Biology 2 Lecture Material For Macroevolution Systematics 2/Biology 2/Exam 1/2016...Biology 2...

13
Biology 2 Macroevolution & Systematics 1 Biology 2 Lecture Material For Macroevolution & Systematics

Transcript of Biology 2 Lecture Material For Macroevolution Systematics 2/Biology 2/Exam 1/2016...Biology 2...

Page 1: Biology 2 Lecture Material For Macroevolution Systematics 2/Biology 2/Exam 1/2016...Biology 2 Macroevolution & Systematics 13 Cladistic Analysis of a DNA Sequence The study group below

Biology 2 Macroevolution & Systematics 1

Biology 2

Lecture Material

For

Macroevolution

&

Systematics

Page 2: Biology 2 Lecture Material For Macroevolution Systematics 2/Biology 2/Exam 1/2016...Biology 2 Macroevolution & Systematics 13 Cladistic Analysis of a DNA Sequence The study group below

Biology 2 Macroevolution & Systematics 2

Microevolution:

Biological Species:

Ring Species

Allopatric Speciation:

Evidence of:

Favorable Conditions:

Sympatric Speciation:

Autopolyploidy:

Allopolyploidy:

Page 3: Biology 2 Lecture Material For Macroevolution Systematics 2/Biology 2/Exam 1/2016...Biology 2 Macroevolution & Systematics 13 Cladistic Analysis of a DNA Sequence The study group below

Biology 2 Macroevolution & Systematics 3

Hybrid Zones:

Reinforcement:

Fusion:

Stability:

Adaptive Radiation:

The emergence of numerous species from a common ancestor introduced into an environment, presenting a

diversity of new opportunities and problems

Page 4: Biology 2 Lecture Material For Macroevolution Systematics 2/Biology 2/Exam 1/2016...Biology 2 Macroevolution & Systematics 13 Cladistic Analysis of a DNA Sequence The study group below

Biology 2 Macroevolution & Systematics 4

Macroevolution:

Gradualism:

Punctuated Equilibrium:

Origin of Evolutionary Novelty

Exaptation (preadaptation):

Macroevolution through Major Changes in the Sequences

and Regulation of Developmental Genes

Effects of Developmental Genes

– Changes in Rate and Timing

– Changes in Spatial Patterns

The Evolution of Development

– Changes in Genes

– Changes in Gene Regulation

Effects of Developmental Genes:

“Evo-devo”

Changes in Rate and Timing:

Allometric Growth:

Page 5: Biology 2 Lecture Material For Macroevolution Systematics 2/Biology 2/Exam 1/2016...Biology 2 Macroevolution & Systematics 13 Cladistic Analysis of a DNA Sequence The study group below

Biology 2 Macroevolution & Systematics 5

Changes in Rate and Timing (cont.):

Heterochrony:

Paedeomorphosis:

Paedeogenesis:

Changes in Spatial Patterns:

Homeotic Genes: Hox Genes:

Page 6: Biology 2 Lecture Material For Macroevolution Systematics 2/Biology 2/Exam 1/2016...Biology 2 Macroevolution & Systematics 13 Cladistic Analysis of a DNA Sequence The study group below

Biology 2 Macroevolution & Systematics 6

Changes in Spatial Patterns (cont.):

Homeobox: DNA, around 180 base pairs long,

found within genes that are involved in the

regulation of patterns of anatomical development.

The Evolution of Genes

Changes in Genes

Changes in Gene Regulation

Page 7: Biology 2 Lecture Material For Macroevolution Systematics 2/Biology 2/Exam 1/2016...Biology 2 Macroevolution & Systematics 13 Cladistic Analysis of a DNA Sequence The study group below

Biology 2 Macroevolution & Systematics 7

Evolutionary Trends:

Species Selection (Steven Stanley):

Size:

Toe Reduction:

Tooth shape/size:

SYSTEMATICS:

Comparing the genes or genomes of two species is the most direct measure of inheritance from shared

ancestors. Comparisons can be made by using three methods: DNA-DNA hybridization, restriction

maps, and DNA sequencing. Use the information to determine where species A through F belong in the

phylogenetic tree. The information below is comparing the number of differences between an amino acid

sequence from a blood protein found in rodents. (Assumption: The larger the number, the longer they

have been separated from their common ancestor)

A B C D E F

A 0 10 4 9 14 10

B 10 0 11 5 16 2

C 4 11 0 10 15 10

D 9 5 10 0 15 6

E 14 16 15 15 0 16

F 10 2 10 6 16 0

Page 8: Biology 2 Lecture Material For Macroevolution Systematics 2/Biology 2/Exam 1/2016...Biology 2 Macroevolution & Systematics 13 Cladistic Analysis of a DNA Sequence The study group below

Biology 2 Macroevolution & Systematics 8

PHYLOGENETIC GROUPINGS:

Monophyletic:

Paraphyletic:

Polyphyletic:

Use the diagram below to identify whether the grouping is monophyletic, paraphyletic or polyphyletic.

