Biology DNA Analysis
-
Upload
elearningja -
Category
Education
-
view
53 -
download
1
Transcript of Biology DNA Analysis
DNA molecules are very long
They may consist of millions of base pairs
In order to study the structure of DNA, the molecules are broken up into smaller fragmentsby enzymes called restriction enzymes
Restriction enzymes do not break up the DNA molecule randomly but ‘cut’ it at particular sites
2Restriction enzymes
For example, a restriction enzyme called EcoR1*‘recognises’ the base sequence CAATTC and cuts itbetween the two As
--C-C-G-C-A-G-C-T-G-T-C-A-A-T-T-C-T-C-T-C-C-G-G-A-T-C-C-A
recognised
cut
--C-C-G-C-A-G-C-T-G-T-C-A
Other restriction enzymes cut the DNA in different placesand so produce fragments which are easier to analyse
--C-C-G-C-A-G-C-T-G-T-C-A
--C-C-G-C-A-G C-T-G-T-C-A A-T-T-C-T-C-C-G G-A-T-C-C-C-A-
A-T-T-C-T-C-T-C-C-G-G-A-T-C-C-C-A-
A-T-T-C-T-C-T-C-C-G-G-A-T-C-C-A-
Restriction fragments 3
The fragments can be separated using gel electrophoresis(See slides 7 – 11)
The fragments cut by the restriction enzymes are calledrestriction fragments
4
Genetic fingerprinting
90% or more of DNA does not carry nucleotide triplets that codefor proteins
The non-coding DNA is often called ‘junk DNA’ but this only means that its functions have not yet been discovered
Some of the non-coding regions consist of repeated sequences of nucleotides
For example -C-A-T-G-C-A-T-G-C-A-T-G-C-A-T-G- *
The number of repeats in any one section of DNA varies from one individual to the next
Since these sections do not code for proteins (and, therefore are not genes) there is no observable difference in these individuals
Genetic fingerprinting
5
Particular repeat sequences can be ‘cut out’ by restriction enzymes
For example
-CATCCACGACATGCATGCATGCATGCCACATCCA-
restriction enzyme cuts
here……………and…..….…..here
or
-CCACGACATGCATGCATGCATGCATGCATGCCACAT-
here…….…..…..………and…...….…………..here
Restriction enzymes 6
Gel electrophoresis
The different sized fragments are separated by a process called gel electrophoresis
The separation takes place in a sheet of a firm but jelly-like substance (a ‘gel’)
Samples of the DNA extracts are placed in shallow cavities (‘wells’) cut into one end of the gel
A voltage is applied to opposite ends of the gel
DNA has a negative charge and moves slowly towardsthe positive end
The shorter fragments travel through the gel faster than the longer fragments
Gel electrophoresis
7
Voltage supply
negative electrode
DNA samples placed inwells cut in gel
positiveelectrode
thin slab ofgel
+DNA fragments Move from negativeTo positive
Gel electrophoresis 9
A sample with theshorter DNA fragmentstravels through the gelfaster than a samplewith the larger fragments
10
Appearance of separated fragments on gel
These bands will contain the shorter DNA fragments
These bands will contain the longer DNA fragments
starting positions Appearance of bands
12
© Prof. E. Wood© Prof. E.J.Wood
Genetic fingerprinting
DNA analysis can be used for catching criminals, establishing parentage, finding how closely organisms are related and many other applications.
The pattern of bands in a gel electrophoresis is known as a genetic fingerprint or a ‘genetic profile’
If a genetic fingerprint found in a sample of blood or other tissueat the scene of a crime matches the genetic fingerprint of a suspect, this can be used as evidence
A DNA sample can be obtained from the suspect using blood, cheek epithelial cells taken from the mouth lining or even the cells clinging to the root of a hair
Genetic fingerprinting
13
….there is a chance of 1 in 10 that this fragment occurs in many individuals…
Suppose that…………
…and.there is a chance of 1 in 20 that this
fragment occurs in many individuals…
…and.there is a chance of 1 in 10 that this
fragment occurs in many individuals…
…and.there is a chance of 1 in 30 that this
fragment occurs in many individuals, but…
Chances of a match 14
…the probability of all 4 bands matching in any person other thanthe suspect is
1 in 10 x 1 in 20 x 1 in 10 x 1 in 30
= 1 in 10 x 20 x 10 x 30 That is 1 in 60,000
When a larger number of bands is involved, the probability that the suspect is not guilty becomes one in many thousands*
Probability of a match 15
V S S1 S2 S3
V Victim
S Sample from crime scene
S1 Suspect 1
S2 Suspect 2
S3 Suspect 3
More than 20 fragmentsfrom Suspect 1 match thosetaken from the crime scene
DNA profiles 16
Evidence from genetic fingerprinting
Genetic fingerprinting is powerful evidence in criminal trials but…
Many restriction fragments may be crowded into a single band
There may be variability in the speed with which a fragment travelsthrough the gel
There is a chance of contamination with ‘foreign’ DNA e.g. from bacteria
The jury may not understand the significance of genetic fingerprinting and may be dependent on conflicting claims from ‘expert’ witnesses
There may be arguments about the statistical significance of a match between DNA profiles
Evidence from genetic fingerprinting
17
Even if there is agreement about a match between the suspect’sDNA profile and forensic samples, it shows only that the suspect was present at the scene of the crime and does not prove that he or she committed the crime
DNA evidence should be considered as conclusive proof of guilt only if there is other supporting evidence
In cases of paternity disputes, the genetic evidence can be conclusive
Paternity can be decided on the basis of a single restriction site
Limitations of DNA evidence 18
position ofrestrictionfragment
part of DNA strand
mother father
Child will receive one copy of the restriction fragment from the mother and one from the father. It could be any one of thesecombinations
child
Paternity test 19
Starting position of sample
1 2 3 4
Genetic fingerprint of …
1 mother
2 child
3 possible father A
4 possible father B
There is a match between one ofthe child’s restriction fragmentsand one of the mother’s.
