Bioaccumulation, Biotransformation, and Toxicity of BDE-47 ... · to compare their accumulation,...

Bioaccumulation, Biotransformation, and Toxicity of BDE-47, 6‑OH-BDE-47, and 6‑MeO-BDE-47 in Early Life-Stages of Zebrafish (Daniorerio)Hongling Liu,*,†,# Song Tang,‡,# Xinmei Zheng,† Yuting Zhu,† Zhiyuan Ma,† Chunsheng Liu,†

Markus Hecker,‡,§ David M.V. Saunders,§ John P. Giesy,†,§,∥,⊥ Xiaowei Zhang,† and Hongxia Yu*,†

†State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing, Jiangsu210023, China‡School of Environment and Sustainability, University of Saskatchewan, Saskatoon, Saskatchewan S7N 5B3, Canada§Toxicology Centre, University of Saskatchewan, Saskatoon, Saskatchewan S7N 5B3, Canada∥Department of Veterinary Biomedical Sciences, University of Saskatchewan, Saskatoon, Saskatchewan S7N 5B3, Canada⊥Department of Biology and Chemistry, City University of Hong Kong, Kowloon, Hong Kong SAR, China

*S Supporting Information

ABSTRACT: 2,2′,4,4′-Tetrabromodiphenyl ether (BDE-47),6-hydroxy-tetrabromodiphenyl ether (6-OH-BDE-47), and 6-methoxy-tetrabromodiphenyl ether (6-MeO-BDE-47) are themost detected congeners of polybrominated diphenyl ethers(PBDEs), OH-BDEs, and MeO-BDEs, respectively, in aquaticorganisms. Although it has been demonstrated that BDE-47can interfere with certain endocrine functions that aremediated through several nuclear hormone receptors (NRs),most of these findings were from mammalian cell lines exposedin vitro. In the present study, embryos and larvae of zebrafishwere exposed to BDE-47, 6-OH-BDE-47, and 6-MeO-BDE-47to compare their accumulation, biotransformation, andbioconcentration factors (BCF) from 4 to 120 hpf. In addition,effects on expression of genes associated with eight differentpathways regulated by NRs were investigated at 120 hpf. 6-MeO-BDE-47 was most bioaccumulated and 6-OH-BDE-47, whichwas the most potent BDE, was least bioaccumulated. Moreover, the amount of 6-MeO-BDE-47, but not BDE-47, transformed to6-OH-BDE-47 increased in a time-dependent manner, approximately 0.01%, 0.04%, and 0.08% at 48, 96, and 120 hpf,respectively. Expression of genes regulated by the aryl hydrocarbon receptor (AhR), estrogen receptor (ER), andmineralocorticoid receptor (MR) was affected in larvae exposed to 6-OH-BDE-47, whereas genes regulated by AhR, ER, andthe glucocorticoid receptor (GR) were altered in larvae exposed to BDE-47. The greatest effect on expression of genes wasobserved in larvae exposed to 6-MeO-BDE-47. Specifically, 6-MeO-BDE-47 affected the expression of genes regulated by AhR,ER, AR, GR, and thyroid hormone receptor alpha (TRα). These pathways were mostly down-regulated at 2.5 μM. Takentogether, these results demonstrate the importance of usage of an internal dose to assess the toxic effects of PBDEs. BDE-47 andits analogs elicited distinct effects on expression of genes of different hormone receptor-mediated pathways, which have expandedthe knowledge of different mechanisms of endocrine disrupting effects in aquatic vertebrates. Because some of these homologuesare natural products, assessments of risks of anthropogenic PBDE need to be made against the background of concentrationsfrom naturally occurring products. Even though PBDEs are being phased out as flame retardants, the natural products remain.

■ INTRODUCTIONPolybrominated diphenyl ethers (PBDEs) have been exten-sively employed as flame retardants (FRs) in various consumerand commercial products for decades.1,2 As a result of thesubstantial production, long-term use, disposal, and recyclingprocesses, these chemicals are now frequently found in theenvironment.3 The persistence, bioaccumulation potential, andtoxic potency (PBT criteria) of 2,2′,4,4′-tetrabromodiphenylether (BDE-47), one of the primary PBDEs found in the

environment, has raised concern about its potential adverseeffects to ecosystems and human health.3−5 In addition to thesynthetic BDE-47, its hydroxylated (OH−) or methoxylated(MeO−) forms, 6-OH-BDE-47 and 6-MeO-BDE-47, have been

Received: August 6, 2014Revised: December 24, 2014Accepted: January 7, 2015Published: January 7, 2015

Article

pubs.acs.org/est

© 2015 American Chemical Society 1823 DOI: 10.1021/es503833qEnviron. Sci. Technol. 2015, 49, 1823−1833

pubs.acs.org/esthttp://dx.doi.org/10.1021/es503833q

suggested to be natural products of marine organisms6 and havebeen detected in a wide variety of freshwater and marineorganisms including mollusks, mussels, shellfish, clam, fish, seal,dolphin, and whale.4,7−13 Moreover, it has been conclusivelydemonstrated that MeO-BDEs, and not PBDEs, are precursorsof OH-BDEs.6,17−19 In zebrafish (Danio rerio), 6-MeO-BDE-47can be transformed into 6-OH-BDE-47; however, BDE-47cannot be transformed into 6-OH-BDE-47.20 In addition,interconversion between 6-MeO-BDE-47 and 6-OH-BDE-47has been observed during dietary exposure of Japanese medaka(Oryzias latipes).17

To date, increasing evidence has shown that exposure toBDE-47 and its two natural analogs, 6-OH-BDE-47 and 6-MeO-BDE-47, can elicit a number of adverse effects in aquaticorganisms including disruption of the endocrine system,21,22

disruption of molting,23 developmental defects,20,24−26 andneurobehavioral toxicity.27−29 OH- and MeO-BDEs have beenshown to exhibit greater toxic potencies than PBDEs for certainend-points such as estrogenicity and androgenicity.21,30

However, mechanisms of their toxicity are complex and havenot been fully resolved.31 PBDEs, as well as OH- and MeO-BDEs, are structural analogs to thyroid hormones, T3 and T4, aswell as dioxin-like chemicals such as polychlorinated biphenyls(PCBs), dioxins (TCDD), and furans (PCDF).31 This raisesthe question of whether the adverse biological outcomesresulting from exposure to PBDEs and OH- or MeO-BDEs aredue to their ability to simulate thyroid hormones or whetherthey elicit effects similar to those of the above dioxin-likechemicals.Nuclear receptors (NRs) are a superfamily of ligand-

activated, transcription factors that act globally to regulate abroad range of biological processes, including development,reproduction, and metabolism.32,33 NRs mediate signaling byligands such as endogenous hormones, lipids, and xeno-biotics.34,35 Upon binding of a ligand to the ligand bindingdomain of several kinds of NRs, a complex array of cellularresponses is initiated. Recently, several in vivo and in vitrostudies have investigated effects of BDE-47, 6-OH-BDE-47, or6-MeO-BDE-47 on certain NR mediated physiological path-ways, in particular the pathways involving the thyroid hormonereceptor (TR), estrogen receptor (ER), androgen receptor(AR), and aryl hydrocarbon receptor (AhR). For example, inadult fathead minnows (Pimephales promelas), dietary exposureto BDE-47 induced transcription of TRα in the brain offemales, and decreased the transcription of TRβ in the brain offish of both sexes.41 In porcine ovarian follicles, both BDE-47and 6-OH-BDE-47 did not alter expression of AR mRNA orassociated protein, but decreased expression of ERβ mRNA andprotein following exposure to BDE-47 and increase both ERαand ERβ gene and protein expression following exposure to 6-OH-BDE-47.42 In an AhR-responsive luciferase reporter assay,6-OH-BDE-47 exhibited greater potency to induce AhR activitythan that of 6-MeO-PBDEs and BDE-47.43 However, so far,most NR studies of BDE-47, 6-OH-BDE-47, and 6-MeO-BDE-47 were completed by use of mammalian or cellular assays.The zebrafish represents an excellent vertebrate model

organism in environmental toxicology studies,44−46 especiallyin context with investigating effects of endocrine disruptingchemicals (EDCs) on reproductive and developmentalsystems.47−49 Moreover, developmental profiling of zebrafishgene expression patterns has confirmed a high degree ofconservation in NR expression patterns between zebrafish andother vertebrate models.50 Therefore, in the present study,

zebrafish embryos and larvae were used to determine the time-course of accumulation, biotransformation, and bioconcentra-tion factors (BCFs) of BDE-47, 6-OH-BDE-47, and 6-MeO-BDE-47. Additionally, in order to gain a more comprehensiveunderstanding of the molecular mechanisms of the toxicity ofBDE-47 and related OH- and MeO-analogs on the endocrinesystem, their effects on expression of genes associated witheight nuclear hormone receptor pathways, particularly ER, AR,AhR, TRα, peroxisome proliferator-activated receptor alpha(PPARα), glucocorticoid receptor (GR), mineralocorticoidreceptor (MR), and pregnane x receptor (PxR), wereinvestigated and compared.

■ MATERIALS AND METHODSMaterials and Reagents. BDE-47 (98% purity) was

purchased from Chem Service (West Chester, PA, USA). 6-MeO-BDE-47 and 6-OH-BDE-47 were synthesized at CityUniversity of Hong Kong, and purities were more than 98% asdescribed previously.51 13C-PCB-178, 13C-2′-OH-BDE-99, and13C-BDE-139 were purchased from Cambridge IsotopeLaboratories (Andover, MA, USA). BDE-47, 6-OH-BDE-47,and 6-MeO-BDE-47 were dissolved in dimethyl sulfoxide(DMSO, Generay Biotech, Shanghai, China) to prepare stocksolutions and then diluted with embryonic rearing water (60mg/L instant ocean salt in aerated distilled water) to thedesired test concentrations. Concentration of DMSO in finaltest solutions did not exceed 0.1%. RNAlater, RNAStabilization Reagents, and RNeasy Mini Kit were purchasedfrom QIAGEN (Hilden, Germany). Maxima First StrandcDNA Synthesis Kits were purchased from Fermentas (StLeon-Rot, Germany). SYBR Real time PCR Master Mix PlusKits were purchased from Toyobo (Tokyo, Japan).