A B C D E F G H 1. A and B ____________________

2. A, B and C ____________________

3. D, E, and F ____________________

4. E, F, G and H ____________________

5. F, G, and H ____________________

6. E, F, and G ____________________

SIMILARITIES

Homology:

Analogy:

Molecular Homeoplasy:

Page 9: Biology 2 Lecture Material For Macroevolution Systematics 2/Biology 2/Exam 1/2016...Biology 2 Macroevolution & Systematics 13 Cladistic Analysis of a DNA Sequence The study group below

Biology 2 Macroevolution & Systematics 9

ONTOGENY RECAPITULATES PHYLOGENY (Ernst Haekel)

SYSTEMATICS:

Classical Evolutionary (Linnaean) Systematics:

Cladistics:

Assumptions:

Synapomorphies: Shared derived characters

Plesiomorphies: Shared ancestral (primitive) characters

Page 10: Biology 2 Lecture Material For Macroevolution Systematics 2/Biology 2/Exam 1/2016...Biology 2 Macroevolution & Systematics 13 Cladistic Analysis of a DNA Sequence The study group below

Biology 2 Macroevolution & Systematics 10

Parsimony:

Page 11: Biology 2 Lecture Material For Macroevolution Systematics 2/Biology 2/Exam 1/2016...Biology 2 Macroevolution & Systematics 13 Cladistic Analysis of a DNA Sequence The study group below

Biology 2 Macroevolution & Systematics 11

Cladistic taxonomy and classical evolutionary taxonomy are different methods of interpreting

phylogenetic data and classifying organisms. Read each statement below and check whether it relates to

the cladistic approach, the classical approach, or both. Cladistic Classical

1. Method of classifying organisms and reconstructing phylogeny ___ ___

2. Concerned only with the order of branching lineages ___ ___

3. Produces cladograms ___ ___

4. Concerned with branching and degree of divergence ___ ___

5. Differentiates between primitive and derived characters ___ ___

6. Puts lizards and crocodiles in one class, birds in another ___ ___

7. Becoming more popular with researchers ___ ___

8. Says birds are closer to crocodiles than to other reptiles ___ ___

9. Uses anatomy and molecular biology to determine relationship ___ ___

10. Places humans in the same family as some other apes ___ ___

11. Places humans in their own family, separate from apes ___ ___

12. The approach used 15 years ago ___ ___

13. Considered to be more objective approach ___ ___

14. Involves subjective judgements about divergence ___ ___

Page 12: Biology 2 Lecture Material For Macroevolution Systematics 2/Biology 2/Exam 1/2016...Biology 2 Macroevolution & Systematics 13 Cladistic Analysis of a DNA Sequence The study group below

Biology 2 Macroevolution & Systematics 12

Cladogram

In cladistics, similar characteristics that come from a common ancestor are used to divide organisms into

groups. A cladogram will begin by grouping organisms based on a characteristic displayed by all the

members of the group. Subsequently, the larger group, or clade, will contain increasingly smaller groups

(clades) that share the traits of the clades before them, but also exhibit distinct changes as the organism

evolves. Draw a cladogram of the organisms below. (a 0 means the organism lacks that characteristic

and a 1 means the organism has that characteristic present)

Characteristics:

no (0), yes (1)

1 is eukaryotic

2 is multicellular

3 has segmented body

4 has jaws

5 has limbs

6 has hair

7 has placenta

Page 13: Biology 2 Lecture Material For Macroevolution Systematics 2/Biology 2/Exam 1/2016...Biology 2 Macroevolution & Systematics 13 Cladistic Analysis of a DNA Sequence The study group below

Biology 2 Macroevolution & Systematics 13

Cladistic Analysis of a DNA Sequence

The study group below is an example of three species of chameleons, two from Madagascar and

one for Equatorial Guinea. The outgroup is a lizard that is a distant relative of chameleons. The

question is are the two Madagascan species (genus: Brookesia) really more closely related to each other

over one being more closely related to the Equatorial Guinea species (Chamaeleo). The information

below is from a piece of mitochondrial DNA sequence which encodes an amino acid of a protein called

NADH dehydrogenase subuit 2.

Uromastyx

AAACCTTAAAAGACACCACAACCATATGAACAACAACACCAACAATCAGCACACTAC

B. theili

AAACACTACAAAATATAACAACTGCATGAACAACATCAACCACAGCAAACATTTTAC

B. brygooi

AAACACTACAAGACATAACAACAGCATGAACTACTTCAACAACAGCAAATATTACAC

C. feae

AAACCCTACGAGACGCAACAACAATATGATCCACTTCCCCCACAACAAACACAATTT

Possible Cladograms

B. theili

1. B. brygooi Number of changes ______

C. feae

B. brygooi

2.

C. feae Number of changes ______

B. theili

B. theili

3.

C. feae Number of changes ______

B. brygooi