes (Applied Biosystems, USA). Geneexpression levels were calculated relative to Ppia (Cyclophilin A) usingthe ddCT method as described previously [18,20]. The primers se-quences used were as follows:

Ppia Fwd:5′- GGTGGTGACTTTACACGCCA -3′Ppia Rev:5′- TCTCCGTAGATGGACCTGCC -3′IL-4 Fwd:5′- GGTCTCAACCCCCAGCTAGT -3′IL-4 Rev:5′- GCCGATGATCTCTCTCAAGTGAT -3′IL-5 Fwd:5′- CTCTGTTGACAAGCAATGAGACG -3′IL-5 Rev:5′- TCTTCAGTATGTCTAGCCCCTG -3′IL-33 Fwd:5′- TCCAACTCCAAGATTTCCCCG -3′IL-33 Rev:5′- CATGCAGTAGACATGGCAGAA -3′IFN-γ Fwd: 5′- ATGAACGCTACACACTGCATC -3′IFN-γ Rev: 5′- CCATCCTTTTGCCAGTTCCTC -3′IL-6 Fwd:5′- CCTCTCTGCAAGAGACTTCCAT -3′IL-6 Rev:5′- AGTCTCCTCTCCGGACTTGT -3′IL-1β Fwd: 5′- CCCTGCAGCTGGAGAGTGTGGA -3′IL-1β Rev: 5′- TGTCTCTGCTTGTGAGGTGCTG -3′

2.7. Histological examinations

Lung tissue sections were fixed in 10 % (v/v) neutral-buffered for-malin, dehydrated in various concentrations of ethanol, embedded inparaffin and cut into 5 μm thick sections. Then, the sections were de-paraffinized and rehydrated by passing through a series of xylene andgraded alcohol and were stained with Hematoxylin and Eosin (H&E),Periodic-Acid-Schiff (PAS) and Mason-Trichrome (MT) stains. Low-magnification and high-magnification histology images of the lungtissue sections were obtained at 100× and 400×, respectively, byusing a bright-field microscope. H&E stained lung sections were ana-lysed for inflammatory cell infiltration at bronchi and at alveoli, alongwith changes in bronchial epithelium. Mucous secretion and goblet cellhyperplasia at bronchial epithelium was assessed by histological ana-lysis of PAS-stained sections. MT stain was used for assessing peri-bronchial collagen depositions. The severity of histopathologicalchanges was determined using 5-point score system [21,22] as follows:0= No Abnormality Detected (NAD), 1= Minimal, 2= Mild, 3=Moderate, 4= Moderately Severe, 5= Severe; and distribution wasrecorded as focal, multifocal and diffused.

2.8. Assessment of anti-oxidative biochemical parameters

2.8.1. Assay of antioxidant enzymes (SOD, CAT, GPX and EPO activityassay)

SOD activity was assayed as per Beauchamp and Fridovich (1971)[23] by measuring the ability of SOD to inhibit the photochemical re-duction of NBT (Nitro blue tetrazolium chloride). The activity of en-zyme is expressed as unit/mg lung tissue. The Catalase (CAT) activityassay was performed using spectrophotometric determination of Hy-drogen Peroxide (H2O2) [24] which form stable complex with Ammo-nium Molybdate. CAT activities are expressed as kilo unit per Liter (kU/L). Glutathione peroxidase (GPx) activity was assayed according to theprocedure of Rotruck et al. (1973) [25] with minor modifications in a96 well format using DTNB reagent and the enzyme activity is ex-pressed in terms of U/mg weight of lung tissue. Eosinophil Peroxidase(EPO) activity using 3,3′,5,5′-Tetramethylbenzidine [26,27] (TMB,Sigma) was measured as described before by Suzuki et al., 1983 [28].Envision microplate reader was used (Perkin Elmer, USA) to measurethe absorbance at 560 nm for SOD activity, 405 nm for CAT activity,420 nm for GPX activity and 450 nm for EPO activity.

2.8.2. Oxidative stress and responses of antioxidant enzyme (MDA, GSH,GSSG and nitrite) assays

Lipid peroxidation was estimated by measuring the levels of mal-ondialdehyde (MDA). MDA estimation assay is based on the reaction ofMDA with Thio-Barbituric acid (TBA); forming a MDA-TBA adduct thatabsorbs strongly at 532 nm (Heath & Packer, 1968) [29]. The levels ofGSH & GSSG were measured by the protocol of Hissin & Hilf (1976)[30] and the fluorescence was read at Ex 350/Em 420 nm. Total nitritecontent was measured according to Griess, 1879 [31] and the absor-bance was measured at 548 nm in Envision microplate reader (PerkinElmer, USA). A standard curve was generated with sodium nitrite inconcentrations from 1 to 100 mmol/ l.

2.9. Preparation of DSR sample

DSR was sourced from Divya Pharmacy, Haridwar, India (Batchnumber A-SSR 020) and were used for all the experiments. The com-position of DSR was given in Table 1. As per the manufacturer’s in-formation, DSR was prepared by pulverising and blending of cleanedand dried plant materials (serial number 1–9; Table 1). The remainingcomponents (serial number 10–13; Table 1) were mixed with above;and passed through sieve before aseptic packing. For HPLC analysis,0.50 g of DSR sample was mixed with 10 ml of methanol and sonicatedfor 45 min. This solution was centrifuged at 10000 rpm for 5 min andfiltered using 0.45 μm nylon filter (Solution A). 1.0 ml of solution A wasdiluted to 5 ml with methanol (Solution B) and diluted to 10 ml withsame solvent (Solution C). Solution A, B and C were used for the ana-lysis of chemical signatures present in the sample using their respectivestandards with purity ≥ 98.0 %.

The quantification of signature compounds was performed usingHigh Performance Liquid Chromatography (Waters Corporation, USA)equipped with binary pump (1525), PDAD (2998) and auto-sampler(2707) using a reverse phase Sunfire C18 (5 μm, 4.6 × 250 mm)column with a flow rate of 1.0 ml/min at 37 °C. For HPLC, mobile phaseA (0.1 % ortho-Phosphoric acid in water adjust pH 2.5 withDiethylamine) and mobile phase B (0.1 % ortho-Phosphoric acid in amixer of acetonitrile and water in the ratio of 88:12, adjust pH 2.5 withDiethylamine) were used. For Cinnamic acid, Glycyrrhizin, Eugenol, 6-Gingerol and Piperine, gradient program was 35 % of mobile phase Bfrom 0−5 min, 35–50 % mobile phase B from 5−15 min, 50–80 %mobile phase B from 15−25 min, 80–90 % mobile phase B from 25−30min, 90-35 % mobile phase B from 30−31 min, 35 % mobile phase Bfrom 31−35 min. For Gallic acid and Ellagic acid, the gradient programwas 5–10 % of mobile phase B from 0−10 min, 10–30 % mobile phaseB from 10−30 min, 30–90 % mobile phase B from 30−31 min, 90–95

A. Balkrishna, et al. Biomedicine & Pharmacotherapy 126 (2020) 110063

3

% mobile phase B from 31−35 min, 95-5 % mobile phase B from35−36 min, 5 % mobile phase B from 36−40 min. While, solution Awas used for the analysis of Cinnamic acid and Ellagic acid, solution Bwas used for the analysis of Eugenol, Glycyrrhizin, 6-Gingerol, Piperineand Solution C was used for the analysis of Gallic acid. Ten microliter ofstandard solutions and test solution was injected during the analysis.Chromatographs were recorded at 278 nm wavelength (for Cinnamicacid, Eugenol, 6-Gingerol and Piperine) and 250 nm wavelength (forGlycyrrhizin, Gallic acid and Ellagic acid).

2.10. ICP-OES analysis

100 mg of Divya-Swasari-Ras sample was digested in HNO3/HClO4

(2:1) acid solution until a white residue was obtained. The residue wasdissolved by adding 2% Nitric acid and filtered. The filtrate was re-constituted to 100 ml by 2% Nitric acid and 10 ml of above solution wasfurther diluted ten-fold in 2% Nitric acid. Blank sample was preparedwithout DSR. Standard solution of Calcium (1 ppm, 2 ppm and 5 ppm)was prepared in 2% Nitric acid from stock standard solution.Calibration curve is obtained by using blank solution and three differentconcentration of standard solution using ICP-OES (Varian 720-ES)(Agilent, Inc, USA).

2.11. Statistical analysis

All data are expressed as the Mean± Standard Error of the Means(SEM). Statistical analysis was done using GraphPad Prism version 7.0software (GraphPad Software, San Diego, CA, USA). A one-way analysisof variance (ANOVA) followed by Dunnett’s multiple comparison testwas used to calculate the statistical difference. Differences in meanvalues were considered significant at p<0.05.

3. Results

3.1. HPLC analysis identified indicating compounds in DSR

HPLC analysis identified the presence of Cinnamic acid, Eugenol, 6-Gingerol, Piperine, Glycyrrhizin, Gallic acid and Ellagic acid as in-dicating components of DSR (Fig. 2), upon comparing the chromato-grams with chromatograms obtained from pure substances. The ana-lytical curve showed linearity in the concentration range used asstandard (data not shown). HPLC analysis revealed that 0.039 μg/ mgCinnamic acid (at 13.49 min), 8.647 μg/ mg Eugenol (at 20.43 min),0.460 μg/ mg 6-Gingerol (at 22.70 min), 3.925 μg/ mg Piperine (at24.23 min) (Fig. 2A), 2.458 μg/ mg Glycyrrhizin (at 18.56 min)(Fig. 2B), 5.161 μg/ mg Gallic acid (at 7.19 min) and 0.158 μg/ mgEllagic acid (at 28.39 min) (Fig. 2C) were present in DSR.

3.2. ICP-OES analysis identified calcium present in DSR

ICP-OES analysis of DSR for the presence of minerals identified thepresence of Calcium in herbal formulation. In DSR the level of Calciumpresent was discovered to be 4.60 %. (Fig. 2D).

3.3. DSR reduces inflammatory cell accumulation in the BALF in OVA-induced allergic lung inflammation

Activation of immune cells and infiltration into lungs is a hallmarkof allergic airway inflammation and a measurement of its severity. Inorder to assess the therapeutic benefit of DSR on inflammatory cellinfiltration, we evaluated the number of inflammatory cells, includingeosinophils, neutrophils, macrophages, and lymphocytes, in broncho-alveolar lavage fluid (BALF).