Animals and Exposure Experiment. Adult (7 monthsold) AB strain zebrafish maintenance and culturing wereperformed as previously described.20 The eggs were examinedunder a stereomicroscope and only normally developedembryos were used for exposure experiments. Briefly, 20embryos were randomly distributed into a 25 mL glass beakercontaining 20 mL of exposure solution. Fish were exposed until120 h post fertilization (hpf), by which time they haddeveloped into free-swimming larvae and most organs hadcompleted development.52 The control group received 0.1%DMSO (v/v) only. 100% of the exposure solutions werereplaced by fresh exposure solution every 48 h. For 6-OH-BDE-47, BDE-47, and 6-MeO-BDE-47 exposures, the experimentsincluded two parts: First, zebrafish embryos were exposed to 6-OH-BDE-47 (0, 0.008, 0.02, 0.05, 0.1, 0.5 μM), 6-MeO-BDE-47 (0, 0.02, 0.1, 0.5, 2.5 μM), and BDE-47 (0, 0.02, 0.1, 0.5, 2.5μM) from 4 to 120 hpf to study the morphologic toxicity ofcompounds as previously described.20 Second, on the basis ofthe results of acute toxicity test, three comparable exposureconcentrations for each compound were chosen: 6-OH-BDE-47 at 0.008, 0.02, and 0.05 μM, and at 0.1, 0.5, and 2.5 μM forboth 6-MeO-BDE-47 and BDE-47 from 4 to 120 hpf to studythe effects on expression of 63 genes involved in eight receptor-mediated pathways by q-RT-PCR. After exposure for 120 hpf,larvae were anesthetized with ethyl 3-aminobenzoate meth-anesulfonate (MS-222, Suzhou Xin Yong Biological MedicineTechnology Co., Ltd., Jiangsu, China), and were preserved inRNAlater RNA Stabilization Reagents until total RNA isolation.

Bioavailability Analysis and QA/QC. This experimentwas designed to analyze bioaccumulation of the three chemicalsin early life-stages of zebrafish. In each treatment, 600 zebrafish

Environmental Science & Technology Article

DOI: 10.1021/es503833qEnviron. Sci. Technol. 2015, 49, 1823−1833

1824

http://dx.doi.org/10.1021/es503833q

embryos were exposed to 6-OH-BDE-47, 6-MeO-BDE-47, orBDE-47 at 300 μg/L (0.6, 0.58, and 0.62 μM, respectively)from 4 to 120 hpf in glass beakers. Variation amongconcentrations of the three compounds in both the exposuremedium and the embryos/larvae was determined. 80 embryos/larvae and corresponding exposure solutions were collected at12, 24, 48, 72, 96, and 120 hpf. Detailed protocols forextraction, clean up, and quantification, and quality assuranceand quality control (QA/QC) are provided in previousstudies20,53,54 and the Supporting Information, Methods andTable S1.Quantitative RT-PCR. Total RNA was isolated from

zebrafish larvae using RNeasy Mini Kit. The concentrationand quality of total RNA were determined in accordance withthe procedures described in a previous study.45 First-strandcDNA synthesis and quantitative RT-PCR were performedusing Maxima First Strand cDNA Synthesis and SYBR RealtimePCR Master Mix Plus Kits.20 Quantitative RT-PCR wasperformed by an Applied Biosystems Stepone Plus Real-timePCR System (Foster City, California, USA). The primers wereeither mined from previous literature55 or designed usingPrimer 3 (http://bioinfo.ut.ee/primer3-0.4.0/). Primer sequen-ces are listed in the Supporting Information, Table S2. Thehousekeeping gene 18S small subunit rRNA (18S rRNA) wasused as an internal control.56 The thermal cycle was set at 95°C for 2 min, followed by 40 cycles of 95 °C for 15 s and 60 °Cfor 1 min. Melting curves were derived during RT-PCR tovalidate that all cDNA samples amplified only a single product.Levels of expression of genes were normalized to 18S rRNAmRNA contents using the 2−ΔΔCt method. Each concentrationwas measured in triplicate or quadruplicate in a compositesample containing 20 larvae.Nuclear Receptor Pathway Analysis. For genes relating

to AhR and ER pathways, the Agilent Literature Searchapplication was used to construct a biological interactionnetwork within the Cytoscape software v3.1.1 (Cytoscapeconsortium, San Diego, CA, USA).57−59 The gene networks ofthe other six NR pathways were retrieved by either WikiPath-ways (http://www.wikipathways.org)60 or SABioscience GeneNetwork Central (http://www.sabiosciences .com/genenetwork/genenetworkcentral.php), and integrated withAhR and ER pathways as “associations” and visualized as onenetwork by Cytoscape. Only genes of interest were shown inthis pathway network. The resulting network genes (nodes)were colored by the Enhanced Graphics application withinCytoscape according to the significant fold changes of geneexpressions in the respective treatments.Statistical Analysis. SPSS 12.0 (SPSS Inc., Chicago, IL,

USA) was used for statistical analysis. A Kolmogorov−Smirnovtest was used to verify the normality of the data, and thehomogeneity of variances was analyzed by Levene’s test aspreviously described.20 If the data failed the Kolmogorov−Smirnov test, logarithmic transformation was performed anddata was checked again for homogeneity of variances. A one-way analysis of variance (ANOVA) followed by LSD test wasused to evaluate differences between the control and exposuregroups. A value of p < 0.05 was considered statisticallysignificant. To capture the likely nonlinearity in concentrationsin exposure water or in zebrafish embryos−larvae acrossdifferent time-points, generalized additive models (GAMs)were used by the “mgcv” package in R software version 3.10 (RCore Team, Vienna, Austria). Hierarchical cluster analysis forthe gene expression was performed by the “complete” method

in R. A heatmap of gene expression results was implemented by“pheatmap” package version 0.7.7 in R.

■ RESULTSMorphologic Effects of 6-OH-BDE-47, 6-MeO-BDE-47

and BDE-47. Among the three compounds, 6-OH-BDE-47was the most potent to zebrafish embryos/larvae (SupportingInformation, Figure S1B,C,D,F and Table S3). Exposure to allconcentrations caused delayed development of embryos for upto 6−8 at 24 hpf. In embryos exposed to 0.5 μM 6-OH-BDE-47, mortality significantly increased to 22.5 ± 4.1%, at 48 hpf.At 48 hpf, in groups exposed to concentrations greater than 0.1μM, the embryos developed hypopigmentation. At 72 hpf,development was arrested in all embryos exposed to 0.5 μM 6-OH-BDE-47 (Supporting Information, Figure S1B,C) whereasdevelopment of embryos at 12−18 hpf was not altered. Larvaeexposed to 0.1 μM 6-OH-BDE-47 exhibited spinal curvatures(Supporting Information, Figure S1D), decreased heartbeats,and reduced body lengths (3516 ± 250 μm in 0.1 μM groupand 4040 ± 55 μm in control). The LC50 values of 6-OH-BDE-47 for teratogenic effects were 0.28 μM (0.21−0.38) at 72 hpf,0.13 μM (0.11−0.16) at 96 hpf, and 0.09 μM (0.04−0.10) at120 hpf. The most sensitive toxicological end-point was spinalcurvature (Supporting Information, Figure S1F), which wasmanifested in a concentration-dependent manner with maximaleffects resulting from exposure to 0.08 μM (0.07−0.09) 6-OH-BDE-47 at 120 hpf.There were no significant differences in developmental

alterations in individuals exposed to 6-MeO-BDE-47 and thecontrol group until 96 hpf. The most sensitive toxicologicalend-points were concomitant spinal curvature and pericardialedema at 120 hpf at 2.5 μM (Supporting Information, FigureS1G). Although no statistically significant differences wereobserved within 96 hpf following exposure to BDE-47 up to 2.5μM, concomitant spinal curvature and pericardial edemaoccurred in embryos at 120 hpf. The NOEC of spinal curvatureand pericardial edema was 0.5 μM of BDE-47, although therewere significant differences at 2.5 μM and the proportion ofaffected larvae was 27.6 ± 18.3% (Supporting Information,Figure S1H). In addition, at 120 hpf following exposure to 2.5μM BDE-47, the body lengths of larvae (3751 ± 152 μm) weresignificantly reduced compared to those in the control group(4029 ± 201 μm).

Accumulation by Zebrafish. Concentrations of BDE-47,6-OH-BDE-47, or 6-MeO-BDE-47 were below their analyticalmethod detection limits in the control group (SupportingInformation Table S4). At 120 hpf, 100% mortality occurredfollowing exposure to 300 μg/L 6-OH-BDE-47; therefore, nodata is available for this time-point. gas chromatography−massspectrometry (GC/MS) results indicated that the chemicalconcentrations in exposure solutions decreased and the doses inembryos and larvae increased in a time-dependent manner(Figure 1). Moreover, the concentrations of BDE-47 and 6-MeO-BDE-47 were approximately 10- to 100-fold greater thanconcentrations of 6-OH-BDE-47 in zebrafish embryos andlarvae that were exposed to the same concentrations of thethree compounds (Figure 1). The three BDE congeners rankedas follows regarding their in vivo accumulation (values fromgreater to lesser potential): 6-MeO-BDE-47 > BDE-47 > 6-OH-BDE-47.Calculated BCF values for 6-OH-BDE-47 were 4.07, 9.88,

21.7, 26.9, and 23.3 at 12, 24, 48, 72, and 96 hpf, respectively(Figure 2A). For 6-MeO-BDE-47, the BCF values were 17.2,



1825

http://bioinfo.ut.ee/primer3-0.4.0/http://www.wikipathways.orghttp://www.sabiosciences.com/genenetwork/genenetworkcentral.phphttp://www.sabiosciences.com/genenetwork/genenetworkcentral.phphttp://dx.doi.org/10.1021/es503833q

42.6, 89.7, 390, 1207, and 935 at 12, 24, 48, 72, 96, and 120 hpf,respectively. For BDE-47, bioconcentration factor (BCF)values were 25.7, 68.0, 489, 750, 2489, and 2430 at 12, 24,48, 72, 96, and 120 hpf, respectively. These results indicatedthat trends of BCF values after various durations of exposurewere similar for 6-MeO-BDE-47 and BDE-47, reaching amaximum at 96 hpf, and showing a slight decrease at later time-points.Biotransformation in Zebrafish. Exposure of zebrafish to

300 μg/L 6-MeO-BDE-47 resulted in increasing tissueconcentrations of 6-OH-BDE-47 in their tissues were quantifiedin a time-dependent manner, with 0.02, 0.11, 0.12, and 0.25 μg/g, wm (wet mass) at 48, 72, 96, and 120 hpf, respectively(Figure 2B). However, no transformation of BDE-47 into 6-OH-BDE-47 or 6-MeO-BDE occurred. Also, 6-OH-BDE-47was not transformed into either BDE-47 or 6-MeO- BDE-47.Based on these transformation ratios, the amounts of

biotransformed 6-OH-BDE-47 were expected to be 0.04,0.21, and 1.07 μg/g, wm after 120 hpf exposure to 0.1, 0.5,or 2.5 μM 6-MeO-BDE-47, respectively (Table 1). Amounts ofbiotransformed 6-OH-BDE-47 in larvae exposed to 0.5 and 2.5μM of 6-MeO-BDE-47 were greater than the accumulated

concentration of 6-OH-BDE-47 (0.21 and 1.07 μg/g, wm vs0.15 μg/g, wm) in larvae exposed to 0.05 μM of 6-OH-BDE-47(Table 1).

