AP Biology 2006-2007 Chapter 19: MacroEvolution and the Evidence.
Biology 2 Lecture Material For Macroevolution Systematics 2/Biology 2/Exam 1/2016...Biology 2...
Transcript of Biology 2 Lecture Material For Macroevolution Systematics 2/Biology 2/Exam 1/2016...Biology 2...
![Page 1: Biology 2 Lecture Material For Macroevolution Systematics 2/Biology 2/Exam 1/2016...Biology 2 Macroevolution & Systematics 13 Cladistic Analysis of a DNA Sequence The study group below](https://reader034.fdocuments.net/reader034/viewer/2022042313/5ede0e2aad6a402d66695331/html5/thumbnails/1.jpg)
Biology 2 Macroevolution & Systematics 1
Biology 2
Lecture Material
For
Macroevolution
&
Systematics
![Page 2: Biology 2 Lecture Material For Macroevolution Systematics 2/Biology 2/Exam 1/2016...Biology 2 Macroevolution & Systematics 13 Cladistic Analysis of a DNA Sequence The study group below](https://reader034.fdocuments.net/reader034/viewer/2022042313/5ede0e2aad6a402d66695331/html5/thumbnails/2.jpg)
Biology 2 Macroevolution & Systematics 2
Microevolution:
Biological Species:
Ring Species
Allopatric Speciation:
Evidence of:
Favorable Conditions:
Sympatric Speciation:
Autopolyploidy:
Allopolyploidy:
![Page 3: Biology 2 Lecture Material For Macroevolution Systematics 2/Biology 2/Exam 1/2016...Biology 2 Macroevolution & Systematics 13 Cladistic Analysis of a DNA Sequence The study group below](https://reader034.fdocuments.net/reader034/viewer/2022042313/5ede0e2aad6a402d66695331/html5/thumbnails/3.jpg)
Biology 2 Macroevolution & Systematics 3
Hybrid Zones:
Reinforcement:
Fusion:
Stability:
Adaptive Radiation:
The emergence of numerous species from a common ancestor introduced into an environment, presenting a
diversity of new opportunities and problems
![Page 4: Biology 2 Lecture Material For Macroevolution Systematics 2/Biology 2/Exam 1/2016...Biology 2 Macroevolution & Systematics 13 Cladistic Analysis of a DNA Sequence The study group below](https://reader034.fdocuments.net/reader034/viewer/2022042313/5ede0e2aad6a402d66695331/html5/thumbnails/4.jpg)
Biology 2 Macroevolution & Systematics 4
Macroevolution:
Gradualism:
Punctuated Equilibrium:
Origin of Evolutionary Novelty
Exaptation (preadaptation):
Macroevolution through Major Changes in the Sequences
and Regulation of Developmental Genes
Effects of Developmental Genes
– Changes in Rate and Timing
– Changes in Spatial Patterns
The Evolution of Development
– Changes in Genes
– Changes in Gene Regulation
Effects of Developmental Genes:
“Evo-devo”
Changes in Rate and Timing:
Allometric Growth:
![Page 5: Biology 2 Lecture Material For Macroevolution Systematics 2/Biology 2/Exam 1/2016...Biology 2 Macroevolution & Systematics 13 Cladistic Analysis of a DNA Sequence The study group below](https://reader034.fdocuments.net/reader034/viewer/2022042313/5ede0e2aad6a402d66695331/html5/thumbnails/5.jpg)
Biology 2 Macroevolution & Systematics 5
Changes in Rate and Timing (cont.):
Heterochrony:
Paedeomorphosis:
Paedeogenesis:
Changes in Spatial Patterns:
Homeotic Genes: Hox Genes:
![Page 6: Biology 2 Lecture Material For Macroevolution Systematics 2/Biology 2/Exam 1/2016...Biology 2 Macroevolution & Systematics 13 Cladistic Analysis of a DNA Sequence The study group below](https://reader034.fdocuments.net/reader034/viewer/2022042313/5ede0e2aad6a402d66695331/html5/thumbnails/6.jpg)
Biology 2 Macroevolution & Systematics 6
Changes in Spatial Patterns (cont.):
Homeobox: DNA, around 180 base pairs long,
found within genes that are involved in the
regulation of patterns of anatomical development.