As shown in the Fig. 3A, total number of inflammatory cells weresignificantly increased in chronic OVA challenged Disease Control (DC)mice, compared to Normal Control (NC) (p<0.05). Oral treatment ofmice with low (135 mg/kg) medium (400 mg/kg) and high dose (1200mg/kg) of DSR markedly reduced the number of inflammatory cellspresent in BALF (p<0.05). Further, DEXA-treated mice also had sig-nificantly fewer inflammatory cells (p< 0.05) than DC.

Differential count analysis of inflammatory cells identified thatOVA-induced a significant influx of Lymphocytes (Fig. 3B) and Eosi-nophils (Fig. 3C). Compared to NC, significantly modest increase in thelymphocyte percentage (37 % vs. 46.8 %, p<0.005) (Fig. 3B) and arobust increase in eosinophil percentage (2% vs 12.5 %, p<0.005)(Fig. 3C) was noticed in DC. Interestingly, while a significant decreasein macrophage percentage (49 % vs 32 %, p<0.005) (Fig. 3D) wasnoticed upon chronic OVA-challenge in DC, non-significant changes inneutrophil percentage was identified (Fig. 3E). Previous reports havealso shown similar effects on neutrophil levels upon prolonged OVAchallenge [32]. Treatment with DEXA significantly attenuated the OVA-induced lymphocyte and eosinophil percentage (Fig. 3B and C). A dosedependent decreases in the lymphocyte percent (46.8 % vs. 37.8 %,p<0.005) and eosinophil percent (12.5 % vs. 4.0 %, p<0.005)(Fig. 3B and C) was observed upon DSR treatment of mice receivingOVA with maximum response was noticed at highest dose of DSR (1200mg/kg). Conversely, DSR treatment significantly increased the macro-phage percentage in a dose dependent manner with a maximum re-sponse at the highest dose (32.4 % vs. 48.0 %, p<0.005), and at thehighest dose it is comparable to that of NC (49.8 % vs. 48.0 %)(Fig. 3D). Previous reports showed that alveolar macrophages have asuppressive role in allergic airway inflammation [33,34]. These resultsindicated the therapeutic benefit of DSR in inhibiting OVA-inducedinfiltration of inflammatory cells.

Table 1Composition of Divya-Swasari-Ras (DSR).

S. No. Constituent’s Scientific Name Traditional Name (In Hindi) Plant Part Used Quantity in DSR (%)

1 Glycyrrhiza glabra L. Mulethi Root 12.72 Syzygium aromaticum (L.) Merr. & L.M.Perry Lavang Flower bud 6.33 Cinnamomum zeylanicum Blume Dalchini Bark 6.34 Pistacia integerrima J. L. Stewart ex Brandis Kakdasingi Gall 12.75 Cressa cretica (L.) Rudanti Fruit 12.76 Zingiber officinale Rosco Sounth Rhizome 8.57 Piper nigrum (L.) Marich Fruit 8.58 Piperlongum (L.) Chhoti pipal Fruit 8.59 Anacycluspyrethrum (L.) Lag. Akarkara Root 6.310 Herbally processed calcined mica ash Abhraka bhasma – 4.411 Herbally processed calcined shell of Pearl oyster ash Mukta-shukti bhasma – 4.412 Herbally processed calcium rich gypsum ash Godanti bhasma – 4.413 Herbally processed calcined cowry shell ash of Cypraea moneta Linn. Kapardak bhasma – 4.4

A. Balkrishna, et al. Biomedicine & Pharmacotherapy 126 (2020) 110063

4

Fig. 2. Indicating compound analysis of DSR using HPLC and ICP-OES.DSR sample was analysed on HPLC using reference standards. The chromatographs were recorded at 250 nm (Glycyrrhizin, Gallic acid and Ellagic acid) and 278 nm(Cinnamic acid, Eugenol, 6-Gingerol and Piperine) wave-lengths. By comparing with chromatographs of pure standards, HPLC analysis identified the presence of bio-active compounds namely, A) Glycyrrhizin B) Gallic acid and Ellagic acid and C) Cinnamic acid, Eugenol, 6-Gingerol and Piperine in the DSR. The structures of therespective compounds were given along with chromatogram. * indicate the particular chromatographic peak used for quantification for the given metabolite. D) ICP-OES analysis identified the presence of calcium mineral in DSR.

A. Balkrishna, et al. Biomedicine & Pharmacotherapy 126 (2020) 110063

5

3.4. DSR alleviates OVA-induced histo-pathological changes during allergiclung inflammation

In order to assess the pathological changes upon OVA challenge andsubsequent beneficial and anti-asthmatic effect of DSR treatment, H&Estained lung tissue sections were evaluated (Fig. 4) for the features ofpathological signs namely, inflammatory cell accumulation and thick-ening of bronchial epithelium. From the results it is evident that, OVAstimulation induced a multifocal inflammatory cell infiltration in thelung tissues (Fig. 4A, B and E). Whereas, pharmacological treatmentwith DSR significantly modulated the features of this pathology withvery focal inflammatory cell accumulation in lungs, similar to the DEXA

treatment (Fig. 4A, B and E). Whereas, no abnormality was detected inNC group. Further, OVA-induced increase in bronchial thickening wassignificantly decreased upon DSR treatment (Fig. 4C and E). Collec-tively, critical evaluation of pathological features identified thatchronic OVA-challenge induced a mild to moderate pathology in DC.Whereas treatment with DSR significantly decreased the features ofpathology (Fig. 4D and E).

3.5. DSR suppresses airway remodelling in asthmatic mice

Goblet cell hyperplasia, peri-bronchial collagen deposition andairway wall thickening represents the hallmarks of pathological

Fig. 3. DSR reduces inflammatory cell accumulation in the BALF in OVA-induced allergic lung inflammation.Effects of DSR on the numbers of inflammatory cells in BALF of asthmatic mice. Mice were administered with various doses of DSR and DEXA as mentioned inmaterials and methods. BALF was collected at 48 h after the last OVA challenge to measure the A) Total cell count in BALF, B) % Lymphocytes, C) % Eosinophils, D)% Macrophages E) % Neutrophils. Data are present the means± S.E.M (n ≥ 5). **, ##, p<0.005 by one-way ANOVA.; ## Represents significant compared to NCand ** Represents significant compared to DC.

A. Balkrishna, et al. Biomedicine & Pharmacotherapy 126 (2020) 110063

6

Fig. 4. DSR alleviates airway inflammation and histo-pathological changes.Histopathological analysis was performed to beneficial and anti-asthmatic effect of DSR treatment. A) H&E stained lung tissue sections of a) NC b) DC c) DEXA d)135mg/kg DSR e) 400 mg/kg DSR f) 1200 mg/kg DSR. H&E stained lung tissue sections were evaluated for B) Inflammatory cell infiltration in bronchi, C) Inflammatorycell infiltration in alveoli, D) Thickening of bronchial epithelium and E) Total pathological score. Arrow indicates either inflammatory cell accumulation andbronchial wall thickening. Data are present the means± S.E.M (n ≥ 5). **, ##, p<0.005 by one-way ANOVA.; ## Represents significant compared to NC and **Represents significant compared to DC. (40X magnification).

A. Balkrishna, et al. Biomedicine & Pharmacotherapy 126 (2020) 110063

7

changes in asthma, and are commonly used to evaluate the severity ofairway remodelling [4,35]. To evaluate mucus hypersecretion bybronchial airways, lung sections were stained with Periodic Acid–Schiff(PAS) stain (Fig. 5 A) and quantified in a double-blind manner using anumerical scoring system (Fig. 5B). Compared to NC, OVA-challengesignificantly increased mucus hypersecretion and goblet cell hyper-plasia in the airways (p<0.05). Further, OVA induced moderatelysevere mucus hyper secretion was significantly alleviated in a dosedependent manner in DSR treated mice (vs. DC, p<0.05) and in DEXAtreated mice (vs. DC, p<0.05).

To evaluate peri-bronchial collagen deposition and airway wallthickening, Masson’s trichrome staining was performed and evaluated.As shown in Fig. 6A, collagen deposition and airway wall thicknesswere significantly increased in the OVA treated DC (vs. NC, p< 0.05).Compared with the DC, DSR treatment slightly alleviated collagen de-position and airway wall thickening. Whereas, DEXA treatment

significantly inhibited collagen deposition (vs. DC, p<0.05) (Fig. 6B).

3.6. DSR reduced OVA-induced pro-inflammatory cytokine levels in BALF

Various cytokines have been shown to play a crucial role in in-flammatory cell accumulation and the development of allergic in-flammation [4,35]. BAL fluid analysis for the pro-inflammatory cyto-kine protein levels (Fig. 7) identified that, compared to NC, OVAsensitization and challenge in DC, markedly increased the protein levelsof IL-6 (NC, 4 pg/ml vs. 57 pg/ml DC, 14 fold, p<0.05), IL-1β (NC, 1.7pg/ml vs. 10.4 pg/ml DC, 6 fold, p< 0.05) and TNF-α (NC, 6.5 pg/mlvs. 35.1 pg/ml DC, 5.3 fold, all p< 0.05) (Fig. 7A-C). Whereas, treat-ment with DSR significantly reduced the OVA-induced pro-in-flammatory cytokine levels of IL-6 (DC, 57 pg/ml vs. 15.9 pg/ml -19.7pg/ml, DSR, all p< 0.05), IL-1β (DC, 10.4 pg/ml vs. 4 pg/ml -5.9 pg/ml, all p< 0.05) and TNF-α (DC, 35.1 pg/ml vs. 10.2 pg/ml -10.9 pg/

Fig. 5. DSR suppresses mucus accumulation in asthmatic mice.PAS staining of histological sections was performed and evaluated for mucus accumulation in airways. Compared to NC, DC showed mucus accumulation and DSRtreatment significantly alleviated mucus accumulation. A) NC B) DC C) DEXA D) 135 mg/kg DSR E) 400 mg/kg DSR F) 1200 mg/kg DSR. E) Quantification mucusaccumulation at bronchial mucosal epithelium. Arrow indicates mucus accumulation in airways. Data are present the means± S.E.M (n ≥ 5). **, ##, p<0.005 byone-way ANOVA.; ## Represents significant compared to NC and ** Represents significant compared to DC. (40X magnification).

Fig. 6. DSR suppresses collagen deposition in asthmatic mice.Masson’s trichrome staining was performed and evaluated the peri-bronchial collagen deposition. Compared to NC, DC showed collage deposition around airwaysand DSR treatment significantly alleviated collagen deposition. A) NC B) DC C) DEXA D) 135 mg/kg DSR E) 400 mg/kg DSR F) 1200 mg/kg DSR. E) Quantificationperi-bronchial collagen deposition. Arrow indicates collagen deposition. Data are present the means± S.E.M (n ≥ 5). **, ##, p<0.005 by one-way ANOVA.; ##

Represents significant compared to NC and ** Represents significant compared to DC. (40X magnification).