Transcriptional Responses of NR Pathways to 6-OH-BDE-47. A hierarchical cluster analysis of gene expression datashowed a dendrogram that highlighted five principal clusters(Figure 3A). Exposures to 2.5 μM 6-MeO-BDE-47 resulted in aunique clustering of gene expression data that revealed asignificantly different gene expression profile from the otherexposures (Figure 3A). Exposures to the same compound butat different concentrations generally clustered in the samegroup, especially for exposures to 0.008, 0.1, and 0.5 μM 6-OH-BDE-47 (Figure 3A).Zebrafish embryos exposed to 6-OH-BDE-47 had significant

alterations in the expression of genes associated with severalNR pathways. The most significant effects occurred along theAhR pathway (Figures 3 and 4 and the Supporting Information,Table S5) with exposure to 0.008 μM 6-OH-BDE-47 causing asignificant up-regulation in the expression of ahr1a, ahr1b, ahr2,and arnt2 by 2.32-, 1.71-, 1.62-, and 1.62-fold, respectively (p <0.05), and a significant down-regulation of ahrra and cyp19bexpression by 2.27- and 1.81-fold, respectively (p < 0.05).Exposure to 0.02 μM 6-OH-BDE-47 significantly inducedexpression of ahr1b and ahr2 by 1.63- and 1.67-fold,respectively, and reduced the expression of ahrra and cyp1a1by 1.96- and 1.75-fold (p < 0.05). Exposure to 0.05 μM 6-OH-BDE-47 significantly reduced the expression of cyp1a1, cyp1b1,arnt1la, ahrra, and cyp19b by 1.92-, 2.63-, 1.25-, 1.96-, and 2.23-fold, respectively (p < 0.05). In addition to the ahr receptor,following exposure to 0.008 and 0.05 μM 6-OH-BDE-47, theexpression of mr and er2b were significantly up-regulated by1.51- and 1.83-fold, respectively (p < 0.05).

Transcriptional Responses of NR Pathways to 6-MeO-BDE-47. Some NR-mediated pathways such as AhR, ER, AR,TR, and GR were affected by exposure to 6-MeO-BDE-47, withthe greatest effects occurring at the greatest concentrationtested, 2.5 μM (Figures 3 and 4). Exposure to lesserconcentrations of 6-MeO-BDE-47, 0.1 μM, also induced theexpression of several genes in these pathways. Specifically,arnt2, dut, ugtlal, ctnnb1, pa2g4a, dap3, and rela weresignificantly induced by 2.08-, 1.67-, 2.23-, 1.56-, 1.78-, and1.51-fold, respectively (p < 0.05). Exposure to 0.5 μM 6-MeO-BDE-47 did not significantly alter the expressions of mostgenes, except for the down-regulation cyp1a1 and er2a by 9.09-and 1.56-fold, respectively (p < 0.05). However, exposure to agreater concentration of 6-MeO-BDE-47, 2.5 μM, reduced theexpression of most altered genes. Along the AhR pathway, ahr2was down-regulated by 1.92-fold and associated genes such ascyp1a1, cyp1b1, cyp365a, and sp1 were also down-regulated by50-, 100-, 3.03-, and 1.89-fold, respectively (p < 0.05).However, both ahrra and ahrrb were significantly induced by3.16- and 5.71-fold, respectively (p < 0.05). In the ER pathway,er2a and ccnd1 were down-regulated by 1.43- and 1.85-fold,respectively, whereas er2b was up-regulated by 1.44-foldfollowing exposure to 2.5 μM 6-MeO-BDE-47 (p < 0.05). Inthe AR pathway, ar, ctnnb1, pa2g4b, and ncoa1 were down-regulated by 1.85-, 1.89-, 1.47-, and 1.67-fold, respectively (p <0.05). Exposure to 2.5 μM 6-MeO-BDE-47 also decreased theexpression of thra by 2.17-fold and TR associated genes such asncor and fus were significantly down-regulated by 2.08- and1.85-fold (p < 0.05). Also, following exposure to 2.5 μM 6-MeO-BDE-47, the expression of gr and tgfb1 were down-regulated by 2.04- and 1.72-fold, respectively (p < 0.05).

Figure 1. Measured concentrations in exposure medium (μg/L) andin zebrafish embryos−larvae (mg/g, wm) after exposure to 300 μg/Lof BDE-47 (0.62 μM), 6-MeO-BDE-47 (0.58 μM), or 6-OH-BDE-47(0.6 μM) across time-points (hpf). Generalized additive model(GAM) plots between concentrations (after log transformation) inexposure water or in zebrafish embryos−larvae and time (hpf) aregiven. Shaded areas are the 95% confidence intervals for each GAM.The F-statistics, p-values, and adjusted R2 for the specific GAMs aregiven in each plot, whereas D shows the deviance explained.



1826


Transcriptional Responses of NR Pathways to BDE-47.Exposure to BDE-47 significantly affected the expression ofreceptors in the AhR, ER, and GR pathways (Figures 3 and 4).The number of altered genes increased in a concentrationdependent manner. The expression of gr was significantlydown-regulated by 1.28-fold following exposure to 0.5 μMBDE-47 (p < 0.05). When exposed to 2.5 μM, expressions ofahr1b, er2a, and er2b were significantly greater by 1.64-, 1.35-,and 1.40-fold, respectively (p < 0.05) than those of therespective genes controls. Expressions of genes along AhR andER pathways, such as cyp1a1, cyp19a, cyp3a65, and ccnd1, weresignificantly less by factors of 5.88-, 2.88-, 2.04-, and 1.52-fold,respectively, relative to that of the controls (p < 0.05).

■ DISCUSSIONHazard assessment of contaminants is typically based on theexposure of aquatic organisms to chemical solutions for adefined exposure time and the adverse outcomes observed are

then correlated with the concentrations of the compounds inthe ambient media. Because chemicals need to be accumulatedinto organisms and distributed to target sites for the inductionof toxic effects, usage of target site effect concentrations arepostulated to best represent the hazards of a compound invivo.61,62 However, for small-bodied organisms such as thezebrafish, effect concentrations at the target site are difficult todetermine, particularly at earlier stages of development. Averagebody concentrations of contaminants in zebrafish embryos andlarvae are subject to competitive dynamic processes, whichinclude the ability of compounds to penetrate the chorion, invivo biotransformation, distribution, and excretion. Hence,internal effect concentrations need to be determined. More-over, the ratio of the internal concentration in a fish to thesurrounding concentration at a steady state represents thecompound’s BCF, which is an important metric for regulatoryassessment of chemicals.63

Figure 2. (A) Bioconcentration factors (BCF) calculated after exposure to 300 μg/L of BDE-47 (0.62 μM), 6-MeO-BDE-47 (0.58 μM), and 6-OH-BDE-47 (0.6 μM) across time-points (hpf). BCF was calculated based on the ratio of measured concentrations in zebrafish embryos−larvae (μg/kg,wm) and measured concentrations in exposure medium (μg/L) at a specific time (hpf). (B) Measured concentrations of biotransformed 6-OH-BDE-47 in zebrafish embryos−larvae (μg/g, wm) after exposure to 300 μg 6-MeO-BDE-47/L (0.58 μM) across several time-points (hpf). A linearregression between concentrations in zebrafish embryos−larvae and time (hpf) is given (R2 = 0.911; p < 0.05).

Table 1. Estimated Internal Doses of BDE-47, 6-OH-BDE-47, and 6-MeO-BDE-47 Exposures in Zebrafish Larvae at 120 hpfa

chemical BDE-47 6-MeO-BDE-47 6-OH-BDE-47

nominal concentration (μM) 0.1 0.5 2.5 0.1 0.5 2.5 0.008 0.02 0.05BDE-47 (μg/g) 9.05 45.27 226.336-MeO-BDE-47 (μg/g) 18.17 90.87 454.376-OH-BDE-47 (μg/g) 0.024 0.061 0.15biotransformed 6-OH-BDE-47 (μg/g) 0.04 0.21 1.07

aThe calculation of internal dose for each compound was based on the ratio of the exposure concentration at 300 μg/L and the measuredconcentration in larvae at 120 hpf.



1827


In the present study, accumulation, biotransformation, variedamong BCF of BDE-47, 6-OH-BDE-47, and 6-MeO-BDE-47during multiple developmental stages of zebrafish. The time-points during which accumulation of BDE-47 and 6-MeO-BDE-47 increased substantially coincide with the hatchingperiod of zebrafish embryos (48 hpf). In the late developmentalperiods of the larvae (after 96 hpf), the bioaccumulation ofBDE-47 and 6-MeO-BDE-47 reached a plateau, which might bedue to an increase in metabolism and/or excretion activities aswell as the rapid growth of larvae at this time that might dilutetheir body concentrations over this time period. In this study,the BCF of 6-OH-BDE-47 at 96 hpf was 23.3, which is similarto previously reported results,64 in which BCF values werecalculated in liver of zebrafish after 96 h exposure to 100 nM 6-OH-BDE-47. At all six durations of exposure, 6-OH-BDE-47was the least accumulated into the body, though it had thegreatest toxic potency. It is known that a compound withgreater log Kow generally has greater bioaccumulation potential.Values of log Kow were 6.76, 7.17, and 6.59 for BDE-47, 6-MeO-BDE-47, and 6-OH-BDE-47, respectively.65 Thus, differ-

ences in lipophilicity were considered to be the most importantparameters for the different accumulation properties of the testchemicals. For compounds such as 6-OH-BDE-47, the hydroxylgroup by making the compound more polar, result in greaterexcretion, and might also be an important parameter for thelesser in vivo concentration. Hence, our results confirmed thatin aquatic exposure tests, it is not sufficient to evaluate theecotoxicological risk of a compound based solely on theexposure concentration. In addition to accumulation in thebody, the results of this study indicated that the amounts of 6-MeO-BDE-47, but not BDE-47, that were transformed to 6-OH-BDE-47 increased in a time-dependent manner, (approx-imately 0.01%, 0.04%, and 0.08% at 48, 96, and 120 hpf,respectively), which is indicative of an increasing metaboliccapability of zebrafish embryos/larvae with increasing age.Photomicrographs demonstrated that exposures to 6-OH-

BDE-47, 6-MeO-BDE-47, and BDE-47 resulted in devel-opmental abnormalities in zebrafish embryos and larvae. Theembryo-toxic effects of BDE47, 6-OH-BDE47 and 6-MeO-BDE47 have been investigated in a previous study with

Figure 3. Dendrogram displaying similarities of chemicals and doses based on effects on genes in nuclear receptor pathways for BDE-47, 6-MeO-BDE-47, and 6-OH-BDE-47 in zebrafish larvae at 120 hpf. (A) The dendrogram of hierarchical cluster analysis was calculated using the average geneexpression values (63 genes in total) of the three or four biological replicates per exposure. Samples names are composed by the name of exposurecompound followed by the exposure concentration (μM). Different colors in the dendrogram denoted five clustering groups. (B) The heatmap ofgene expression profiles was generated using the average gene expression values of the three or four biological replicates per exposure. The fold-changes of gene expression are given in the respective cells and genes involved in different receptor pathways are given different colors (see legend).



