Biological information transfer
-
Upload
tapeshwar-yadav -
Category
Health & Medicine
-
view
508 -
download
2
Transcript of Biological information transfer
DNA and Genes
Tapeshwar Yadav(Lecturer)BMLT, DNHE, M.Sc. Medical Biochemistry
Things to find out:
• What is DNA?• The Genetic Code• The Human Genome
Diversity of Life• All biological
systems are composed of the same types of molecules
• Similar organization principles are used at the cellular level
The Cell• Basic component of
life
• Two main categories, prokarytic and eukaryotic cells
• Differences in the nucleus
• Prokaryotes: no defined nucleus and a simplified internal structure
• Eukaryotes: membrane limited nucleus and complicated internal structure
• Three branches of life
• Genetic material is located in nucleus• The genetic information is stored in
Deoxyribonucleic acid, DNA • DNA contains the information needed to
build an individual
What is DNA needed for?
• Genetic information is transferred from DNA and converted to protein
•RNA molecules work as messengers
•Proteins are the biological workers
•Information of the DNA is copied to a RNA molecule in transcription •RNA directs the protein synthesis in a translation
•Protein’s 3D structure determines it’s function
•Information transfer only in one direction
‘’Central dogma’’ of LIFE
The biological information flows from DNA to RNA, and from there to proteins called central dogma of LIFE.It is ultimately the DNA that controls every function of the cell through protein synthesis.As the carrier of genetic information, DNA in a cell must be duplicated (replicated), maintained and passed dawn accurately to the daughter cells.
DNA (Deoxyribo Nucleic Acid)
•a polymer of nucleotide monomers
•2’-deoxyribose sugar
•Four bases:•Adenine, A•Guanine, G•Thymine, T•Cytosine, C
Sugar part
Base part
Four bases...Purine bases• Adenine and
guanine• Two carbon rings
Pyrimidine bases• Thymine and
cytosine• A single carbon
ring
DNA chains• Nucleotides are
joined with phosphodiester bond
• Sequence of bases vary genetic information
• Extremely long chains!
DNA Molecules
• Two polynucleotide chains are joined
• Double helix, twisted in right handed way
• Full circle in every 10 bases
•”ladder-structure”–Bases = steps–Sugars and phosphates = supporting pilars
•Two nucleotide chains run in opposite directions
chemical direction (5´-3´)
Complementary Pairing• Bases pair with other bases
• Space between the chains is limited Purines with two carbon rings pair only with single ring pyrimidines A + T G + C
• Complementary pairing is vital for the use and storage of the genetic information!
•Interaction is stabilized by hydrogen bonds
The Genetic Code• Describes how nucleotide sequence is
converted to protein sequence
• Unit of three nucleotides = a codon
• A codon codes for a specific amino acid (structural component of protein)
• The four bases can form 64 different codons
• 20 amino acids are found from the nature
• Regulatory codons
Frame 1Met F P P S G S T G L I P P S H F Q A R P L S T L P R Met A P T W L S D I P L V Q Frame 2C F H L Q V P L G Stop F P P P T F K L G P F Q L C Q E W L P P G S Q T F P W S N Frame 1G L D Q G N V Stop E P G G S H S W Q S Stop K G P S L K V G G G N Q P S G T Stop R W K H
•Right reading frame is obligatory!•Part of the sequence from psoriasis associated gene HCR
• Three different reading frames can be used, but only one is the right one
•Translate tools are found from the internet
atgtttccac cttcaggttc cactgggctg attcccccct cccactttca agctcggccc ctttcaactc tgccaagaat ggctcccacc tggctctcag acattcccct ggtccaaccc
The right one
DNA
chromatin
chromatin fibers
fibers connected to chromosome scaffold
Condenced scaffold
Chromosome
Genes
• A gene: DNA sequence that is needed to encode amino acid sequence of a protein
• Composed of exons, introns and different control elements
• Exon – protein coding sequence• Intron – intervening sequence
• Genes vary a lot in size:Humans: average 3000bplargest 2.4 million bp
•Genes are separated by sequences with unknown function
•Only one strand of the DNA carries biological information template strand
•Potential to store biological information is enormous
That’s all for this time!
The Human Genome and Inheritance
• 3 billion base pairs
• about 22 000 genes
• Only 2 % of the DNA encode proteins
• Genes include exons and introns
• Beside coding areas also additional secuences are found
• 50 % repeated sequences (”junk DNA”)
The Human genome...
The different types of sequences that make up the total DNA of a human cell
• 23 chromosome pairs 46 chromosomes
• 44 autosomes, 2 sex chromosomes
• X and Y –chromosomes
• XX female
• XY Male
Chromosomes carrying the same genes are called homologous
Passing on the genetic information:
• Information passed on in the sexual reproduction• Needed for new characteristics to develop• Offspring recieve genes by inheriting chromosomes
Two important terms...
Phenotype: The outlook of an organism
Genotype: The genetic information written in DNA
ATGTTTCCACCTTCAGGTTCCACTGGGCTGATTCCCCCCTCCCACTTTCAAGCTCGGCCCCTTTCAACTCAGAGAGGCGGCTAGACACCCAGAGACCTCAAGTGACCATGTGGGAACGGGATGTTTCCAGTGACAGGCAG
GCCAAGAATGGCTCCCACCTGGCTCTCAGACATTCCCCTGGTCCAACCCCCAGGCCATCAAGATGTCTCAGAGAGGCGGCTAGACACCCAGAGACCTCAAGTGACCATGTGGGAACGGGATGTTTCCAGTGACAGGCA
Genotype
Phenotypes
Genotype
All somatic cells• 23 chromosome pairs (46 chromosomes)• Diploid cells, 2n
Sperm cell• 23 chromosomes• Haploid cell, n
Egg cell• 23 chromosomes• Haploid cell, n
Fertilization:
n n
+
Fertilized egg • 2n• 46 chromosomes
A chromosome pare:
• A locus• An allele
Mitosis
• Division of somatic cells
• Products two daughter cells from one parent cell • The number of chromosomes does not change
• DNA duplicates before entering the mitosis
• Takes 1-2 hours
Meiosis
• Only in gamete formation
• One diploidic parent cell produces four haploid gametosytes
• Mature gametocytes have 23 chromosomes (n)