A. Balkrishna, et al. Biomedicine & Pharmacotherapy 126 (2020) 110063

8

ml, all p< 0.05) (Fig. 7A–C). Treatment with DEXA significantly de-creased the levels of IL-6 (DC, 57 pg/ml vs. 13 pg/ml, p<0.05), IL-1β(DC, 10.4 pg/ml vs. 4.7 pg/ml, p<0.05) and TNF-α (DC, 35.1 pg/mlvs. 9 pg/ml, p<0.05) (Fig. 7A–C). Decrease in cytokine levels uponDSR treatment at highest dose was comparable to DEXA treatment.

3.7. DSR reduces expression of asthma related pro-inflammatory cytokinesin asthmatic lungs

Activation of Th2 cells and production of Th2 cytokine (IL-4, IL-5and IL-13) and Th2 oriented cytokines (IL-6, IL-33) contribute sig-nificantly to the pathophysiology and lung dysfunction in allergicAsthma [36,37,4]. Steady state mRNA expression analysis of wholelung identified the expression of Th2 related (IL-4, IL-5 and IL-33) andTh1 cytokine (IFN-γ) (Fig. 8).

OVA-challenge in DC induced the expression of IL-4 (vs. NC, 3.3fold, p< 0.05), IL-5 (vs. NC, 2.7 fold, p< 0.05), IL-33 (vs. NC, 3.6 fold,p< 0.05), IFNγ(vs. NC, 2 fold, p< 0.05), IL-6 (vs. NC, 3.9 fold,p< 0.05), and IL-1β (vs. NC, 16.1 fold, p< 0.05) (Fig. 8A–F). Further,either treatment with DEXA (p< 0.05) or DSR (vs. DC, all p< 0.05)significantly attenuated the OVA allergen induced expression of thesecytokines in a dose dependent manner (IL-4, IL-33, IL6 and IL-1β). Theattenuated mRNA expression levels were comparable to DEXA treat-ment groups at low and medium DSR dose.

Remarkably, treatment with high dose of DSR of OVA-sensitized &challenged mice appeared to reduce the expression of IL-4, IL-33 andIFN-γ to even below that of non-sensitized NC mice (Fig. 8A, C and D).At its highest dose (1200 mg/kg), DSR significantly attenuated theexpression of IL-4 (DC, 3.3 fold vs. 0.7 fold, DSR, p< 0.05), IL-5 (DC,2.7 fold vs. 0.9 fold, DSR, p<0.05), IL-33 (DC, 3.6 fold vs. 0.8 fold,

Fig. 7. DSR administration reduced OVA-induced pro-inflammatory cytokine protein levels in BALF.BALF was analysed for the pro-inflammatory cytokine protein concentrations using ELISA and expressed as pg/ml. A) IL-6 B) IL-1β and C) TNF-α. OVA inducedcytokine levels were significantly supressed upon DSR administration. Data are present the means± S.E.M (n ≥ 5). **, ##, p<0.005 and * p<0.05 by one-wayANOVA.; ## Represents significant compared to NC and ** Represents significant compared to DC.

Fig. 8. DSR reduces the mRNA expression of pro-inflammatory cytokines in whole lung tissue.Whole lung tissue RNA was analysed for the steady state mRNA expression levels of cytokines A) IL-4, B) IL-5 C) IL-33 D) IFN-γE) IL-6 and F) IL-1β. Data are presentthe means± S.E.M (n ≥ 5). **, ##, p<0.005 and * p<0.05 by one-way ANOVA.; ## Represents significant compared to NC and ** Represents significantcompared to DC.

A. Balkrishna, et al. Biomedicine & Pharmacotherapy 126 (2020) 110063

9

DSR, p<0.05) and IFNγ(DC, 2.1 fold vs. 0.5 fold, DSR, p< 0.05), IL-6(DC, 3.9 fold vs. 0.9 fold, DSR, p< 0.05), IL-1β (DC, 16.1 fold vs. 1.5fold, DSR, p<0.05)(Fig. 8A–D). The decreased expression of cytokinescorrelates with the decreased infiltration of inflammatory cells speci-fically, eosinophils and lymphocytes as described above (3A-B), sug-gesting a beneficial effect of DSR on modulating airway inflammation.

3.8. DSR modulates antioxidant biochemical markers in OVA-Inducedallergic asthmatic mice

Antioxidants play a very important role in defence mechanisms ofthe cells against oxidative stress [8]. Suppressed activity of key anti-oxidant enzymes had been found to be associated with bronchialasthma and the oxidant/antioxidant imbalance is believed to be a keyevent in asthma [38]. To test the role of oxidative stress and subsequentprotective effect of DSR, lung homogenates were tested for key anti-oxidant biochemical markers. From the analysis it is evident thatcompared to NC, OVA-sensitization and challenge in DC significantlyaltered various oxidant/antioxidant parameters. However, treatmentwith DSR or DEXA reversed OVA-induced alterations (Fig. 9).

Superoxide dismutase (SOD) plays an important role in scavengingsuperoxide radicals during oxidative stress. OVA induced allergicasthma in DC, decreased the activity of antioxidant enzymes, SOD (2.3U/mg vs. 1.0 U/mg, p< 0.05). Whereas, treatment with DSR, sig-nificantly restored the activity (vs. DC, all p< 0.05), similar to DEXA(vs. DC, p< 0.05) (Fig. 9A)

Catalase enzyme detoxifies H2O2 produced under physiologicalconditions by the action of superoxide dismutase. Compared to NC,allergic asthma in DC decreased the activity of catalase (84.8 U/mg vs.30.3 U/mg, p<0.05). Conversely, either treatment with DEXA (vs. DC,p<0.05) or DSR significantly restored the catalase activity at mediumand high dose (p< 0.05) (Fig. 9B).

GPx enzyme, reduces the organic peroxide H2O2, and prevents theperoxidation of cell membrane lipids and subsequent instability. In DC,the levels of GPX were significantly decreased (1.1 U/mg vs. 0.3 U/mg,p<0.05) compared to NC. Treatment with DEXA (vs. DC, p< 0.05) orDSR partially restored the activity of GPX (Fig. 9C).

Malondialdehyde (MDA), the major end product of lipid

peroxidation and indicator of damage to membrane lipids was sig-nificantly elevated DC (1.4 μM/mg vs. 4.5 μM/mg, p<0.05). DEXA(p< 0.05) or DSR significantly decreased the OVA induced of MDAlevels (vs. DC, 2.5 μM/mg-3.0 μM/mg, all p<0.05) (Fig. 9D).

Glutathione (GSH), is an abundant airway antioxidant [39]. Uponoxidation, it is converted to GSSG. The ratio of GSH/GSSG is an in-dicator of cellular redox homeostasis. Compared to NC, in DC, the levelsof GSH were significantly decreased (62.7 μM/mg vs. 32.0 μM/mg,p< 0.05) (Fig. 9E) and the levels of GSSG were elevated (11.2 μM/mgvs. 22.3 μM/mg, p<0.05) (Fig. 9F) hence decreasing the GSH/GSSGratio (4.8 vs. 1.5, p<0.05) in DC (Fig. 9G). DSR treatment (vs. DC, allp< 0.05) and DEXA (vs. DC., p< 0.05) treatment restored the levels ofGSH by supressing the levels of GSSG, significantly restoring the GSH/GSSG ration in a dose dependent manner (vs. DC, all p<0.05) (9E-G).Interestingly, the studied inflammation markers are correlated posi-tively (Figs. 7 and 8) with MDA levels and negatively with the anti-oxidant markers (SOD, CAT, GPX and GSH).

EPO is a biomarker that reveals the extent of cellular injury.Challenge with OVA-significantly increased the EPO activity in DC by 2fold (NC, 0.7 vs 1.2, DC, p< 0.05). Treatment with DSR significantlydecreased the OVA-induced EPO activity (vs. DC, p<0.05). Similarresults were achieved upon DEXA treatment (vs. DC, p< 0.05)(Fig. 10A).

The levels of nitrate and nitrite determine the intensity of nitrogenradicals and involvement of NO signalling pathway. OVA treatmentsignificantly increased the levels of nitrite in lungs of DC (NC, 0.7 μM/mg vs. 2.7 μM/mg, DC, p<0.05). DSR treatment significantly abro-gated (vs. DC all, p< 0.05) the OVA-induced increases (vs, DC, ≤ 60%, p< 0.05) in the nitrite levels. These decreases were comparable toDEXA (p<0.05) (Fig. 10B).

4. Discussion

Asthma pathophysiology is extremely complicated and interactionbetween cells of innate and adaptive immune system such as eosino-phils, macrophages and lymphocytes and structural cells like airwayepithelial cells and smooth muscle cells plays an important role or-chestrating its pathology [2,36,40,41]. Ovalbumin is a well-studied

Fig. 9. DSR modulates the antioxidant biochemical markers in allergic asthma model.Whole lung protein was isolated and analysed for various biochemical parameters related to oxidative stress. A) SOD activity B) Catalase C) GPX D) MDA E) GSH F)GSSG G) GSH/GSSG ratio. Activity was expressed as either U/ mg lung tissue or μM/mg lung tissue. Data are present the means± S.E.M (n ≥ 5). **, ##, p<0.005and * p<0.05 by one-way ANOVA.; ## Represents significant compared to NC and ** Represents significant compared to DC.

A. Balkrishna, et al. Biomedicine & Pharmacotherapy 126 (2020) 110063

10

allergen used to induce experimental asthma in mouse model of dis-ease, as it mimics some of the features of human asthma allowingfeasible method to study the immunological and non-immunologicalmechanisms involved in the pathogenesis of asthma and facilitate stu-dies of potential therapeutic agents [42–44,4].

In the present study, OVA sensitization and challenge successfullyinduced asthma like feature in BALB/c mice namely, elevated eosino-phils and lymphocytes in BAL fluid, histopathological signatures likeinflammatory cell accumulation in lungs, bronchial epithelial thick-ening, mucus secretion by bronchial epithelial cells, peri-bronchialcollagen deposition, BAL and whole lung pro-inflammatory profile anddysregulated oxidative/anti-oxidative balance. These results were inline with several asthma models [41,44,45]. Further, treatment withcalcio-herbal formulation, DSR significantly ameliorated the patholo-gical signs of Asthma in a dose dependent manner in-vivo by reducinginfiltration of inflammatory cells into the airways and lung, attenuatedairway remodelling and decreasing the pro-inflammatory gene andprotein levels, restoring anti-oxidative stress capacity demonstrating itsprominent therapeutic effect on regulation of inflammation in asthma(Fig. 11).