1828


zebrafish embryos exposed from 3 to 72 hpf.64 Those authorsshowed that 6-OH-BDE-47 was the most toxic BDE-47congener, inducing a range of developmental defects includingpericardial edema, yolk sac deformations, lesser pigmentation,lessened heart rate, and delayed development at concentrationsof 25−50 nM, which is consistent with the morphology findings

of this study (Supporting Information, Figure S1B,C,D).64

Furthermore, the lack of toxic effects of BDE47 or 6-MeO-BDE47 at 2.5 μM until 120 hpf (Supporting Information,Figure S1G,H) is consistent with previous findings that showedthat no toxicity was observed for both BDE47 and 6-MeO-BDE47 in zebarfish at 72 hpf.64

Because disruptions of cellular molecules or processes arethought to precede adverse outcomes, changes to normalmolecular processes might function as sensitive biomarkers topredict adverse biological outcomes.66 Moreover, alteration ofNR mediated pathways has been shown to be associated withadverse endocrine and developmental effects that were linkedwith morphological deformities.20,55 For example, previousstudies have demonstrated that BDE-47 can alter thyroid statusand thyroid hormone-regulated gene transcription in thepituitary and brain of adult fathead minnows,67 and both 6-OH-BDE-47 and 6-MeO-BDE-47 were shown to affectexpression of TRα and TRβ genes in the TR pathway, whichcan result in teratogenic effects such as pericardial edema,developmental retardation, and curved spine in zebrafishembryos.20 Also, all BDE-47, TBBPA and BPA have beendemonstrated to alter expression of genes along thehypothalamus-pituitary-thyroid (HPT) axis of zebrafish larvaeas well as induce acute toxicity.68 Additionally, zebrafish hasbeen used to investigate effects of EDCs on the expression ofgenes in six NR mediated pathways.55 In this study, twoadditional receptor pathways-AR and PxR were added, and theinteractions of sixty-three genes involved in eight zebrafishreceptor pathways were integrated. This pathway networkmight represent a novel tool for the examination of themolecular function of each individual receptor as well as for thestudy of their combinatorial regulatory network within NRs.The structures of the three compounds tested are similar.

The cluster dendrogram showed that expression of genes inindividuals exposed to various concentrations of 6-OH-BDE-47clustered together. Nevertheless, clustering is a function ofconcentration for 6-MeO-BDE-47 and BDE-47. Patterns ofexpression of genes following exposures to 2.5 μM BDE-47 and0.5 μM 6-MeO-BDE-47 were grouped into the same cluster,which indicates BDE-47 likely has fewer effects on zebrafishNR-mediated pathways than 6-MeO-BDE-47 at similar water-borne exposure concentrations. Exposure to 2.5 μM of themore bioaccumulative 6-MeO-BDE-47 resulted in a uniquegene expression profile compared to BDE-47 and 6-OH-BDE-47. In addition, 1.07 μg/g, wm of biotransformed 6-OH-BDE-47 were detected in larvae exposed to 2.5 μM of 6-MeO-BDE-47, which was much greater than the detected amount of 6-OH-BDE-47, 0.15 μg/g, which resulted from exposure to 0.05μM 6-OH-BDE-47. The greater body burden of 6-OH-BDE-47resulting from exposure to 2.5 μM 6-MeO-BDE-47 mightexplain the significant and great effect on gene transcription ofNR pathways observed in this exposure group. The effects thatoccurred in the greatest exposure group of 6-MeO-BDE-47,therefore, were attributed to the combined effects ofbiotransformed 6-OH-BDE-47 as well as 6-MeO-BDE-47.The clustering of the three compounds correlated well withtheir respective accumulation potency, indicating the greatimportance of the usage of internal dose to assess the dose−response relationship for studies of PBDEs, especially MeO-PBDEs.Further analyses of endocrine pathways indicated general

disruption of receptor pathways by all three BDEs congeners,which correlated well with the observed teratogenic effects in

Figure 4. Interaction network of selected genes in nuclear steroidreceptor pathways of zebrafish. Nodes represent single genes, edgeseither protein−protein or protein−DNA interactions. Statisticallysignificant changes (p < 0.05) in gene expression following differentconcentrations of treatment of BDE-47, 6-MeO-BDE-47, and 6-OH-BDE-47 at 120 hpf are given in the respective boxes (see legend).



1829


zebrafish. Specifically, 6-OH-BDE-47 altered the expression ofAhR, ER, and MR receptor-mediated pathways, whereas AhR,ER, and GR were the primary pathways altered by BDE-47. Yet,exposure to the more bioaccumulative 6-MeO-BDE-47 affectedAhR, ER, AR, GR, and TRα pathways. Molecular structures ofOH-BDEs closely resemble those of thyroid hormones (THs)and 6-OH-BDE-47 can disrupt normal thyroid homeostasis andfunctions as either an agonist or an antagonist.31,69 Forexample, expression of genes along the hypothalamus-pituitary-thyroid (HPT) axis that is responsible for regulationof metabolism and early life-stage development was affected byBDE-47 and its OH- or MeO- forms in zebrafish embryos−larvae.20,68 However, in the present experiment, expression ofthra was not significantly altered following exposure to 6-OH-BDE-47, which contradicted previous findings showing thrawas reduced in zebrafish exposed to 200 μg/L 6-OH-BDE-47.20

This difference might be due to the almost 10 times greaterconcentrations used in the previous study. However, exposureto 2.5 μM 6-MeO-BDE-47 significantly decreased theexpression of thra, nocr, and fus in TRα pathway. Becausesignificant quantities of biotransformed 6-OH-BDE-47 werefound in vivo, 6-MeO-BDE-47 may exert adverse effectsindirectly via transformation into 6-OH-BDE-47, which thencan bind directly to TH targeted genes by mimicking THs.Apart from the TRα pathway, recent studies have also

focused on disruption of the AhR and ER pathways by PBDEs.Cross talk between ER- and AhR-signaling pathways in fish hasbeen hypothesized previously.72,73 The pathway analysesconducted in this study also suggest interactions betweenthese pathways as visualized in the constructed networks. Allthree compounds altered AhR and ER pathways in zebrafish. 6-OH-BDE-47 significantly increased expression of er2b inzebrafish, which is consistent with previous in vitro findingsthat both ERα and ERβ gene and protein expression wereinduced by 6-OH-BDE-47.42 Exposure to 2.5 μM 6-MeO-BDE-47 significantly reduced expression of er2a but induced er2bindicating the compound might cause endocrine disruptingeffects through interfering with the ER signaling pathway.21 Inaddition, 6-OH-BDE-47 increased the expression of severalAhR receptors including ahr1a, ahr1b, and ahr2 in vivo, while 6-MeO-BDE-47 and BDE-47 only affected ahr2 and ahr1atranscription, respectively. These results have confirmed thatOH-BDEs can induce greater dioxin-like activity thancorresponding MeO-BDEs and parent PBDEs in vitro.43,74

AR and PxR pathways have been previously shown to beaffected by PBDEs in vitro.21,75−77 In the MDA-kb2 human cellline AR receptor binding assay, all three compounds exhibitedpotent antiandrogenicity, with potencies ranking as follows: 6-OH-BDE-47 (IC50 = 0.34 μM) > BDE47 (IC50 = 3.83 μM) >6-MeO-BDE-47 (IC50 = 41.8 μM).

21,76 However, in zebrafish,both BDE-47 and 6-OH-BDE-47 did not significantly alter ARexpression, which is consistent with a study in porcine ovarianfollicular cells, showing BDE-47 and its OH- metabolites hadno effect on the expression of AR mRNA and proteinexpression.42 The PxR, a steroid and xenobiotic nuclearreceptor (SXR), can be activated by BDE-47 in mice.75

Nevertheless, in zebrafish, BDE-47 significantly down-regulatedPxR associated genes of cyp3a65, hnf4a, and ugtlal, butincreased pou1f1. The incongruities between these resultscould be due to differences between species and lesserconcentrations used in our experiments. Furthermore, PxRassociated genes cyp24a1 and hnf4a were significantly up-

regulated by 6-OH-BDE-47 exposure, indicating 6-OH-BDE-47might be an agonist of zebrafish PxR.Reports on the effect of PBDEs on PPARα, MR, and GR are

limited. PPARα plays an important role in lipid homeostasis,inflammation, adipogenesis, reproduction, and carcinogenesis.78

In this study, none of three compounds significantly affectedthe expression of PPARα in zebrafish. However, treatment witha PBDE mixture, BDE-71 and BDE-47 caused increases inPPARγ transcript levels at day 8 in 3T3-L1 mouse embryofibroblast cells.79 GR and MR are essential for regulation ofmultiple physiological functions, such as glucose metabolism,mineral balance, and behavior.80 In this study, exposure to 2.5μM 6-MeO-BDE-47 or 0.5 μM BDE-47 caused down-regulation of GR, whereas 0.008 μM 6-OH-BDE-47 increasedMR expression, which suggests that GR or MR signalingpathways might be involved in the endocrine disrupting effectsinduced by PBDEs.Altogether, the results of present study, which compared the

toxicities of BDE-47 with its OH- and MeO- analogs inzebrafish via multiple quantitative approaches, ranging from invivo toxicity tests, bioaccumulation and biotransformation, tothe molecular analysis of response patterns of genes along NRpathways, highlight the importance of the usage of internal doseto evaluate the toxic effects for PBDEs, and the use of early life-stages of zebrafish as an efficient and reliable vertebrate modelto assess toxicological effects of endocrine disruptors. Our dataalso elucidated several molecular aspects of BDE-47, 6-OH-BDE-47, and 6-MeO-BDE-47 induced toxicities. Specifically,the data provided valuable insights into the early interaction ofthese compounds with steroid hormone receptor pathways,which provided novel clues for their in vivo mechanisms ofsubsequent endocrine disruption and developmental toxicities.

■ ASSOCIATED CONTENT*S Supporting InformationFurther details on the analytical methods and additional tablesand figures as noted in the text. This material is available free ofcharge via the Internet at http://pubs.acs.org/.

■ AUTHOR INFORMATIONCorresponding Authors*Dr. Hongling Liu. Tel: +86-25-89680356. Fax: +86-25-89680356. E-mail: [email protected].*Dr. Hongxia Yu. Tel: +86-25-89680356. Fax: +86-25-89680356. E-mail: [email protected] Contributions#These authors contributed equally to this work.NotesThe authors declare no competing financial interest.

■ ACKNOWLEDGMENTSWe thank Dr. Richard A. Erickson (Upper Midwest Environ-mental Sciences Center, U.S. Geological Survey) for providingthe expertise in statistical analyses. This work was funded byNational Natural Science Foundation (No. 21377053 and20977047) and Major National Science and TechnologyProjects (No. 2012ZX07506-001 and 2012ZX07501-003-02)of China. J.P.G. and M.H. were supported by the CanadaResearch Chair Program. J.P.G. was supported by the Programof 2012 “Great Level Foreign Experts” (#GDW20123200120)funded by the State Administration of Foreign Experts Affairs,China to Nanjing University, and the Einstein Professor



1830

http://pubs.acs.org/mailto:[email protected]:[email protected]://dx.doi.org/10.1021/es503833q

Program of the Chinese Academy of Sciences. He was alsosupported by a Visiting Distinguished Professorship in theDepartment of Biology and Chemistry and State KeyLaboratory in Marine Pollution at City University of HongKong.