There is also a match between the child’s other fragment and one from possible father A.
Neither of the child’s restrictionfragments match those of possiblefather B
Paternity test
20
The Human Genome Project
An organism’s genome is its entire genetic make-up
The genome includes …
all the chromosomes
all the genes on the chromosomes
and all the DNA of the chromosomes
The human genome project set out to …
identify the genes in the human genome (about 25,000*)
discover the sequence of the base pairs (about 2.8 billion)
99% of the gene-containing part of human DNA had been analysed by 2003
Human genome project
21
Mapping is the identification of genes and their positions in the chromosome
Modern biochemical techniques are used to identify genes and their positions in the chromosome
Special staining methods reveal bands in the chromosomesThese do not necessarily represent genes but help to identify the position of genes
Chromosome 7
Chromosome 11
position of gene for cystic fibrosis
position of gene for sickle cell anaemia
Mapping
22
By special staining techniques, bands appear in the ‘giant chromosome’ of the fruit-fly (Drosophila)
© Biophoto Associates
Giant chromosomes 23
The bands do not necessarily represent genes but if, in mutant flies, some of the bands are missing, there is a corresponding defect in the fly
If bands are missing from this region, the fly has no colour in its eyes (normally red)
If this band is missing thereis an irregularity in the wing
Loss of this band leads to a change in the texture of the eye surface
One or more of the bands in this region controls the normaldevelopment of bristles
Chromosome banding
24
AGCTAGCCTCAGTTGATCATCGAGTGAGTACTGGACCATGC
Sequencing
Sequencing aims to find out the sequence of nucleotides in a stretch of DNA
The process can be automated to give results relatively quickly
Analysis of a small piece of DNA might give results somethinglike this
Further analysis is needed to decide which sequences code forproteins and represent genes
Sequencing
25
GCTTATCGATTCGGTGATACCATAGTGTAGTGTAGTCGCT
ATCCATCGCTTACGAGTCTGATGCGCATTAGCTAGCTAGCT
Applications of results from the Human Genome Project
It is hoped that a knowledge of the human genome will enable…
identification of defective genes and the chance of early treatment
identification of genes which could make a person susceptible to certain diseases, and so lead to preventative measures
prediction of the proteins that genes produce, giving the opportunityto enhance or inhibit these proteins by specially designed drugs
Among the possible drawbacks are the possibilities that …
insurance companies may refuse cover for people at risk of developing a genetic disability or disease
prediction of a disease or disability could blight a person’s life
26
Applications
Question 1
A restriction enzyme cuts DNA
(a) at random sites
(b) at sites with repeat nucleotides
(c) into single nucleotides
(d) at specific sites
27
Question 2
The proportion of human DNA which codes for proteins is
(a) 3-10%
(b) 10-20%
(c) 50-80%
(d) 80-90%
28
Question 3
Junk DNA is DNA which
(a) is functionless
(b) does not code for proteins
(c) codes for harmful genes
(d) may have functions not yet discovered
29
Question 4
A restriction fragment is a piece of DNA which
(a) contains a gene
(b) contains repeated nucleotide sequences
(c) breaks up DNA at specific sites
(d) codes for a protein
30
Question 5
In gel electrophoresis, the restriction fragments are separated
(a) by heat
(b) by chemicals
(c) by electricity
(d) by X-rays
31
Question 6
In gel electrophoresis
(a) short DNA fragments move faster than long fragments
(b) long DNA fragments move faster than short fragments
(c) the fragments move towards the positive end
(d) the fragments move towards the negative end
32
Question 7
If, in electrophoresis, specific bands appear in the same placein 10% of the population, what are the chances of 5 of these bandsoccurring in one individual?
(a) 1 in 100
(b) 1 in 1000
(c) 1 in 10,000
(d) 1 in 100,000
33
Question 8
In slide 19, each individual has two bands in the electrophoresisseparation. This is because
(a) only two fragments are being analysed
(b) DNA is double stranded
(c) in each individual, one of their fragments is inherited from the father and one from the mother
(d) the results are intended to distinguish between two possible fathers
34
Question 9
The human genome includes
(a) all the genes
(b) all the DNA
(c) all the nucleotides
(d) all the bases
35
Question 10
Mapping is
(a) identifying the genes
(b) finding the position of genes in the chromosome
(c) finding the sequence of nucleotides
(d) finding the number of genes in a chromosome
36
Question 11
Sequencing aims to find
(a) the sequence of nucleotides in DNA
(b) the sequence of genes in DNA
(c) the sequence of events in DNA replication
(d) the timing of the stages in replication
37