Glucocorticoids and β2-adrenergic agonists have been in use for theimprovement of airway remodelling and features of asthma. However,patients with refractory asthma are poor responded to this treatment[2]. Consequently, identifying cost effective and reliable anti-asthmatictherapies that can mitigate the symptoms of asthma are needed. In thepresent study, we have used chronic model of allergic asthma as, suchmodels have been shown to recapitulate hall mark features more closelyto human asthma like eosinophilia, Th2-dependent allergic inflamma-tion and remodelling of the airways [46,7,47,48,44]. Mucus

hypersecretion may result in airway obstruction, leading to the mor-bidity and mortality in asthma [49,50]. Further, components of extracellular matrix (ECM), particularly collagen, account for the formationof sub epithelial fibrosis [51]. Our results confirmed that DSR treatmentmarkedly reduced mucus secretion, collagen deposition and subsequentfibrosis, indicating that compounds in DSR may have an inhibitory rolein asthmatic airway remodelling.

Asthma is a complex chronic inflammatory airway disease and anumber of studies have demonstrated aberrant expansion of Th2 lym-phocytes and secrete type-2 cytokines, interleukin-4 (IL-4), IL-5, IL-9and IL-13, and Th2 oriented cytokines, like IL-6 and IL-33 induce re-cruitment of inflammatory cells, promote eosinophilia of airways,airway mucus over secretion, bronchial hyper responsiveness (BHR),and immunoglobulin E (IgE) synthesis. Specifically, IL-4 induces Igisotype switching and induces the production of IgE and IgG1 by B cells,IL-5 promotes eosinophil survival, differentiation and migration.Whereas, IL-13 induces mucus metaplasia and airway hyper respon-siveness [51,2,52,36,37,4]. Recently it is becoming apparent that lungepithelial cells produce specific cytokines and that these cytokines canfavour Th2 cell differentiation [37,53]. IL-33 is produced by lung epi-thelial cells and promotes IL-5 production and subsequent eosinophilia.IL-6 has been considered a general marker of inflammation along withTNF-α and IL-1β, two other classical inflammatory cytokines. IL-6regulates CD4 T cell fate [54], promotes IL-4 production during Th2differentiation and inhibits Th1 differentiation. Elevated levels of IL-6have been found in BAL fluid of asthmatics, consistent with our in-vivostudies [55].

Attempts to block selective cytokines and chemokines and asso-ciated adaptive immune pathways has resulted in only a limited successin a subset of population [56,4]. In the present research work, a sig-nificant increase in the mRNA levels of IL-4, IL-5, IL-33 and IL-6 inwhole lung and protein levels of IL-6, in BALF were identified. Further,significant decrease in the pro-inflammatory molecules parallels thedecrease in eosinophil counts in BAL and airway lumen and mucussecretion in airway. These results suggest the role of DSR in regulatingpro-inflammatory signalling mediators and subsequent inflammatoryprocesses.

IL-1β is causally involved in both Th1 and Th2 features of asthmaexacerbations. Sputum levels of IL-1β has recently been shown to play avery crucial role in severe asthma [57] and exacerbations of chronicobstructive pulmonary disease (COPD) and asthma [58]. Further, ele-vated levels of IL-1β may contribute to neutrophilic lung inflammationand asthma in both humans [59] and animal models of asthma [60–62]and contribute to steroid resistance [61]. Further, IL-1β has been shownto increase the expression of Th2 cytokines, IL-33 [63] and IL-6 [64].Contrastingly, in our study we have not seen parallel increases neu-trophilia along with increases in the BAL IL-1β. Further, DSR treatmentsignificantly decreased the levels of IL-1β indicating its therapeuticpotential.

Pro-inflammatory cytokine TNF-α has been implicated in many as-pects of the airway pathology in asthma including AHR [65] probablydue to its direct effect on airway smooth muscle cells [66] or by therelease of the cysteinyl-leukotrienes LTC4 and LTD4 [67]. Further, TNF-α has recently been identified as important factor in refractory asthma[68]. Decrease in the levels of TNF-α upon DSR administration sug-gests, DSR may be an effective therapeutic target or complementaryalternative medicine in refractory asthma.

Oxidative stress plays a crucial role in the pathogenesis of asthma.Airway inflammation is results in enhanced generation of reactivespecies by various immune cells specifically, activated macrophages,eosinophils, and neutrophils exogenously or endogenously resulting inelevated oxidative stress, causing severe macromolecular damage, al-tered enzymatic activities and functional changes in cells [9]. The roleof oxidative stress and impaired antioxidant defence system in asthmapathology is evident from various studies [8,38]. Oxidative stress in-duces the activation of numerous genes involved in antioxidant,

Fig. 10. DSR supresses the elevated levels of EPO and nitrite levels in wholelung.Whole lung protein was isolated and analysed for A) EPO (U/ mg lung tissue)and B) Nitrite (μM/mg lung tissue). Data are present the means± S.E.M (n ≥5). **, ##, p<0.005 and * p<0.05 by one-way ANOVA.; ## Represents sig-nificant compared to NC and ** Represents significant compared to DC.

A. Balkrishna, et al. Biomedicine & Pharmacotherapy 126 (2020) 110063

11

cytoprotective, detoxification and anti-inflammatory functions in-cluding SOD-3, Catalase, GPx, MDA, GSH, NAD(P)H-quinone oxidor-eductase (NQO1), Heme oxygenase-1 (HO-1) via nuclear erythroid 2p45-related factor 2 (Nrf2) transcription factor dependent mechanism[69,45]. Previous reports suggest the use of herbal formulations formodulating oxidative stress in ameliorating asthma have been reported[70,71]. In the present investigation, elevated levels of EPO activity,nitrite species, MDA activity and decreased activity of SOD, Catalase,GPx and GSH confirms the aberrant oxidative/anti-oxidative defencemechanism. Importantly, DSR mediated regulation of anti-oxidativedefence parameters confirms the protective role of DSR in asthma pa-thology by modulating these parameters.

World Health Organization (WHO) has estimated that around 70%–95 % world population, especially in developing countries, dependsessentially on plants based products and herbal preparations/medicinesfor health care needs [72]. Use of poly herbal or mono herbal for-mulations for asthma treatment have been reported [70,73,74]. DSRconsists of roots of Glycyrrhiza glabra L. (Liquorice), buds of Syzygiumaromaticum (L.) Merr. & L.M.Perry (Cloves), bark of Cinnamomum zey-lanicum Blume (Cinnamon), galls of Pistacia integerrima J. L. Stewart exBrandis (Zebrawood), fruits of Cressa cretica (L.), rhizomes of Zingiberofficinale Rosco (Ginger), fruits of Piper nigrum (L.) (Black pepper), fruitsof Piperlongum (L.) (Long pepper), roots of Anacycluspyrethrum(L.) Lag.(Spanish chamomile) (Table 1). HPLC analysis identified the presenceof Cinnamic acid, Eugenol, 6-Gingerol, Piperine, Glycyrrhizin, Gallicacid and Ellagic acid as phyto-metabolites present in DSR.

Glycyrrhiza glabra L. (Liquorice), contains glycyrrhizin as majorbioactive ingredient, along with glycyrrhetinic acid, flavonoids, iso-flavonoids, and chalcones as active compounds. Its roots have beentraditionally used for cough, colds, asthma, and COPD [75]. In line with

our findings, it alleviated the allergic asthma in OVA-induced experi-mental mouse model by decreasing the levels of Th2 IL-4 and IL-5 levelsand eosinophil and interfered with IgE by decreasing the IgE-stimu-lating cytokines, AHR [76] and OVA-induced oxidative stress [77],mucus production [78]. Further, it decreased LPS induced TNF-α andIL-1β levels in lungs [79].

Eugenol is a phenylpropanoid phenolic compound constituting45–90 % of its essential oil of Syzygium aromaticum [80]. It has anti-oxidative, free radical scavenging [81] and anti-inflammatory [80]properties. In lungs, eugenol inhibited eosinophilia and the levels of IL-4 and IL-5 in a NF-κB pathway dependent manner [82]. Further, it hasalso increased the SOD, CAT, GPx, and GST activity [83] and decreasingMPO, MDA activity, improving antioxidant capacity [84] and it mod-ulates NF-κB, ERK1/2, and p38 MAPK signalling pathways [85]. Thebarks of Cinnamomum zeylanicum contains trans-cinnamaldehyde, eu-genol, and linalool, which represent 82.5 % of the total composition[86]. Cinnamon has anti-oxidant [86] properties [87] and supresses IL-1β, IL-6 and TNF-α in LPS-activated macrophages in MAPK dependentpathway [88] and bleomycin-induced idiopathic pulmonary fibrosis[89].

In India, essential oil of P. integerrima is used for the treatment ofasthma, chronic bronchitis, and other ailments for the respiratory tract.However, its pharmacological properties have not yet fully explored[90]. It exerts anti-asthmatic activity by reducing the levels of TNF-α,IL-4, and IL-5 and regulating AQP expression levels [91]. Ethyl gallatepresent in galls attenuates acute lung injury through Nrf2 signaling [92]and inhibits cell adhesion molecules by blocking AP-1 transcriptionfactor [93]. Cressa cretica L exhibits Bronchodilatory and mast cellstabilising activity [94] and its aerial parts contain noctacosanol-1, β-sitosterol, 6-hydroxy-3,4-dimethyl coumarin, 6-methoxy-7,8-methylene

Fig. 11. DSR regulates OVA-induced asthmalike feature in lung airways.Sensitization and challenge with OVA inducesthe production of pro-inflammatory cytokinesin lungs and secretion into airway lumen.These cytokines recruit inflammatory cells likeLymphocytes, Eosinophils and Macrophages inlungs. Further, OVA induces oxidative stress inthe lungs; and that in-turn exacerbates pro-in-flammatory processes. The released cytokinesand oxidative stress cumulatively might inducethe remodelling of airways like mucus secre-tion and peri-bronchial collagen deposition.Treatment with DSR significantly reduces theairway inflammation, oxidative stress, mucushyper secretion and collagen deposition in lungairways.

A. Balkrishna, et al. Biomedicine & Pharmacotherapy 126 (2020) 110063

12

dioxy coumarin, β-sitosterolglucoside, quercetin, kaempferol and rutinand showed protection from CCl4- induced liver damage and anti-oxidant parameters modulation [95].