■ REFERENCES(1) Birnbaum, L. S.; Staskal, D. F. Brominated flame retardants:Cause for concern? Environ. Health Perspect. 2004, 112 (1), 9−17.(2) Qu, W. Y.; Bi, X. H.; Sheng, G. Y.; Lu, S. Y.; Fu, H.; Yuan, J.; Li,L. P. Exposure to polybrominated diphenyl ethers among workers atan electronic waste dismantling region in Guangdong, China. Environ.Int. 2007, 33 (8), 1029−1034.(3) Chen, D.; Letcher, R. J.; Burgess, N. M.; Champoux, L.; Elliott, J.E.; Hebert, C. E.; Martin, P.; Wayland, M.; Chip Weseloh, D. V.;Wilson, L. Flame retardants in eggs of four gull species (Laridae) frombreeding sites spanning Atlantic to Pacific Canada. Environ. Pollut.2012, 168, 1−9.(4) Valters, K.; Li, H.; Alaee, M.; D’Sa, I.; Marsh, G.; Bergman, A.;Letcher, R. J. Polybrominated diphenyl ethers and hydroxylated andmethoxylated brominated and chlorinated analogues in the plasma offish from the Detroit River. Environ. Sci. Technol. 2005, 39 (15), 5612−5619.(5) Haraguchi, K.; Kotaki, Y.; Relox, J. R., Jr.; Romero, M. L.; Terada,R. Monitoring of naturally produced brominated phenoxyphenols andphenoxyanisoles in aquatic plants from the Philippines. J. Agric. FoodChem. 2010, 58 (23), 12385−12391.(6) Wiseman, S. B.; Wan, Y.; Chang, H.; Zhang, X. W.; Hecker, M.;Jones, P. D.; Giesy, J. P. Polybrominated diphenyl ethers and theirhydroxylated/methoxylated analogs: Environmental sources, metabolicrelationships, and relative toxicities. Mar. Pollut. Bull. 2011, 63 (5−12),179−188.(7) Rotander, A.; van Bavel, B.; Riget, F.; Auethunsson, G. A.; Polder,A.; Gabrielsen, G. W.; Vikingsson, G.; Mikkelsen, B.; Dam, M.Methoxylated polybrominated diphenyl ethers (MeO-PBDEs) aremajor contributors to the persistent organobromine load in sub-Arcticand Arctic marine mammals, 1986−2009. Sci. Total Environ. 2012,416, 482−489.(8) Yogui, G. T.; Sericano, J. L. Polybrominated diphenyl ether flameretardants in the U.S. marine environment: A review. Environ. Int.2009, 35 (3), 655−666.(9) Liu, X.; Jiao, Y.; Lin, C.; Sun, K.; Zhao, Y. PBDEs, hydroxylatedPBDEs and methoxylated PBDEs in bivalves from Beijing markets.Chemosphere 2014, 110, 97−103.(10) Sun, J.; Liu, J.; Liu, Y.; Jiang, G. Hydroxylated and methoxylatedpolybrominated diphenyl ethers in mollusks from Chinese coastalareas. Chemosphere 2013, 92 (3), 322−328.(11) Yin, G.; Asplund, L.; Qiu, Y.; Zhou, Y.; Wang, H.; Yao, Z.; Jiang,J.; Bergman, A. Chlorinated and brominated organic pollutants inshellfish from the Yellow Sea and East China SeaEnviron. Sci. Pollut.Res. Int. 2014, DOI: 10.1007/s11356-014-3198-8.(12) Wang, H. S.; Du, J.; Ho, K. L.; Leung, H. M.; Lam, M. H. W.;Giesy, J. P.; Wong, C. K. C.; Wong, M. H. Exposure of Hong Kongresidents to PBDEs and their structural analogues through market fishconsumption. J. Hazard. Mater. 2011, 192 (1), 374−380.(13) McKinney, M. A.; De Guise, S.; Martineau, D.; Beland, P.;Lebeuf, M.; Letcher, R. J. Organohalogen contaminants andmetabolites in beluga whale (Delphinapterus leucas) liver from twoCanadian populations. Environ. Toxicol. Chem. 2006, 25 (5), 1246−1257.(14) Malmvarn, A.; Marsh, G.; Kautsky, L.; Athanasiadou, M.;Bergman, A.; Asplund, L. Hydroxylated and methoxylated brominateddiphenyl ethers in the red algae Ceramium tenuicorne and blue musselsfrom the Baltic Sea. Environ. Sci. Technol. 2005, 39 (9), 2990−2997.(15) Bowden, B. F.; Towerzey, L.; Junk, P. C. A new brominateddiphenyl ether from the marine sponge Dysidea herbacea. Aust. J. Chem.2000, 53 (4), 299−301.

(16) Malmvarn, A.; Zebuhr, Y.; Kautsky, L.; Bergman, K.; Asplund, L.Hydroxylated and methoxylated polybrominated diphenyl ethers andpolybrominated dibenzo-p-dioxins in red alga and cyanobacteria livingin the Baltic Sea. Chemosphere 2008, 72 (6), 910−916.(17) Wan, Y.; Liu, F.; Wiseman, S.; Zhang, X.; Chang, H.; Hecker,M.; Jones, P. D.; Lam, M. H.; Giesy, J. P. Interconversion ofhydroxylated and methoxylated polybrominated diphenyl ethers inJapanese medaka. Environ. Sci. Technol. 2010, 44 (22), 8729−8735.(18) Wan, Y.; Wiseman, S.; Chang, H.; Zhang, X.; Jones, P. D.;Hecker, M.; Kannan, K.; Tanabe, S.; Hu, J.; Lam, M. H.; Giesy, J. P.Origin of hydroxylated brominated diphenyl ethers: Naturalcompounds or man-made flame retardants? Environ. Sci. Technol.2009, 43 (19), 7536−7542.(19) Liu, F.; Wiseman, S.; Wan, Y.; Doering, J. A.; Hecker, M.; Lam,M. H.; Giesy, J. P. Multi-species comparison of the mechanism ofbiotransformation of MeO-BDEs to OH-BDEs in fish. Aquat. Toxicol.2012, 114−115, 182−188.(20) Zheng, X.; Zhu, Y.; Liu, C.; Liu, H.; Giesy, J. P.; Hecker, M.;Lam, M. H.; Yu, H. Accumulation and biotransformation of BDE-47by zebrafish larvae and teratogenicity and expression of genes alongthe hypothalamus-pituitary-thyroid axis. Environ. Sci. Technol. 2012, 46(23), 12943−12951.(21) Hu, W.; Liu, H.; Sun, H.; Shen, O.; Wang, X.; Lam, M. H.;Giesy, J. P.; Zhang, X.; Yu, H. Endocrine effects of methoxylatedbrominated diphenyl ethers in three in vitro models. Mar. Pollut. Bull.2011, 62 (11), 2356−2361.(22) Chan, W. K.; Chan, K. M. Disruption of the hypothalamic-pituitary-thyroid axis in zebrafish embryo-larvae following waterborneexposure to BDE-47, TBBPA and BPA. Aquat. Toxicol. 2012, 108,106−111.(23) Davies, R.; Zou, E. Polybrominated diphenyl ethers disruptmolting in neonatal Daphnia magna. Ecotoxicology 2012, 21 (5),1371−1380.(24) Dong, W.; Macaulay, L. J.; Kwok, K. W. H.; Hinton, D. E.;Stapleton, H. M. Using whole mount in situ hybridization to examinethyroid hormone deiodinase expression in embryonic and larvalzebrafish: A tool for examining OH-BDE toxicity to early life stages.Aquat. Toxicol. 2013, 132, 190−199.(25) Usenko, C. Y.; Hopkins, D. C.; Trumble, S. J.; Bruce, E. D.Hydroxylated PBDEs induce developmental arrest in zebrafish.Toxicol. Appl. Pharmacol. 2012, 262 (1), 43−51.(26) Kallqvist, T.; Grung, M.; Tollefsen, K. E. Chronic toxicity of2,4,2′,4′-tetrabromodiphenyl ether on the marine alga Skeletonemacostatum and the crustacean Daphnia magna. Environ. Toxicol. Chem.2006, 25 (6), 1657−1662.(27) Zhao, J.; Xu, T.; Yin, D. Q. Locomotor activity changes onzebrafish larvae with different 2,2′,4,4′-tetrabromodiphenyl ether(PBDE-47) embryonic exposure modes. Chemosphere 2014, 94, 53−61.(28) Chen, X.; Huang, C.; Wang, X.; Chen, J.; Bai, C.; Chen, Y.;Chen, X.; Dong, Q.; Yang, D. BDE-47 disrupts axonal growth andmotor behavior in developing zebrafish. Aquat. Toxicol. 2012, 120−121, 35−44.(29) Chou, C. T.; Hsiao, Y. C.; Ko, F. C.; Cheng, J. O.; Cheng, Y. M.;Chen, T. H. Chronic exposure of 2,2′,4,4′-tetrabromodiphenyl ether(PBDE-47) alters locomotion behavior in juvenile zebrafish (Daniorerio). Aquat. Toxicol. 2010, 98 (4), 388−395.(30) Hamers, T.; Kamstra, J. H.; Sonneveld, E.; Murk, A. J.; Visser, T.J.; Van Velzen, M. J.; Brouwer, A.; Bergman, A. Biotransformation ofbrominated flame retardants into potentially endocrine-disruptingmetabolites, with special attention to 2,2′,4,4′-tetrabromodiphenylether (BDE-47). Mol. Nutr. Food Res. 2008, 52 (2), 284−298.(31) Ren, X. M.; Guo, L. H. Molecular toxicology of polybrominateddiphenyl ethers: Nuclear hormone receptor mediated pathways.Environ. Sci. Process Impact. 2013, 15 (4), 702−708.(32) Castrillo, A.; Tontonoz, P. Nuclear receptors in macrophagebiology: At the crossroads of lipid metabolism and inflammation.Annu. Rev. Cell Dev. Biol. 2004, 20, 455−480.