The Evolution of Genes
Changes in Genes
Changes in Gene Regulation
![Page 7: Biology 2 Lecture Material For Macroevolution Systematics 2/Biology 2/Exam 1/2016...Biology 2 Macroevolution & Systematics 13 Cladistic Analysis of a DNA Sequence The study group below](https://reader034.fdocuments.net/reader034/viewer/2022042313/5ede0e2aad6a402d66695331/html5/thumbnails/7.jpg)
Biology 2 Macroevolution & Systematics 7
Evolutionary Trends:
Species Selection (Steven Stanley):
Size:
Toe Reduction:
Tooth shape/size:
SYSTEMATICS:
Comparing the genes or genomes of two species is the most direct measure of inheritance from shared
ancestors. Comparisons can be made by using three methods: DNA-DNA hybridization, restriction
maps, and DNA sequencing. Use the information to determine where species A through F belong in the
phylogenetic tree. The information below is comparing the number of differences between an amino acid
sequence from a blood protein found in rodents. (Assumption: The larger the number, the longer they
have been separated from their common ancestor)
A B C D E F
A 0 10 4 9 14 10
B 10 0 11 5 16 2
C 4 11 0 10 15 10
D 9 5 10 0 15 6
E 14 16 15 15 0 16
F 10 2 10 6 16 0
![Page 8: Biology 2 Lecture Material For Macroevolution Systematics 2/Biology 2/Exam 1/2016...Biology 2 Macroevolution & Systematics 13 Cladistic Analysis of a DNA Sequence The study group below](https://reader034.fdocuments.net/reader034/viewer/2022042313/5ede0e2aad6a402d66695331/html5/thumbnails/8.jpg)
Biology 2 Macroevolution & Systematics 8
PHYLOGENETIC GROUPINGS:
Monophyletic:
Paraphyletic:
Polyphyletic:
Use the diagram below to identify whether the grouping is monophyletic, paraphyletic or polyphyletic.
A B C D E F G H 1. A and B ____________________
2. A, B and C ____________________
3. D, E, and F ____________________
4. E, F, G and H ____________________
5. F, G, and H ____________________
6. E, F, and G ____________________
SIMILARITIES
Homology:
Analogy:
Molecular Homeoplasy:
![Page 9: Biology 2 Lecture Material For Macroevolution Systematics 2/Biology 2/Exam 1/2016...Biology 2 Macroevolution & Systematics 13 Cladistic Analysis of a DNA Sequence The study group below](https://reader034.fdocuments.net/reader034/viewer/2022042313/5ede0e2aad6a402d66695331/html5/thumbnails/9.jpg)
Biology 2 Macroevolution & Systematics 9
ONTOGENY RECAPITULATES PHYLOGENY (Ernst Haekel)
SYSTEMATICS:
Classical Evolutionary (Linnaean) Systematics:
Cladistics:
Assumptions:
Synapomorphies: Shared derived characters
Plesiomorphies: Shared ancestral (primitive) characters
![Page 10: Biology 2 Lecture Material For Macroevolution Systematics 2/Biology 2/Exam 1/2016...Biology 2 Macroevolution & Systematics 13 Cladistic Analysis of a DNA Sequence The study group below](https://reader034.fdocuments.net/reader034/viewer/2022042313/5ede0e2aad6a402d66695331/html5/thumbnails/10.jpg)
Biology 2 Macroevolution & Systematics 10
Parsimony:
![Page 11: Biology 2 Lecture Material For Macroevolution Systematics 2/Biology 2/Exam 1/2016...Biology 2 Macroevolution & Systematics 13 Cladistic Analysis of a DNA Sequence The study group below](https://reader034.fdocuments.net/reader034/viewer/2022042313/5ede0e2aad6a402d66695331/html5/thumbnails/11.jpg)
Biology 2 Macroevolution & Systematics 11
Cladistic taxonomy and classical evolutionary taxonomy are different methods of interpreting
phylogenetic data and classifying organisms. Read each statement below and check whether it relates to