Rhizome of Zingiber officinale has been used in the treatment of cold,asthma, and bronchitis [75] and it has antiviral activity against re-spiratory syncytial virus [96] n-gingerol present in ginger prevents Th2-mediated immune responses in a mouse model of airway inflammationand 6-gingerol was sufficient to suppress eosinophilia [97] and inhibitthe production of TNF-α, IL-1β, and IL-12 from LPS-stimulated mac-rophages [98]. Piper longum and P. nigrum is used for treating bronchialdiseases, tuberculosis, due to its anti-oxidant, anti-inflammatory, anti-bacterial, anti-tumor properties [99–101]. The fruits of the P. longumcontains the alkaloids and amides; pipericide, piperine, piperlongumi-nine, piplartine, and aristolactams [100,102,100]. Piperine is a majorcomponent of Piper nigrum and P. longum. Piper longum exhibited en-dothelial barrier protective effects and leukocytes migration in-vivo,supressed IL-6 and TNF- α levels by acting upon NF-kB and ERK1/2pathways [103]. Fruits of P. longum inhibited the release of Th-2-mediated cytokines, eosinophil infiltration in mouse model of asthma[104]. P. Nigrum inhibited allergic Inflammation by Inhibiting Th2/Th17 responses and mast cell activation and regulated the balance ofcytokines production from Th1, Th2, Th17 and Treg cells, and inhibitedGATA3, IL-4, IL-6, IL-1β, RORγt, IL-17A, TNF-α expression and in-creased the secretions of IL-10, INF-γ [105]. Piperine also reducedhistologic damage and myeloperoxidase (MPO) activity in the pancreas[106].

The roots of Anacylcus pyrethrum abundantly contains N-iso-butyldienediynamide and polysaccharides [107] along with aponins,sesamin, inulin, gum and traces of essential oil [108,109]. This plantexerts immune modulatory and immune stimulating properties [110]along with anti-inflammatory and antioxidant properties [111]. Poly-herbal formulation, DSR may contains additive properties of all theabove mentioned plant materials with proven anti-inflammatory oranti-asthmatic potential and hence may serve as superior formulationfor treatment of asthma, correlating with the observed biological re-sponses.

Bhasma are unique ayurvedic metallic/minerals preparation,treated with herbal juice or decoction and exposed for Ayurveda, whichare known in Indian subcontinent since 7th century A.D. Bhasma is anash obtained through incineration [112,113]. DSR contains kapardakbhasma, abhraka bhasma, godanti bhasma and mukta shukti bhasma.Kapardak bhasma is prepared from shell of sea animal Cypraea monetaLinn [114] and has reported anti asthmatic properties [115]. Abhrakabhasma is a calcined mica ash that has anti-inflammatory propertiesand provides relief from chronic and incessant cough and asthma [116]and hepato protective function [117]. Godanti bhasma has a potentcombination of calcium rich gypsum and Aloe vera juice, heated at hightemperatures in earthen pots. It has anti-inflammatory function [118]and significant gastro protective and antipyretic activity [119]. Muktashukti bhasma is prepared from Pearl oyster and it has been tradi-tionally used for its anti-inflammatory properties [120] and lung dis-eases [121], antacid, anti-pyretic, and also as a source of calcium [122].Use of bhasma for treatment of asthma has been reported previouslyand demonstrated that bhasma have mast cell stabilizing & anti-in-flammatory activity [123]. Hence, the bhasma and herbal componentspresent in DSR formulation might be modulating various pathologicalparameters of asthma either by acting upon immune cells, structuralcells and inhibiting the inflammatory processes and providing theoverall therapeutic efficacy.

5. Conclusions

The present study demonstrates the therapeutic efficacy and diseasemodifying properties of the Indian traditional calcio-herbal formula-tion, Divya-Swasari-Ras by inhibiting airway inflammation, airway re-modelling and modulating various cellular, molecular and biochemical

parameters associated with asthma pathology. Hence, the use of Divya-Swasari-Ras containing various indicating ingredients as com-plementary or alternative medicine as adjunct in asthma treatmentcould alleviate the asthma pathology.

Author contributions

A.B. provided broad direction for the study, identified and preparedthe test formulations, generated resources and gave final approval forthe manuscript; M.T. performed analytical chemistry experiments;S.K.S. and H.S. performed the biology study and analysed the data,S.K.S performed data curing, and wrote the manuscript; A.V. con-ceptualized and supervised overall studies, generated resources, criti-cally reviewed and finally approved the manuscript.

Data availability

The data is available on request.

Declaration of competing interest

The authors declare no competing interests in the publication of thedata in this manuscript.

Acknowledgments

We are indebted to Param Shradhey Swami Ramdev Ji for his fi-nancial and institutional supports to accomplish this research work. Wealso appreciate Dr. Kumresh and Dr. Suman Jha for their help with ICP-OES analysis; Mr. Sudeep Verma for his help with HPLC analysis. Wewould also like to thank Dr. G.C. Sar and Dr Sachin S. Sakat for in-vivofacility support, Ms. Deepika Mehra, Mr. Kamal Joshi for histo-pathology support; Mr. Vipin Kumar and Mr. Sonit Kumar for animalhandling and Mr. Ajeet Chouhan for art work. We extend our gratitudeto Ms. Priyanka Kandpal, Mr. Pradeep Nain, Mr. Tarun Rajput, Mr.Gagan Kumar and Mr. Lalit Mohan for their swift administrative sup-ports. This presented work has been conducted using research fundsfrom Patanjali Research Foundation Trust, Hardwar, India.

References

[1] Global Asthma Network, The Global Asthma Report 2018, (2018) https://doi.org/ISBN: 978-0-473-29125-9\r978-0-473-29126-6 (ELECTRONIC).

[2] B.N. Lambrecht, H. Hammad, The immunology of asthma, Nat. Immunol. (2015),https://doi.org/10.1038/ni.3049.

[3] F.T. Ishmael, The inflammatory response in the pathogenesis of asthma, J. Am.Osteopath. Assoc. (2011).

[4] P.J. Barnes, Targeting cytokines to treat asthma and chronic obstructive pul-monary disease, Nat. Rev. Immunol. (2018), https://doi.org/10.1038/s41577-018-0006-6.

[5] S. Verstraelen, K. Bloemen, I. Nelissen, H. Witters, G. Schoeters, R. Van DenHeuvel, Cell types involved in allergic asthma and their use in in vitro models toassess respiratory sensitization, Toxicol. Vitr. (2008), https://doi.org/10.1016/j.tiv.2008.05.008.

[6] M. Wills-Karp, Interleukin-13 in asthma pathogenesis, Immunol. Rev. (2004),https://doi.org/10.1111/j.0105-2896.2004.00215.x.

[7] S. Al-Muhsen, J.R. Johnson, Q. Hamid, Remodeling in asthma, J. Allergy Clin.Immunol. (2011), https://doi.org/10.1016/j.jaci.2011.04.047.

[8] U.M. Sahiner, E. Birben, S. Erzurum, C. Sackesen, O. Kalayci, Oxidative stress inasthma, World Allergy Organ. J. (2011), https://doi.org/10.1097/WOX.0b013e318232389e.

[9] Y.S. Cho, H.B. Moon, The role of oxidative stress in the pathogenesis of asthma,Allergy, Asthma Immunol. Res. (2010), https://doi.org/10.4168/aair.2010.2.3.183.

[10] M. Jesenak, M. Zelieskova, E. Babusikova, Oxidative stress and bronchial asthmain children-causes or consequences? Front. Pediatr. (2017), https://doi.org/10.3389/fped.2017.00162.

[11] R. Clarke, F.T. Lundy, L. McGarvey, Herbal treatment in asthma and COPD –current evidence, Clin. Phytoscience. (2015), https://doi.org/10.1186/s40816-015-0005-0.

[12] J. Hert, J.J. Irwin, C. Laggner, M.J. Keiser, B.K. Shoichet, Quantifying biogenicbias in screening libraries, Nat. Chem. Biol. (2009), https://doi.org/10.1038/nchembio.180.

A. Balkrishna, et al. Biomedicine & Pharmacotherapy 126 (2020) 110063

13

[13] A.L. Harvey, R. Edrada-Ebel, R.J. Quinn, The re-emergence of natural products fordrug discovery in the genomics era, Nat. Rev. Drug Discov. (2015), https://doi.org/10.1038/nrd4510.

[14] M.C. Wen, C.H. Wei, Z.Q. Hu, K. Srivastava, J. Ko, S.T. Xi, D.Z. Mu, J. Bin Du,G.H. Li, S. Wallenstein, H. Sampson, M. Kattan, X.M. Li, Efficacy and tolerability ofantiasthma herbal medicine intervention in adult patients with moderate-severeallergic asthma, J. Allergy Clin. Immunol. (2005), https://doi.org/10.1016/j.jaci.2005.05.029.

[15] M.H. Boskabady, N. Mohsenpoor, L. Takaloo, Antiasthmatic effect of Nigella sativain airways of asthmatic patients, Phytomedicine. (2010), https://doi.org/10.1016/j.phymed.2010.01.002.

[16] A. Nair, S. Jacob, A simple practice guide for dose conversion between animalsand human, J. Basic Clin. Pharm. (2016), https://doi.org/10.4103/0976-0105.177703.

[17] L.L. Reber, F. Daubeuf, M. Plantinga, L. De Cauwer, S. Gerlo, W. Waelput, S. VanCalenbergh, J. Tavernier, G. Haegeman, B.N. Lambrecht, N. Frossard, K. DeBosscher, A dissociated glucocorticoid receptor modulator reduces airway hy-perresponsiveness and inflammation in a mouse model of asthma, J. Immunol.(2012), https://doi.org/10.4049/jimmunol.1004227.

[18] S.K. Solleti, D.M. Simon, S. Srisuma, M.C. Arikan, S. Bhattacharya, T. Rangasamy,K.M. Bijli, A. Rahman, J.T. Crossno, S.D. Shapiro, T.J. Mariani, Airway epithelialcell PPARγ modulates cigarette smoke-induced chemokine expression and em-physema susceptibility in mice, Am. J. Physiol. - Lung Cell. Mol. Physiol. (2015),https://doi.org/10.1152/ajplung.00287.2014.

[19] N.E. Everds, Hematology of the laboratory mouse, Mouse Biomed. Res. (2007),https://doi.org/10.1016/B978-012369454-6/50059-5.

[20] S.K. Solleti, S. Srisuma, S. Bhattacharya, J. Rangel-Moreno, K.M. Bijli,T.D. Randall, A. Rahman, T.J. Mariani, Serpine2 deficiency results in lung lym-phocyte accumulation and bronchus-associated lymphoid tissue formation, FASEBJ. (2016), https://doi.org/10.1096/fj.201500159R.