1831


(33) Chinenov, Y.; Gupte, R.; Rogatsky, I. Nuclear receptors ininflammation control: Repression by GR and beyond. Mol. Cell.Endocrinol. 2013, 380 (1−2), 55−64.(34) Knoedler, J. R.; Denver, R. J. Kruppel-like factors are effectors ofnuclear receptor signaling. Gen. Comp. Endrocrinol. 2014, 203, 49−59.(35) Omiecinski, C. J.; Vanden Heuvel, J. P.; Perdew, G. H.; Peters, J.M. Xenobiotic metabolism, disposition, and regulation by receptors:From biochemical phenomenon to predictors of major toxicities.Toxicol. Sci. 2011, 120 (Suppl 1), S49−S75.(36) Aranda, A.; Pascual, A. Nuclear hormone receptors and geneexpression. Physiol. Rev. 2001, 81 (3), 1269−1304.(37) Jennings, P.; Limonciel, A.; Felice, L.; Leonard, M. O. Anoverview of transcriptional regulation in response to toxicologicalinsult. Arch. Toxicol. 2013, 87 (1), 49−72.(38) Jacobs, M. N.; Dickins, M.; Lewis, D. F. Homology modelling ofthe nuclear receptors: Human oestrogen receptorbeta (hERbeta), thehuman pregnane-X-receptor (PXR), the Ah receptor (AhR) and theconstitutive androstane receptor (CAR) ligand binding domains fromthe human oestrogen receptor alpha (hERalpha) crystal structure, andthe human peroxisome proliferator activated receptor alpha (PPAR-alpha) ligand binding domain from the human PPARgamma crystalstructure. J. Steroid Biochem. Mol. Biol. 2003, 84 (2−3), 117−132.(39) Prossnitz, E. R.; Arterburn, J. B.; Smith, H. O.; Oprea, T. I.;Sklar, L. A.; Hathaway, H. J. Estrogen signaling through thetransmembrane G protein-coupled receptor GrPR30. Annu. Rev.Physiol. 2008, 70, 165−190.(40) Norman, A. W.; Mizwicki, M. T.; Norman, D. P. Steroid-hormone rapid actions, membrane receptors and a conformationalensemble model. Nat. Rev. Drug Discovery 2004, 3 (1), 27−41.(41) Lema, S. C.; Dickey, J. T.; Schultz, I. R.; Swanson, P. DietaryExposure to 2,2′,4,4′-Tetrabromodiphenyl ether (PBDE-47) altersthyroid status and thyroid hormone-regulated gene transcription in thepituitary and brain. Environ. Health Perspect. 2008, 116 (12), 1694−1699.(42) Karpeta, A.; Ptak, A.; Gregoraszczuk, E. L. Different action of2,2′,4,4′-tetrabromodiphenyl ether (BDE-47) and its hydroxylatedmetabolites on ERalpha and ERbeta gene and protein expression.Toxicol. Lett. 2014, 229 (1), 250−256.(43) Su, G.; Xia, J.; Liu, H.; Lam, M. H.; Yu, H.; Giesy, J. P.; Zhang,X. Dioxin-like potency of HO- and MeO- analogues of PBDEs’ thepotential risk through consumption of fish from Eastern China.Environ. Sci. Technol. 2012, 46 (19), 10781−10788.(44) Stegeman, J. J.; Goldstone, J. V.; Hahn, M. E. Perspectives onzebrafish as a model in environmental toxicology. Fish Physiol. 2010,29, 367−439.(45) Tang, S.; Cai, Q.; Chibli, H.; Allagadda, V.; Nadeau, J. L.; Mayer,G. D. Cadmium sulfate and CdTe-quantum dots alter DNA repair inzebrafish (Danio rerio) liver cells. Toxicol. Appl. Pharmacol. 2013, 272(2), 443−452.(46) Dai, Y. J.; Jia, Y. F.; Chen, N.; Bian, W. P.; Li, Q. K.; Ma, Y. B.;Chen, Y. L.; Pei, D. S. Zebrafish as a model system to study toxicology.Environ. Toxicol. Chem. 2014, 33 (1), 11−17.(47) Baker, M. E.; Hardiman, G. Transcriptional analysis ofendocrine disruption using zebrafish and massively parallel sequencing.J. Mol. Endocrinol. 2014, 52 (3), R241−R256.(48) Scholz, S.; Fischer, S.; Gundel, U.; Kuster, E.; Luckenbach, T.;Voelker, D. The zebrafish embryo model in environmental riskassessmentApplications beyond acute toxicity testing. Environ. Sci.Pollut. Res. Int. 2008, 15 (5), 394−404.(49) Scholz, S.; Mayer, I. Molecular biomarkers of endocrinedisruption in small model fish. Mol. Cell. Endocrinol. 2008, 293 (1−2),57−70.(50) Bertrand, S.; Thisse, B.; Tavares, R.; Sachs, L.; Chaumot, A.;Bardet, P. L.; Escriva, H.; Duffraisse, M.; Marchand, O.; Safi, R.;Thisse, C.; Laudet, V. Unexpected novel relational links uncovered byextensive developmental profiling of nuclear receptor expression. PLoSGenet. 2007, 3 (11), 2085−2100.(51) Marsh, G.; Stenutz, R.; Bergman, A. Synthesis of hydroxylatedand methoxylated polybrominated diphenyl ethers - Natural products

and potential polybrominated diphenyl ether metabolites. Eur. J. Org.Chem. 2003, 14, 2566−2576.(52) Amsterdam, A.; Nissen, R. M.; Sun, Z.; Swindell, E. C.;Farrington, S.; Hopkins, N. Identification of 315 genes essential forearly zebrafish development. Proc. Natl. Acad. Sci. U. S. A. 2004, 101(35), 12792−12797.(53) Wen, Q.; Liu, H. L.; Zhu, Y. T.; Zheng, X. M.; Su, G. Y.; Zhang,X. W.; Yu, H. X.; Giesy, J. P.; Lam, M. H. Maternal transfer,distribution, and metabolism of BDE-47 and its related hydroxylated,methoxylated analogs in zebrafish (Danio rerio). Chemosphere 2014,120C, 31−36.(54) Wen, Q.; Liu, H. L.; Su, G. Y.; Wei, S.; Feng, J. F.; Yu, H. X.Determination of polybrominated diphenyl ethers and their derivatesin zebrafish eggs. Chin. J. Anal. Chem. 2012, 40 (11), 1698−1702.(55) Liu, C.; Wang, Q.; Liang, K.; Liu, J.; Zhou, B.; Zhang, X.; Liu,H.; Giesy, J. P.; Yu, H. Effects of tris(1,3-dichloro-2-propyl) phosphateand triphenyl phosphate on receptor-associated mRNA expression inzebrafish embryos/larvae. Aquat. Toxicol. 2013, 128−129, 147−157.(56) Tang, S.; Allagadda, V.; Chibli, H.; Nadeau, J. L.; Mayer, G. D.Comparison of cytotoxicity and expression of metal regulatory genesin zebrafish (Danio rerio) liver cells exposed to cadmium sulfate, zincsulfate and quantum dots. Metallomics 2013, 5 (10), 1411−1422.(57) Cline, M. S.; Smoot, M.; Cerami, E.; Kuchinsky, A.; Landys, N.;Workman, C.; Christmas, R.; Avila-Campilo, I.; Creech, M.; Gross, B.;Hanspers, K.; Isserlin, R.; Kelley, R.; Killcoyne, S.; Lotia, S.; Maere, S.;Morris, J.; Ono, K.; Pavlovic, V.; Pico, A. R.; Vailaya, A.; Wang, P.-L.;Adler, A.; Conklin, B. R.; Hood, L.; Kuiper, M.; Sander, C.;Schmulevich, I.; Schwikowski, B.; Warner, G. J.; Ideker, T.; Bader,G. D. Integration of biological networks and gene expression datausing Cytoscape. Nat. Protoc. 2007, 2 (10), 2366−2382.(58) Shannon, P.; Markiel, A.; Ozier, O.; Baliga, N. S.; Wang, J. T.;Ramage, D.; Amin, N.; Schwikowski, B.; Ideker, T. Cytoscape: Asoftware environment for integrated models of biomolecularinteraction networks. Genome Res. 2003, 13 (11), 2498−2504.(59) Saito, R.; Smoot, M. E.; Ono, K.; Ruscheinski, J.; Wang, P. L.;Lotia, S.; Pico, A. R.; Bader, G. D.; Ideker, T. A travel guide toCytoscape plugins. Nat. Methods 2012, 9 (11), 1069−1076.(60) Pico, A. R.; Kelder, T.; van Iersel, M. P.; Hanspers, K.; Conklin,B. R.; Evelo, C. WikiPathways: pathway editing for the people. PLoSBiol. 2008, 6 (7), e184.(61) Escher, B. I.; Hermens, J. L. M. Modes of action inecotoxicology: Their role in body burdens, species sensitivity,QSARs, and mixture effects. Environ. Sci. Technol. 2002, 36 (20),4201−4217.(62) Escher, B. I.; Hermens, J. L. M. Internal exposure: Linkingbioavailability to effects. Environ. Sci. Technol. 2004, 38 (23), 455A−462A.(63) Adolfsson-Erici, M.; Akerman, G.; McLachlan, M. S. Internalbenchmarking improves precision and reduces animal requirementsfor determination of fish bioconcentration factors. Environ. Sci.Technol. 2012, 46 (15), 8205−8211.(64) van Boxtel, A. L.; Kamstra, J. H.; Cenijn, P. H.; Pieterse, B.;Wagner, J. M.; Antink, M.; Krab, K.; van der Burg, B.; Marsh, G.;Brouwer, A.; Legler, J. Microarray analysis reveals a mechanism ofphenolic polybrominated diphenylether toxicity in zebrafish. Environ.Sci. Technol. 2008, 42 (5), 1773−1779.(65) Yu, Y.; Yang, W.; Gao, Z.; Lam, M. H. W.; Liu, X.; Wang, L.; Yu,H. RP-HPLC measurement and quantitative structure-propertyrelationship analysis of the noctanol-water partitioning coefficients ofselected metabolites of polybrominated dyphenyl ethers. Environ.Chem. 2008, 5 (5), 332−339.(66) Aardema, M. J.; MacGregor, J. T. Toxicology and genetictoxicology in the new era of “toxicogenomics”: Impact of “-omics”technologies. Mutat. Res. 2002, 499 (1), 13−25.(67) Lema, S. C.; Dickey, J. T.; Schultz, I. R.; Swanson, P. Dietaryexposure to 2,2′,4,4′-tetrabromodiphenyl ether (PBDE-47) altersthyroid status and thyroid hormone-regulated gene transcription inthe pituitary and brain. Environ. Health Perspect. 2008, 116 (12),1694−1699.