the cladistic approach, the classical approach, or both. Cladistic Classical
1. Method of classifying organisms and reconstructing phylogeny ___ ___
2. Concerned only with the order of branching lineages ___ ___
3. Produces cladograms ___ ___
4. Concerned with branching and degree of divergence ___ ___
5. Differentiates between primitive and derived characters ___ ___
6. Puts lizards and crocodiles in one class, birds in another ___ ___
7. Becoming more popular with researchers ___ ___
8. Says birds are closer to crocodiles than to other reptiles ___ ___
9. Uses anatomy and molecular biology to determine relationship ___ ___
10. Places humans in the same family as some other apes ___ ___
11. Places humans in their own family, separate from apes ___ ___
12. The approach used 15 years ago ___ ___
13. Considered to be more objective approach ___ ___
14. Involves subjective judgements about divergence ___ ___
![Page 12: Biology 2 Lecture Material For Macroevolution Systematics 2/Biology 2/Exam 1/2016...Biology 2 Macroevolution & Systematics 13 Cladistic Analysis of a DNA Sequence The study group below](https://reader034.fdocuments.net/reader034/viewer/2022042313/5ede0e2aad6a402d66695331/html5/thumbnails/12.jpg)
Biology 2 Macroevolution & Systematics 12
Cladogram
In cladistics, similar characteristics that come from a common ancestor are used to divide organisms into
groups. A cladogram will begin by grouping organisms based on a characteristic displayed by all the
members of the group. Subsequently, the larger group, or clade, will contain increasingly smaller groups
(clades) that share the traits of the clades before them, but also exhibit distinct changes as the organism
evolves. Draw a cladogram of the organisms below. (a 0 means the organism lacks that characteristic
and a 1 means the organism has that characteristic present)
Characteristics:
no (0), yes (1)
1 is eukaryotic
2 is multicellular
3 has segmented body
4 has jaws
5 has limbs
6 has hair
7 has placenta
![Page 13: Biology 2 Lecture Material For Macroevolution Systematics 2/Biology 2/Exam 1/2016...Biology 2 Macroevolution & Systematics 13 Cladistic Analysis of a DNA Sequence The study group below](https://reader034.fdocuments.net/reader034/viewer/2022042313/5ede0e2aad6a402d66695331/html5/thumbnails/13.jpg)
Biology 2 Macroevolution & Systematics 13
Cladistic Analysis of a DNA Sequence
The study group below is an example of three species of chameleons, two from Madagascar and
one for Equatorial Guinea. The outgroup is a lizard that is a distant relative of chameleons. The
question is are the two Madagascan species (genus: Brookesia) really more closely related to each other
over one being more closely related to the Equatorial Guinea species (Chamaeleo). The information
below is from a piece of mitochondrial DNA sequence which encodes an amino acid of a protein called
NADH dehydrogenase subuit 2.
Uromastyx
AAACCTTAAAAGACACCACAACCATATGAACAACAACACCAACAATCAGCACACTAC
B. theili
AAACACTACAAAATATAACAACTGCATGAACAACATCAACCACAGCAAACATTTTAC
B. brygooi
AAACACTACAAGACATAACAACAGCATGAACTACTTCAACAACAGCAAATATTACAC
C. feae
AAACCCTACGAGACGCAACAACAATATGATCCACTTCCCCCACAACAAACACAATTT
Possible Cladograms
B. theili
1. B. brygooi Number of changes ______
C. feae
B. brygooi
2.
C. feae Number of changes ______
B. theili
B. theili
3.
C. feae Number of changes ______
B. brygooi