[21] C. Shackelford, G. Long, J. Wolf, C. Okerberg, R. Herbert, Qualitative and quan-titative analysis of nonneoplastic lesions in toxicology studies, Toxicol. Pathol.(2002), https://doi.org/10.1080/01926230252824761.

[22] P.C. Mann, J. Vahle, C.M. Keenan, J.F. Baker, A.E. Bradley, D.G. Goodman,T. Harada, R. Herbert, W. Kaufmann, R. Kellner, T. Nolte, S. Rittinghausen,T. Tanaka, International harmonization of toxicologic pathology nomenclature: anoverview and review of basic principles, Toxicol. Pathol. (2012), https://doi.org/10.1177/0192623312438738.

[23] C. Beauchamp, I. Fridovich, Superoxide dismutase: improved assays and an assayapplicable to acrylamide gels, Anal. Biochem. (1971), https://doi.org/10.1016/0003-2697(71)90370-8.

[24] L. Góth, A simple method for determination of serum catalase activity and revisionof reference range, Clin. Chim. Acta (1991), https://doi.org/10.1016/0009-8981(91)90067-M.

[25] J.T. Rotruck, A.L. Pope, H.E. Ganther, A.B. Swanson, D.G. Hafeman,W.G. Hoekstra, Selenium: biochemical role as a component of glatathione per-oxidase, Science 80 (1973), https://doi.org/10.1126/science.179.4073.588.

[26] P.M. Bozeman, D.B. Learn, E.L. Thomas, Assay of the human leukocyte enzymesmyeloperoxidase and eosinophil peroxidase, J. Immunol. Methods (1990), https://doi.org/10.1016/0022-1759(90)90020-V.

[27] R. Menegazzi, G. Zabucchi, A. Knowles, R. Cramer, P. Patriarca, A new, one-stepassay on whole cell suspensions for peroxidase secretion by human neutrophilsand eosinophils, J. Leukoc. Biol. (1992), https://doi.org/10.1002/jlb.52.6.619.

[28] K. Suzuki, H. Ota, S. Sasagawa, T. Sakatani, T. Fujikura, Assay method for mye-loperoxidase in human polymorphonuclear leukocytes, Anal. Biochem. (1983),https://doi.org/10.1016/0003-2697(83)90019-2.

[29] R.L. Heath, L. Packer, Photoperoxidation in isolated chloroplasts. I. Kinetics andstoichiometry of fatty acid peroxidation, Arch. Biochem. Biophys. (1968), https://doi.org/10.1016/0003-9861(68)90654-1.

[30] P.J. Hissin, R. Hilf, A fluorometric method for determination of oxidized and re-duced glutathione in tissues, Anal. Biochem. (1976), https://doi.org/10.1016/0003-2697(76)90326-2.

[31] P. Griess, H.H. Bemerkungen zu der Abhandlung der, Weselsky und Benedikt„Ueber einige Azoverbindungen, Berichte Der Dtsch. Chem. Gesellschaft (1879),https://doi.org/10.1002/cber.187901201117.

[32] J. Chen, L. Deng, D. Dreymuller, X. Jiang, J. Long, Y. Duan, Y. Wang, M. Luo,F. Lin, L. Mao, B. Muller, G. Koller, J.W. Bartsch, A novel peptide ADAM8 inhibitorattenuates bronchial hyperresponsiveness and Th2 cytokine mediated inflamma-tion of murine asthmatic models, Sci. Rep. (2016), https://doi.org/10.1038/srep30451.

[33] É. Careau, L.I. Proulx, P. Pouliot, A. Spahr, V. Turmel, É.Y. Bissonnette, Antigensensitization modulates alveolar macrophage functions in an asthma model, Am. J.Physiol. - Lung Cell. Mol. Physiol. (2006), https://doi.org/10.1152/ajplung.00219.2005.

[34] Y.S. Seo, H.S. Kim, A.Y. Lee, J.M. Chun, S.B. Kim, B.C. Moon, B.I. Kwon,Codonopsis lanceolata attenuates allergic lung inflammation by inhibiting Th2 cellactivation and augmenting mitochondrial ROS dismutase (SOD2) expression, Sci.Rep. (2019), https://doi.org/10.1038/s41598-019-38782-6.

[35] P.J. Barnes, Immunology of asthma and chronic obstructive pulmonary disease,Nat. Rev. Immunol. (2008), https://doi.org/10.1038/nri2254.

[36] G.G. Brusselle, T. Maes, K.R. Bracke, Eosinophils in the spotlight: eosinophilicairway inflammation in nonallergic asthma, Nat. Med. (2013), https://doi.org/10.1038/nm.3300.

[37] B.C.L. Chan, C.W.K. Lam, L.S. Tam, C.K. Wong, IL33: Roles in allergic inflamma-tion and therapeutic perspectives, Front. Immunol. (2019), https://doi.org/10.3389/fimmu.2019.00364.

[38] S.C. Erzurum, New insights in oxidant biology in asthma, Ann. Am. Thorac. Soc.(2016), https://doi.org/10.1513/AnnalsATS.201506-385MG.

[39] A.M. Cantin, S.L. North, R.C. Hubbard, R.G. Crystal, Normal alveolar epitheliallining fluid contains high levels of glutathione, J. Appl. Physiol. (1987), https://doi.org/10.1152/jappl.1987.63.1.152.

[40] M.J. Holtzman, D.E. Byers, J. Alexander-Brett, X. Wang, The role of airway epi-thelial cells and innate immune cells in chronic respiratory disease, Nat. Rev.Immunol. (2014), https://doi.org/10.1038/nri3739.

[41] S.T. Holgate, Innate and adaptive immune responses in asthma, Nat. Med. (2012),https://doi.org/10.1038/nm.2731.

[42] A.T. Nials, S. Uddin, Mouse models of allergic asthma: acute and chronic allergenchallenge, DMM Dis. Model. Mech. (2008), https://doi.org/10.1242/dmm.000323.

[43] L. Kandratavicius, P. Alves Balista, C. Lopes-Aguiar, R.N. Ruggiero, E.H. Umeoka,N. Garcia-Cairasco, L.S. Bueno-Junior, J.P. Leite, Animal models of epilepsy: useand limitations, Neuropsychiatr. Dis. Treat. (2014), https://doi.org/10.2147/NDT.S50371.

[44] M.V. Aun, R. Bonamichi-Santos, F.M. Arantes-Costa, J. Kalil, P. Giavina-Bianchi,Animal models of asthma: utility and limitations, J. Asthma Allergy (2018),https://doi.org/10.2147/JAA.S121092.

[45] T. Rangasamy, J. Guo, W.A. Mitzner, J. Roman, A. Singh, A.D. Fryer,M. Yamamoto, T.W. Kensler, R.M. Tuder, S.N. Georas, S. Biswal, Disruption ofNrf2 enhances susceptibility to severe airway inflammation and asthma in mice, J.Exp. Med. (2005), https://doi.org/10.1084/jem.20050538.

[46] J.R. Johnson, R.E. Wiley, R. Fattouh, F.K. Swirski, B.U. Gajewska, A.J. Coyle,J.C. Gutierrez-Ramos, R. Ellis, M.D. Inman, M. Jordana, Continuous exposure tohouse dust mite elicits chronic airway inflammation and structural remodeling,Am. J. Respir. Crit. Care Med. (2004), https://doi.org/10.1164/rccm.200308-1094oc.

[47] S.J. McMillan, C.M. Lloyd, Prolonged allergen challenge in mice leads to persistentairway remodelling, Clin. Exp. Allergy (2004), https://doi.org/10.1111/j.1365-2222.2004.01895.x.

[48] R.K. Kumar, C. Herbert, M. Yang, A.M.L. Koskinen, A.N.J. McKenzie, P.S. Foster,Role of interleukin-13 in eosinophil accumulation and airway remodelling in amouse model of chronic asthma, Clin. Exp. Allergy (2002), https://doi.org/10.1046/j.1365-2222.2002.01420.x.

[49] H. Lai, D.F. Rogers, New pharmacotherapy for airway mucus hypersecretion inasthma and COPD: Targeting intracellular signaling pathways, J. Aerosol Med.Pulm. Drug Deliv. (2010), https://doi.org/10.1089/jamp.2009.0802.

[50] D.R. Curran, L. Cohn, Advances in mucous cell metaplasia: a plug for mucus as atherapeutic focus in chronic airway disease, Am. J. Respir. Cell Mol. Biol. (2010),https://doi.org/10.1165/rcmb.2009-0151TR.

[51] B.N. Lambrecht, H. Hammad, J.V. Fahy, The cytokines of asthma, Immunity.(2019), https://doi.org/10.1016/j.immuni.2019.03.018.

[52] R. Leigh, R. Ellis, J.N. Wattie, J.A. Hirota, K.I. Matthaei, P.S. Foster, P.M. O’Byrne,M.D. Inman, Type 2 cytokines in the pathogenesis of sustained airway dysfunctionand airway remodeling in mice, Am. J. Respir. Crit. Care Med. (2004), https://doi.org/10.1164/rccm.200305-706oc.

[53] M. Kurowska-Stolarska, P. Kewin, G. Murphy, R.C. Russo, B. Stolarski, C.C. Garcia,M. Komai-Koma, N. Pitman, Y. Li, A.N.J. McKenzie, M.M. Teixeira, F.Y. Liew,D. Xu, IL-33 induces antigen-specific IL-5 + t cells and promotes allergic-inducedairway inflammation independent of IL-4, J. Immunol. (2008), https://doi.org/10.4049/jimmunol.181.7.4780.

[54] O. Dienz, M. Rincon, The effects of IL-6 on CD4 T cell responses, Clin. Immunol.(2009), https://doi.org/10.1016/j.clim.2008.08.018.

[55] J.C. Virchow, C. Kroegel, C. Walker, H. Matthys, Inflammatory determinants ofasthma severity: mediator and cellular changes in bronchoalveolar lavage fluid ofpatients with severe asthma, J. Allergy Clin. Immunol. (1996), https://doi.org/10.1016/s0091-6749(96)80126-6.

[56] M.J. Schuijs, M.A. Willart, H. Hammad, B.N. Lambrecht, Cytokine targets inairway inflammation, Curr. Opin. Pharmacol. (2013), https://doi.org/10.1016/j.coph.2013.03.013.