1832


(68) Chan, W. K.; Chan, K. M. Disruption of the hypothalamic-pituitary-thyroid axis in zebrafish embryo-larvae following waterborneexposure to BDE-47, TBBPA and BPA. Aquat. Toxicol. 2012, 108,106−111.(69) Ren, X. M.; Guo, L. H.; Gao, Y.; Zhang, B. T.; Wan, B.Hydroxylated polybrominated diphenyl ethers exhibit differentactivities on thyroid hormone receptors depending on their degreeof bromination. Toxicol. Appl. Pharmacol. 2013, 268 (3), 256−63.(70) Zhou, H.; Wu, H.; Liao, C.; Diao, X.; Zhen, J.; Chen, L.; Xue, Q.Toxicology mechanism of the persistent organic pollutants (POPs) infish through AhR pathway. Toxicol. Mech. Methods 2010, 20 (6), 279−286.(71) Shibata, H.; Spencer, T. E.; Onate, S. A.; Jenster, G.; Tsai, S. Y.;Tsai, M. J.; O’Malley, B. W. Role of co-activators and co-repressors inthe mechanism of steroid/thyroid receptor action. Recent Prog. Horm.Res. 1997, 52, 141−164 discussion 164-5.(72) Gjernes, M. H.; Schlenk, D.; Arukwe, A. Estrogen receptor-hijacking by dioxin-like 3,3′4,4′,5-pentachlorobiphenyl (PCB126) insalmon hepatocytes involves both receptor activation and receptorprotein stability. Aquat. Toxicol. 2012, 124−125, 197−208.(73) Grans, J.; Wassmur, B.; Celander, M. C. One-way inhibitingcross-talk between arylhydrocarbon receptor (AhR) and estrogenreceptor (ER) signaling in primary cultures of rainbow trouthepatocytes. Aquat. Toxicol. 2010, 100 (3), 263−270.(74) Kojima, H.; Takeuchi, S.; Uramaru, N.; Sugihara, K.; Yoshida,T.; Kitamura, S. Nuclear hormone receptor activity of polybrominateddiphenyl ethers and their hydroxylated and methoxylated metabolitesin transactivation assays using Chinese hamster ovary cells. Environ.Health Perspect. 2009, 117 (8), 1210−1218.(75) Pacyniak, E. K.; Cheng, X.; Cunningham, M. L.; Crofton, K.;Klaassen, C. D.; Guo, G. L. The flame retardants, polybrominateddiphenyl ethers, are pregnane X receptor activators. Toxicol. Sci. 2007,97 (1), 94−102.(76) Liu, H.; Hu, W.; Sun, H.; Shen, O.; Wang, X.; Lam, M. H.;Giesy, J. P.; Zhang, X.; Yu, H. In vitro profiling of endocrine disruptingpotency of 2,2′,4,4′-tetrabromodiphenyl ether (BDE47) and relatedhydroxylated analogs (HO-PBDEs). Mar. Pollut. Bull. 2011, 63 (5−12), 287−296.(77) Fery, Y.; Buschauer, I.; Salzig, C.; Lang, P.; Schrenk, D.Technical pentabromodiphenyl ether and hexabromocyclododecane asactivators of the pregnane-X-receptor (PXR). Toxicology 2009, 264(1−2), 45−51.(78) Abbott, B. D. Review of the expression of peroxisomeproliferator-activated receptors alpha (PPAR alpha), beta (PPARbeta), and gamma (PPAR gamma) in rodent and human development.Reprod. Toxicol. 2009, 27 (3−4), 246−257.(79) Tung, E. W.; Boudreau, A.; Wade, M. G.; Atlas, E. Induction ofadipocyte differentiation by polybrominated diphenyl ethers (PBDEs)in 3T3-L1 cells. PLoS One 2014, 9 (4), e94583.(80) Greenwood, A. K.; Butler, P. C.; White, R. B.; DeMarco, U.;Pearce, D.; Fernald, R. D. Multiple corticosteroid receptors in a teleostfish: Distinct sequences, expression patterns, and transcriptionalactivities. Endocrinology 2003, 144 (10), 4226−4236.



1833


S1

Supporting Information

Bioaccumulation, biotransformation and toxicity of BDE-47, 6-OH-BDE-47

and 6-MeO-BDE-47 in early life-stages of zebrafish (Danio rerio)

Hongling Liu1#*

, Song Tang2#

, Xinmei Zheng1, Yuting Zhu

1, Zhiyuan Ma

1, Chunsheng Liu

1,

Markus Hecker2,3

, David M.V. Saunders3, John P. Giesy

1,3,4,5, Xiaowei Zhang

1, Hongxia Yu

1*

1 State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment,

Nanjing University, Nanjing, Jiangsu 210023, China

2 School of Environment and Sustainability, University of Saskatchewan, Saskatoon, SK S7N

5B3, Canada

3 Toxicology Centre, University of Saskatchewan, Saskatoon, SK S7N 5B3, Canada

4 Department of Veterinary Biomedical Sciences, University of Saskatchewan, Saskatoon,

SK S7N 5B3, Canada

5 Department of Biology and Chemistry, City University of Hong Kong, Kowloon, Hong

Kong, SAR, China

# These authors contributed equally to this work.

* Correspondence to: Drs. Hongling Liu and Hongxia Yu, School of the Environment,

Nanjing University, Nanjing, Jiangsu 210023, China

Tel: +86-25-89680356; Fax: +86-25-89680356; Email: [email protected] (Dr. Hongling Liu)

and [email protected] (Dr. Hongxia Yu)

A summary of 13 pages including 1 figure and 5 tables

mailto:[email protected]:[email protected]

S2

Chemical Analysis Procedures

Bioavailability analysis

This experiment was designed to determine bioaccumulation of the three chemicals in

early life-stages of zebrafish. In each treatment, 600 zebrafish embryos were exposed to

6-OH-BDE-47, 6-MeO-BDE-47 or BDE-47 at 300 μg/L (0.6, 0.58, and 0.62 μM, respectively)

from 4 to 120 hpf in glass beakers (Diameter 150 mm). Concentration of each of the three

compounds was quantified in both exposure solution and embryos/larvae. 80 embryos/larvae

and corresponding exposure solutions were collected at 0, 12, 24, 48, 72, 96, and 120 hpf.

Detailed protocols for extraction, clean up, identification and quantification, and quality

assurance and quality control (QA/QC) are provided in previous publications.1-3

In brief,

samples of exposure solutions were collected and diluted to 5 mL with MilliQ water, and 1

mL hydrochloric acid (2 M HCl) were added. After vortex mixing, samples were extracted

with 6 mL n-hexane-methyl tert butyl ether mixture (MTBE) (1:1, v/v) three times and were

dried under nitrogen. Dried extracts were dissolved in 480 μL of derivatization solvent

(acetonitrile: methanol: water: pyridine = 5:2:2:1, v/v/v/v), and 40 μL methylchloroformate

(MCF) was added. Samples were then incubated at 25 oC with vortex for 1 h, after which 1.4

mL MilliQ water was added and extracted three times with 6 mL n-hexane. The extracts were

concentrated, and 100 μL of 13

C-PCB-178 was added as the internal injection standard and

made up to 100 μL prior to GC/MS analysis. Embryos and larvae from each exposure were

composited, rinsed with MilliQ water, gently dried, and weighed. Internal dose and potential

biotransformation of individual OH-PBDEs, MeO-PBDEs and PBDEs were also determined.

Approximately 0.1 g sample was homogenized and transferred into amber serum bottles, and

spiked surrogate recovery standard (13

C-2’-OH-BDE-99 and 13

C-BDE-139), and 2 mL MilliQ

water, 50 µL HCl at 2 M, and 2 mL 3-propanol was added. Then they were extracted three

times with 10 mL of n-hexane/MTBE (1:1,v/v). Extracts were concentrated by rotary

evaporation and dried under nitrogen. After, the derivation of PBDEs, MeO-PBDEs and

OH-PBDEs and purification was followed by the previous method.1-3

Concentrations of 12

PBDEs, 12 OH-PBDEs and 12 MeO-PBDEs were determined by use of a TSQ Quantum

GC/MS (Thermo Scientific, USA) coupled with an Agilent DB-XLB column (15 m × 0.25

mm × 0.25 μm, J&W Scientific, USA) in 3 separate runs. Identification of specific PBDEs,

S3

OH-PBDEs and MeO-PBDEs was performed by comparing relative retention times versus

internal standard and product ions in SRM mode with the standards. Time-courses of

bioconcentration factors (BCF) for each chemical were also calculated based on measured

concentrations in zebrafish embryos and larvae divided by the determined concentration in

water.

QA/QC

QA/QC was conducted by the analysis of procedural blanks (RSD

S4

Figure S1. Effects of exposures to 6-OH-BDE-47, 6-MeO-BDE-47 and BDE-47 on

morphologies of several development stages of zebrafish embryos and larvae. A) normal

zebrafish at 72 hpf; B) edema caused by 0.5 μM 6-OH-BDE-47 at 72 hpf; C) development

arrested by 0.5 μM 6-OH-BDE-47 at 72 hpf; D) spinal curvature caused by 0.1 μM

6-OH-BDE-47 at 72 hpf; E) normal zebrafish at 120 hpf; F) severe edema and spinal

curvature caused by 0.05 μM 6-OH-BDE-47 at 120 hpf, LC50=0.09 μM; G) spinal curvature

caused by 2.5 μM 6-MeO-BDE-47 at 120 hpf, NOEC=0.5 μM; H) spinal curvature caused by

2.5 μM BDE-47 at 120 hpf, NOEC=0.5 μM.

S5

Table S1. Results of repeatability, recovery and detection limit with spiked procedural

blanks.

Compounds Repeatability

Recovery Detection Limit

RSD Instrument (ng/mL) Method (ng/g)

BDE-17 15.2% 119.6% 2.7 2.7

BDE-28 14.6% 144.0% 4.5×10-1 4.5×10-1

BDE-71 10.0% 114.6% 9.2×10-2 9.2×10-2

BDE-47 9.5% 119.1% 7.8×10-1 7.8×10-1

BDE-66 9.0% 129.2% 1.2 1.2

BDE-100 10.1% 101.9% 2.3 2.3

BDE-99 10.8% 105.6% 5.1×10-1 5.1×10-1

BDE-85 11.9% 116.0% 6.7×10-1 6.7×10-1

BDE-154 12.2% 146.0% 2.6 2.6

BDE-138 12.9% 93.0% 2.9 2.9

BDE-183 13.4% 101.1% 4.1 4.1

BDE-190 12.4% 109.5% 4.2 4.2

6'-MeO-BDE-17 11.9% 113.5% 5.4×10-1 5.4×10-1

2'-MeO-BDE-28 11.7% 109.7% 5.5×10-1 5.5×10-1

2'-MeO-BDE-68 10.2% 116.4% 4.9 4.9

6-MeO-BDE-47 9.1% 119.6% 8.0 8.0

2'-MeO-BDE-47 9.9% 120.5% 6.2 6.2

4'-MeO-BDE-49 10.2% 127.3% 6.5 6.5

4’-MeO-BDE-90 9.6% 106.0% 1.9×101 1.9×101

6-MeO-BDE-90 11.4% 112.6% 4.5 4.5

3-MeO-BDE-100 10.5% 133.0% 9.8 9.8

2-MeO-BDE-123 11.4% 116.5% 8.9 8.9

6-MeO-BDE-85 10.1% 107.7% 1.0×101 1.0×101

6-MeO-BDE-137 12.1% 103.0% 1.6×101 1.6×101

3'-OH-BDE-7 21.2% 89% 2.2×101 2.2×101

2'-OH-BDE-7 21.5% 91.9% 1.4×101 1.4×101

2'-OH-BDE-17 18.2% 92.6% 1.1×101 1.1×101

2'-OH-BDE-25 22.6% 81% 2.2×101 2.2×101

2'-OH-BDE-28 16.7% 103.2% 9.7 9.7

2-OH-BDE-47 11.6% 88.9% 6.6 6.6

2'-OH-BDE-68 20.8% 71.6% 1.5×101 1.5×101

2'-OH-BDE-66 20.9% 67% 2.9×101 2.9×101

2-OH-BDE-90 17.0% 74.6% 9.9 9.9

2-OH-BDE-85 15.4% 112.8% 1.7×101 1.7×101

4'-OH-BDE-49 21.6% 87% 2.5×101 2.5×101

2-OH-BDE-137 17.3% 91.4% 1.6×101 1.6×101

S6

Table S2. Primer sequences of NR related genes for qRT-PCR.