[57] C. Rossios, S. Pavlidis, U. Hoda, C.H. Kuo, C. Wiegman, K. Russell, K. Sun,M.J. Loza, F. Baribaud, A.L. Durham, O. Ojo, R. Lutter, A. Rowe, A. Bansal,C. Auffray, A. Sousa, J. Corfield, R. Djukanovic, Y. Guo, P.J. Sterk, K.F. Chung,I.M. Adcock, Sputum transcriptomics reveal upregulation of IL-1 receptor familymembers in patients with severe asthma, J. Allergy Clin. Immunol. (2018),https://doi.org/10.1016/j.jaci.2017.02.045.

[58] J.J. Fu, V.M. McDonald, K.J. Baines, P.G. Gibson, Airway IL-1β and systemic in-flammation as predictors of future exacerbation risk in asthma and COPD, Chest(2015), https://doi.org/10.1378/chest.14-2337.

[59] J.V. Fahya, K.W. b, J. Kimb, H.A. Liub, Bousheya, b, Prominent neutrophilic in-flammation in sputum from subjects with asthma exacerbation, J. Allergy Clin.Immunol. (1995), https://doi.org/10.1016/S0091-6749(95)70128-1.

[60] I. Mahmutovic Persson, H. Akbarshahi, M. Menzel, A. Brandelius, L. Uller,Increased expression of upstream TH2-cytokines in a mouse model of viral-in-duced asthma exacerbation, J. Transl. Med. (2016), https://doi.org/10.1186/s12967-016-0808-x.

[61] R.Y. Kim, J.W. Pinkerton, A.T. Essilfie, A.A.B. Robertson, K.J. Baines, A.C. Brown,J.R. Mayall, M.K. Ali, M.R. Starkey, N.G. Hansbro, J.A. Hirota, L.G. Wood,J.L. Simpson, D.A. Knight, P.A. Wark, P.G. Gibson, L.A.J. O’Neill, M.A. Cooper,J.C. Horvat, P.M. Hansbro, Role for NLRP3 inflammasome-mediated, IL-1β-de-pendent responses in severe, steroid-resistant asthma, Am. J. Respir. Crit. CareMed. (2017), https://doi.org/10.1164/rccm.201609-1830OC.

[62] I. Mahmutovic Persson, M. Menzel, S. Ramu, S. Cerps, H. Akbarshahi, L. Uller, IL-1β mediates lung neutrophilia and IL-33 expression in a mouse model of viral-

A. Balkrishna, et al. Biomedicine & Pharmacotherapy 126 (2020) 110063

14

induced asthma exacerbation, Respir. Res. (2018), https://doi.org/10.1186/s12931-018-0725-z.

[63] K. Nomura, T. Kojima, J. Fuchimoto, K. Obata, T. Keira, T. Himi, N. Sawada,Regulation of interleukin-33 and thymic stromal lymphopoietin in human nasalfibroblasts by proinflammatory cytokines, Laryngoscope. (2012), https://doi.org/10.1002/lary.23261.

[64] H. Eda, B.L. Burnette, H. Shimada, H.R. Hope, J.B. Monahan, Interleukin-1β-in-duced interleukin-6 production in A549 cells is mediated by both phosphatidyli-nositol 3-kinase and interleukin-1 receptor-associated kinase-4, Cell Biol. Int.(2011), https://doi.org/10.1042/cbi20100247.

[65] P.S. Thomas, G. Heywood, Effects of inhaled tumour necrosis factor alpha insubjects with mild asthma, Thorax. (2002), https://doi.org/10.1136/thorax.57.9.774.

[66] M. Adner, A.C. Rose, Y. Zhang, K. Swärd, M. Benson, R. Uddman, N.P. Shankley,L.O. Cardell, An assay to evaluate the long-term effects of inflammatory mediatorson murine airway smooth muscle: evidence that TNFα up-regulates 5-HT 2A-mediated contraction, Br. J. Pharmacol. (2002), https://doi.org/10.1038/sj.bjp.0704928.

[67] M. Huber, B. Beutler, D. Keppler, Tumor necrosis factor α stimulates leukotrieneproduction in vivo, Eur. J. Immunol. (1988), https://doi.org/10.1002/eji.1830181233.

[68] M.A. Berry, B. Hargadon, M. Shelley, D. Parker, D.E. Shaw, R.H. Green,P. Bradding, C.E. Brightling, A.J. Wardlaw, I.D. Pavord, Evidence of a role oftumor necrosis factor α in refractory asthma, N. Engl. J. Med. (2006), https://doi.org/10.1056/NEJMoa050580.

[69] H.Y. Cho, A.E. Jedlicka, S.P.M. Reddy, T.W. Kensler, M. Yamamoto, L.Y. Zhang,S.R. Kleeberger, Role of NRF2 in protection against hyperoxic lung injury in mice,Am. J. Respir. Cell Mol. Biol. (2002), https://doi.org/10.1165/ajrcmb.26.2.4501.

[70] J. Cui, F. Xu, Z. Tang, W. Wang, L. li Hu, C. Yan, Q. Luo, H. Gao, Y. Wei, J. Dong,Bu-Shen-Yi-Qi formula ameliorates airway remodeling in murine chronic asthmaby modulating airway inflammation and oxidative stress in the lung, Biomed.Pharmacother. (2019), https://doi.org/10.1016/j.biopha.2019.108694.

[71] M. Tiwari, U.N. Dwivedi, P. Kakkar, Tinospora cordifolia extract modulates COX-2, iNOS, ICAM-1, pro-inflammatory cytokines and redox status in murine model ofasthma, J. Ethnopharmacol. (2014), https://doi.org/10.1016/j.jep.2014.01.031.

[72] WHO, Traditional Medicines: Global Situation, Issues and Challenges, (2011).[73] T.T. Bui, C.H. Piao, C.H. Song, H.S. Shin, O.H. Chai, Bupleurum chinense extract

ameliorates an OVA-induced murine allergic asthma through the reduction of theTh2 and Th17 cytokines production by inactivation of NFκB pathway, Biomed.Pharmacother. (2017), https://doi.org/10.1016/j.biopha.2017.04.133.

[74] C.L. Venturini, A. Macho, K. Arunachalam, D.A.T. de Almeida, S.I.G. Rosa,E. Pavan, S.O. Balogun, A.S. Damazo, D.T. de O. Martins, Vitexin inhibits in-flammation in murine ovalbumin-induced allergic asthma, Biomed. Pharmacother.(2018), https://doi.org/10.1016/j.biopha.2017.10.073.

[75] A. Ram, S. Balachandar, P. Vijayananth, V.P. Singh, Medicinal plants useful fortreating chronic obstructive pulmonary disease (COPD): current status and futureperspectives, Fitoterapia (2011), https://doi.org/10.1016/j.fitote.2010.09.005.

[76] A. Ram, U. Mabalirajan, M. Das, I. Bhattacharya, A.K. Dinda, S.V. Gangal,B. Ghosh, Glycyrrhizin alleviates experimental allergic asthma in mice, Int.Immunopharmacol. (2006), https://doi.org/10.1016/j.intimp.2006.04.020.

[77] H.A.R. Hassan Khattab, U.A. Abdel-Dayem, H. Abdulsalam Jambi, A. Tallat Abbas,M.T. Ahmead Abdul-Jawad, N.A.E.A. Fouad El-Shitany, Licorice (Glycyrrhizzaglabra) extract prevents production of th2 cytokines and free radicals induced byova albumin in mice, Int. J. Pharmacol. (2018), https://doi.org/10.3923/ijp.2018.1072.1079.

[78] Y. Nishimoto, A. Hisatsune, H. Katsuki, T. Miyata, K. Yokomizo, Y. Isohama,Glycyrrhizin attenuates mucus production by inhibition of MUC5AC mRNA ex-pression in vivo and in vitro, J. Pharmacol. Sci. (2010), https://doi.org/10.1254/jphs.09344FP.

[79] Y.C. Xie, X.W. Dong, X.M. Wu, X.F. Yan, Q.M. Xie, Inhibitory effects of flavonoidsextracted from licorice on lipopolysaccharide-induced acute pulmonary in-flammation in mice, Int. Immunopharmacol. (2009), https://doi.org/10.1016/j.intimp.2008.11.004.

[80] P. Zhang, E. Zhang, M. Xiao, C. Chen, W. Xu, Study of anti-inflammatory activitiesof α-d-glucosylated eugenol, Arch. Pharm. Res. (2013), https://doi.org/10.1007/s12272-013-0003-z.

[81] J.N. Barboza, C. da Silva Maia Bezerra Filho, R.O. Silva, J.V.R. Medeiros, D.P. deSousa, An overview on the anti-inflammatory potential and antioxidant profile ofeugenol, Oxid. Med. Cell. Longev. (2018), https://doi.org/10.1155/2018/3957262.

[82] C. Pan, Z. Dong, Antiasthmatic effects of eugenol in a mouse model of allergicasthma by regulation of vitamin D3 upregulated protein 1/NF-κB pathway,Inflammation (2015), https://doi.org/10.1007/s10753-015-0110-8.

[83] X. Huang, Y. Liu, Y. Lu, C. Ma, Anti-inflammatory effects of eugenol on lipopo-lysaccharide-induced inflammatory reaction in acute lung injury via regulatinginflammation and redox status, Int. Immunopharmacol. (2015), https://doi.org/10.1016/j.intimp.2015.03.026.

[84] D.M. Abd El Motteleb, S.A. Selim, A.M. Mohamed, Differential effects of eugenolagainst hepatic inflammation and overall damage induced by ischemia/re-perfu-sion injury, J. Immunotoxicol. (2014), https://doi.org/10.3109/1547691X.2013.832444.

[85] J.L. Yeh, J.H. Hsu, Y.S. Hong, J.R. Wu, J.C. Liang, B.N. Wu, I.J. Chen, S.F. Liou,Eugenolol and glyceryl-isoeugenol suppress LPS-induced iNOS expression bydown-regulating NF-κB and AP-1 through inhibition of MAPKs and Akt/IκBαsignaling pathways in macrophages, Int. J. Immunopathol. Pharmacol. (2011),https://doi.org/10.1177/039463201102400208.

[86] S. Chericoni, J.M. Prieto, P. Iacopini, P. Cioni, I. Morelli, In vitro activity of theessential oil of Cinnamomum zeylanicum and eugenol in peroxynitrite-inducedoxidative processes, J. Agric. Food Chem. (2005), https://doi.org/10.1021/jf050183e.

[87] G.K. Jayaprakasha, L.J. Mohan Rao, K.K. Sakariah, Volatile constituents fromCinnamomum zeylanicum fruit stalks and their antioxidant activities, J. Agric.Food Chem. (2003), https://doi.org/10.1021/jf034169i.

[88] M.E. Kim, J.Y. Na, J.S. Lee, Anti-inflammatory effects of trans-cinnamaldehyde onlipopolysaccharide-stimulated macrophage activation via MAPKs pathway reg-ulation, Immunopharmacol. Immunotoxicol. (2018), https://doi.org/10.1080/08923973.2018.1424902.

[89] L. Yan, F. Song, H. Li, Y. Li, J. Li, Q.Y. He, D. Zhang, F. Wang, M. Zhang, H. Zhao,T. Feng, Y.Y. Zhao, S.W. Wang, Submicron emulsion of cinnamaldehyde amelio-rates bleomycin-induced idiopathic pulmonary fibrosis via inhibition of in-flammation, oxidative stress and epithelial-mesenchymal transition, Biomed.Pharmacother. (2018), https://doi.org/10.1016/j.biopha.2018.03.145.

[90] R.L. Shirole, N.L. Shirole, A.A. Kshatriya, R. Kulkarni, M.N. Saraf, Investigationinto the mechanism of action of essential oil of Pistacia integerrima for its anti-asthmatic activity, J. Ethnopharmacol. (2014), https://doi.org/10.1016/j.jep.2014.02.009.

[91] S. Rana, M. Shahzad, A. Shabbir, Pistacia integerrima ameliorates airway in-flammation by attenuation of TNF-α, IL-4, and IL-5 expression levels, and pul-monary edema by elevation of AQP1 and AQP5 expression levels in mouse modelof ovalbumin-induced allergic asthma, Phytomedicine (2016), https://doi.org/10.1016/j.phymed.2016.04.006.

[92] K. Mehla, S. Balwani, A. Agrawal, B. Ghosh, Ethyl gallate attenuates acute lunginjury through Nrf2 signaling, Biochimie (2013), https://doi.org/10.1016/j.biochi.2013.08.030.

[93] K. Mehla, S. Balwani, A. Kulshreshtha, D. Nandi, P. Jaisankar, B. Ghosh, Ethylgallate isolated from Pistacia integerrima Linn. inhibits cell adhesion molecules byblocking AP-1 transcription factor, J. Ethnopharmacol. (2011), https://doi.org/10.1016/j.jep.2011.07.068.

[94] S. Priyashree, S. Jha, S.P. Pattanayak, Bronchodilatory and mast cell stabilisingactivity of Cressa cretica L.: evaluation through in vivo and in vitro experimentalmodels, Asian Pac. J. Trop. Med. (2012), https://doi.org/10.1016/S1995-7645(12)60021-2.

[95] K. Dharmendra Singh, P.V. Arya, V. Singh, B. Dharmendra Arya, R. Gupta, Role ofCressa cretica on CCl4- induced liver damage in experimental rats, J. Pharmacogn.Phytochem. 7 (2018) 1368–1373.

[96] J.S. Chang, K.C. Wang, C.F. Yeh, D.E. Shieh, L.C. Chiang, Fresh ginger (Zingiberofficinale) has anti-viral activity against human respiratory syncytial virus inhuman respiratory tract cell lines, J. Ethnopharmacol. (2013), https://doi.org/10.1016/j.jep.2012.10.043.

[97] M.L.B. Ahui, P. Champy, A. Ramadan, L. Pham Van, L. Araujo, K. Brou André,S. Diem, D. Damotte, S. Kati-Coulibaly, M.A. Offoumou, M. Dy, N. Thieblemont,A. Herbelin, Ginger prevents Th2-mediated immune responses in a mouse modelof airway inflammation, Int. Immunopharmacol. (2008), https://doi.org/10.1016/j.intimp.2008.07.009.

[98] S. Tripathi, K.G. Maier, D. Bruch, D.S. Kittur, Effect of 6-gingerol on pro-in-flammatory cytokine production and costimulatory molecule expression in murineperitoneal macrophages, J. Surg. Res. (2007), https://doi.org/10.1016/j.jss.2006.07.051.

[99] S. Vinay, P. Vahl, P.R. Vahl, K. Renuka, V. Palak, C.R. Harisha, P.K. Prajapati,P.D. Scholar, Pharmacognostical and phytochemical study of piper Longum L, J.Pharm. Sci. Innov. (2012), https://doi.org/10.13140/2.1.3859.9689.

[100] S. Kumar, S. Malhotra, A. Prasad, E. Eycken, M. Bracke, W. Stetler-Stevenson,V. Parmar, B. Ghosh, Anti-inflammatory and antioxidant properties of Piper spe-cies: a perspective from screening to molecular mechanisms, Curr. Top. Med.Chem. (2015), https://doi.org/10.2174/1568026615666150220120651.

[101] H. Huang, C.M. Morgan, R.N. Asolkar, M.E. Koivunen, P.G. Marrone, Phytotoxicityof sarmentine isolated from long pepper (Piper longum) fruit, J. Agric. Food Chem.(2010), https://doi.org/10.1021/jf102087c.

[102] A. Chatterjee, C.P. Dutta, Alkaloids of Piper longum Linn-I. Structure and synthesisof piperlongumine and piperlonguminine, Tetrahedron (1967), https://doi.org/10.1016/S0040-4020(01)82575-8.

[103] W. Lee, H. Yoo, J.A. Kim, S. Lee, J.G. Jee, M.Y. Lee, Y.M. Lee, J.S. Bae, Barrierprotective effects of piperlonguminine in LPS-induced inflammation in vitro and invivo, Food Chem. Toxicol. (2013), https://doi.org/10.1016/j.fct.2013.04.027.

[104] S.-H. Kim, Y.-C. Lee, Piperine inhibits eosinophil infiltration and airway hy-perresponsiveness by suppressing T cell activity and Th2 cytokine production inthe ovalbumin-induced asthma model, J. Pharm. Pharmacol. (2009), https://doi.org/10.1211/jpp/61.03.0010.

[105] T.T. Bui, C.H. Piao, C.H. Song, H.S. Shin, D.H. Shon, O.H. Chai, Piper nigrumextract ameliorated allergic inflammation through inhibiting Th2/Th17 responsesand mast cells activation, Cell. Immunol. (2017), https://doi.org/10.1016/j.cellimm.2017.10.005.

[106] G.S. Bae, M.S. Kim, J. Jeong, H.Y. Lee, K.C. Park, B.S. Koo, B.J. Kim, T.H. Kim,S.H. Lee, S.Y. Hwang, Y.K. Shin, H.J. Song, S.J. Park, Piperine ameliorates theseverity of cerulein-induced acute pancreatitis by inhibiting the activation ofmitogen activated protein kinases, Biochem. Biophys. Res. Commun. (2011),https://doi.org/10.1016/j.bbrc.2011.05.136.

[107] J. Boonen, V. Sharma, V.K. Dixit, C. Burvenich, B. De Spiegeleer, LC-MS N-alky-lamide profiling of an ethanolic Anacyclus pyrethrum root extract, Planta Med.(2012), https://doi.org/10.1055/s-0032-1315371.

[108] K. Sujith, V. Suba, R. Darwin, Neuropharmacological profile of ethanolic extract ofAnacyclus pyrethrum in albino wistar rats, Int. J. Pharm. Sci. Res. (2011).

A. Balkrishna, et al. Biomedicine & Pharmacotherapy 126 (2020) 110063

15

[109] G. Subasri, S.A. John, Screening of phytochemical compounds, trace metals andantimicrobial activity of Anacyclus pyrethrum, Int. J. Adv. Sci. Res. (2016),https://doi.org/10.7439/ijasr.v2i1.2891.

[110] C.A. Wu, J.J. Wu, M.J. Tsai, R.Y. Chen, Immunomodulatory effects of a traditionalChinese medicine, Chi-Shie-Shuang-Bu-An-Shen-Tang, on BALB/c mice, J.Ethnopharmacol. (2007), https://doi.org/10.1016/j.jep.2007.06.021.

[111] Antioxidant activity of ethanolic root extract of Anacyclus Pyrethrum, Int. Res. J.Pharm. Pharmacol. (2011).

[112] D. Pal, C.K. Sahu, A. Haldar, Bhasma: The ancient Indian nanomedicine, J. Adv.Pharm. Technol. Res. (2014), https://doi.org/10.4103/2231-4040.126980.

[113] S.S. Ilangovan, S. Sen, Nano - bhasmas for chronic non-communicable diseases,Res. J. Pharm. Biol. Chem. Sci. (2016).

[114] E.C. Sachau, Alberuni’s India, (2013), https://doi.org/10.4324/9781315012049.[115] R. Vaidya (Ed.), Ayurveda Sar Sangrah, Shri Baidyanath Ayurveda Bhawan Ltd.,

Allahabad, India, 2009, p. 95.[116] Vaidya, R. Vaidya (Ed.), Ayurveda Sar Sangrah, Shri Baidyanath Ayurveda

Bhawan Ltd., Allahabad, India, 2009, pp. 90–91.

[117] S. Buwa, S. Patil, P.H. Kulkarni, A. Kanase, Hepatoprotective action of abhrakbhasma, an ayurvedic drug in albino rats against hepatitis induced by CCl4, IndianJ. Exp. Biol. (2001).

[118] R. Vaidya (Ed.), Ayurveda Sar Sangrah, Shri Baidyanath Ayurveda Bhawan Ltd,Allahabad, India, 2009, p. 102.

[119] N. Dubey, N. Dubey, R.S. Mehta, P. Sharma, S. Ghule, M. Bhowmick, Toxicologicaland pharmacological assessment of Godanti bhasma, Asian J. Chem. (2012).

[120] O. Chauhan, J.L. Godhwani, N.K. Khanna, V.K. Pendse, Antiinflammatory activityof Muktashukti bhasma, Indian J. Exp. Biol. (1998).

[121] Vaidya, R. Vaidya (Ed.), Ayurveda Sar Sangrah, Shri Baidyanath AyurvedaBhawan Ltd., Allahabad, India, 2009, p. 150.

[122] C.E. Bowen, H. Tang, Conchiolin-protein in aragonite shells of mollusks, Comp.Biochem. Physiol. - A Physiol. (1996), https://doi.org/10.1016/S0300-9629(96)00059-X.

[123] K. Sarda, K. Sarda, V. Pandit, J. Dawane, G. Deshmane, Study mechanism of actionof krishnavajrabhraka bhasma in asthma, Nat. Preced. (2010), https://doi.org/10.1038/npre.2010.5422.

A. Balkrishna, et al. Biomedicine & Pharmacotherapy 126 (2020) 110063

16