Genes Forward Sequence (5’-3’) Reverse Sequence (5’-3’) Gene ID

11βhsd tggtgaagtatgccatcgaa gcaaagctttttgagccatc AY578180

18s ttgttggtgttgttgctggt ggatgctcaacaggggttcat NM_200713

abcb311 agcgtgtctcttttgggaga atagcacagctagggccaga NM_001006594

adrb2a gctgatctggtcatgggatt atgtgatggcgatgtaacga NM_001102652

adrb2b cccgattacaagctgatggt tatgagcaaccccactgtca NM_001089471

ahr1b ggagagcacttgaggaaacg ggatccagatcgtcctttga NM_001024816

ahr2 atctccatgggcaaaacaag tccctcttgtgtcgataccc NM_131264

ahrra gctgctgatgtttggactga gacgctgtgttcacgtcact NM_001035265

ahrrb acctgggatttcatcagacg gctgtacagatgagccgtca NM_001033920

aip ccatcacttgaagcctccat tgcatgtgctccaacttctc NM_214712

ar acattctggaggccattgag acgtgcaagttacggaaacc NM_001083123

arnt2 gaatggtctcggtccgtcta agctggtcacctgcagtctt NM_131674

arntl1a tctcctgggggaaagaagat ccatcgctgcttcatcatta NM_131577

arntl1b ctcgctgaatgccatagaca cccgagacgactgtattggt NM_178300

c1d acggagagctgacagaccat gccgacatcagatccagttt NM_001007059

ccnd1 tgacttgccttgacttgtcg gaaaaagcagggagcacttg NM_131025

ctnnb1 atcctgtccaacctgacctg tctctgcatcctggtgtctg NM_131059

cyp1a1 cctgggcggttgtctatcta tgaggaatggtgaagggaag AF210727

cyp1b1 gctcagctcggtaacactcc cgttagacacgaaccggaat AY727864

cyp24a1 aagacgtggaaggaccacac ctctgttgtggcagcgtaaa NM_001089458

cyp3a65 ctgtgcatcatggaccaaac ggtgaaggatggtgagagga AY452279

dap3 tcgaccgttcatgtaaacca ctggatgctgagacacctga NM_001098737

dut tacagacgctggatgagacg aatgcagcaacacaaacagc NM_001006005

egfr aacgcaaataatggcaggac tctccagaaccacagtgcag AY332223

er1 ggtccagtgtggtgtcctct cacacgaccagactccgtaa NM_152959

er2a agcttgtgcacatgatcagc gctttcatccctgctgagac NM_180966

er2b ttgtgttctccagcatgagc ccacatatggggaaggaatg NM_174862

flh ctcttccaaatgccacgaat gggcacgcagtagttatggt DQ118096

fus ccaatatgcaggagcaggat cttccccgtctctctgtctg NM_201083

gr agaccttggtccccttcact cgcctttaatcatgggagaa EF567112

hdac3 agccatgaaggtgtccattc agaagctgcttgcaggactc NM_200990

hnf4a gccgacactacagagcatca aggtgttcctggaccagatg NM_194368

hpse cggcagtctgaacagatgaa aacacgggacaaatccacat NM_001045005

hsp90aa1 ggatctggtgatcctgctgt tccagaacgggcatatcttc NM_131328

il6 tcctggtgaacgacatcaaa tcatcacgctggagaagttg JN698962

il8 gtcgctgcattgaaacagaa cttaacccatggagcagagg XM_001342570

lpl ctggccttctcaccaaacat gcctttgaatcccaatgcta NM_131127

mr tttgagggaccagacaaacc cacactttggctgtcgaaga EF567113

ncoa1 tgagagcctctgttggaggt ctctgaccctggtttggtgt XM_686652

ncoa2 agagcctgtcagtcccaaga ggtcgtagccaccatcagtt NM_131777

ncoa3 aactcacctgcccacaaatc agaggcctgttgctggtcta XM_687846

ncoa4 gacaactgcggaaaagaagc ctggggatttggcagagtta NM_201129

S7

ncor agggtaaggagcagagcaca gcaaaactggttcaggtggt EF016488

ncor2 ttgaaccagtttcaccacca tgacaatggctgagttgctc NM_001007032

pa2g4a cgggaaaaggacatgaagaa aagccgtcaacatgaactcc NM_001002170

pa2g4b caaagacaccaccacgtttg gtgccaccattacgcttttt NM_212641

pgr caacaggtggttgtggacag atttggagatgtccgctttg NM_001166335

pou1f1 cggagctttgtggagaagag ttggtcatgaaggagctgtg NM_212851

pparg tgccgcatacacaagaagag atgtggttcacgtcactgga NM_131467

ppargc1a aatcaggattcggtgtggag ttggatgcttcattgccata AY998087

pparα gattcaaatcttgccgtggt tcgtcgctgagagactgaga NM_001161333

pxr ccagctaccagagccttgac tggtcctccataaccagagc DQ069792

rela tataagccacacccacacga gaatgggttgttttgcgtct AY163839

sp1 tcctccattaatcggtcgag tgtgtgtgagcacaaaacga NM_212662

tgfb1 aactactgcatggggtcctg ggacaattgctccaccttgt AY178450

thra caatgtaccatttcgcgttg gctcctgctctgtgttttcc NM_131396

ube2i tggaaagagggaagatgtgg cgaatgaagtgaaggggtgt NM_131351

ugt1a1 attggagaaggctcccaagt ggaaaggatccgtgagcata NM_001037428

vtg1 ctgcgtgaagttgtcatgct gaccagcattgcccataact NM_001044897

vtg2 tactttgggcactgatgcaa agacttcgtgaagcccaaga AY729644

vtg4 ctacaaggtggaggctctgc ggaggacaaatcaccagcat NM_001045294

vtg5 agctaatgctctgcccgtta gttcagcctcaaacagcaca NM_001025189

S8

Table S3. Toxicity of 6-OH-BDE-47, 6-MeO-BDE-47, and BDE-47 to early life-stages of zebrafish.

Chemicals Duration of

development (hpf)

Toxicity Endpoints Concentration or Mean (95% CI)

(μM)

6-OH-BDE-47 48 Hypopigmentation ≥0.1

72 Spinal curvatures, slow heartbeats, and reduced body lengths 0.1

72 Arrested development 0.5

72 LC50 0.28 (0.21-0.38)

96 LC50 0.13 (0.11-0.16)

120 LC50 0.09 (0.04-0.10)

6-MeO-BDE-47 120 NOEC 0.5

120 Spinal curvatures and pericardial edema 2.5

BDE-47 120 NOEC 0.5

120 Spinal curvatures, pericardial edema, and reduced body lengths 2.5

Table S4. Measured concentrations of BDE-47, 6-OH-BDE-47 and 6-MeO-BDE-47 in exposure solutions (ng/g) with a nominal concentration

of 300 μg/L at 0 hpf.

Chemical Control BDE-47 6-MeO-BDE-47 6-OH-BDE-47

BDE-17 n.d 22.39 n.d. n.d.

BDE-28 n.d. 27.02 n.d. n.d.

BDE-71 n.d. n.d. n.d. n.d.

BDE-47 n.d. 227.56 n.d. n.d.







S9



6'-MeO-BDE-17 n.d. n.d. n.d. n.d.



6-MeO-BDE-47 n.d. n.d. 493.19 n.d.

6-MeO-BDE-90 n.d.. n.d. n.d. n.d.

3-MeO-BDE-100 n.d. n.d. n.d. n.d.







3'-OH-BDE-7 n.d. n.d. n.d. n.d.





6-OH-BDE-47 n.d. n.d. n.d. 282.73



6-OH-BDE-90 n.d. n.d. n.d. n.d.




S11

Table S5. Fold-change of gene expressions in NR pathways, * p

S12

ER er1 1.16 1.29 1.25 1.59 1.04 -1.24 1.22 1.88 1.02 1.51 1.69 1.38

ER er2a 1.00 1.68 1.60 1.23 1.00 -1.05 -1.56* -1.43* 1.00 1.43* 1.30 1.35*

ER er2b 1.02 1.47 1.64 1.83* 1.01 -1.16 -1.05 1.44* 1.00 1.27 1.11 1.40*

ER ncoa3 1.07 1.55 1.09 1.37 1.05 -1.09 1.08 -1.75 1.02 1.23 1.31 -1.07

ER pgr 1.05 -1.36 -1.12 1.13 1.07 1.03 1.02 -1.08 1.08 -1.25 1.04 1.66

ER vtg1 1.02 -1.31 -1.30 -1.02 1.02 -1.35 -1.08 -1.14 1.12 -1.33 -1.36 1.03

ER vtg2 1.01 -1.22 -1.21 1.10 1.02 -1.17 1.15 1.19 1.01 1.44 1.46 1.36

ER vtg4 1.01 -1.67 -1.20 -1.09 1.02 2.23 3.55 1.06 1.00 -7.69* -1.19 1.30

ER vtg5 1.04 -1.39 -1.34 -1.13 1.00 -3.85 -5.26 -3.85 1.00 1.07 1.13 -1.29

GR dap3 1.01 1.42 1.28 2.18* 1.01 1.78* -1.20 1.28 1.03 1.14 1.15 1.15

GR gr 1.00 1.12 -1.02 -1.30 1.00 1.14 1.18 -2.04* 1.00 -1.05 -1.28* -1.14

GR hsp90aa1 1.00 -1.25 -1.06 1.49 1.00 1.65 -1.04 1.37 1.00 -1.07 -1.17 -1.01

GR rela 1.01 1.21 1.19 1.34 1.01 1.51* 1.03 -1.96 1.01 1.03 -1.10 -1.02

GR tgfb1 1.00 1.03 1.04 3.27 1.01 1.09 -1.35 -1.72* 1.00 1.09 -1.12 -1.08

MR 11βhsd3 1.01 -1.35 -1.30 -1.27 1.01 1.40 1.00 -1.30 1.01 -1.15 -1.35* -1.49*

MR adrb2a 1.01 1.00 -1.01 -1.12 1.00 -1.14 -1.01 -1.05 1.01 1.13 1.05 1.17

MR adrb2b 1.01 -1.32 -1.25 -1.25 1.00 -1.14 1.02 1.22 1.01 1.48* 1.31 1.36

MR egfr 1.01 1.27 1.39 1.69 1.00 1.47 1.07 -2.05 1.01 -1.15 -1.14 -1.11

MR hpse 1.02 -1.28 -1.06 -1.16 1.02 -1.08 -1.11 -1.45* 1.01 1.12 -1.00 -1.09

MR mr 1.02 1.51* 1.42 -1.15 1.03 1.26 1.19 -1.89 1.02 1.05 1.09 -1.09

MR ube2i 1.00 -1.06 -1.11 -1.22* 1.00 1.00 -1.11 -1.32* 1.00 1.10 1.07 -1.25*

PPARα dut 1.01 -1.20 -1.08 -1.27 1.00 1.67* 1.02 1.30 1.00 1.08 1.07 1.14

PPARα il6 1.00 -1.20 1.56 2.29 1.00 -2.17 1.01 2.30 1.00 2.06 1.72 -1.56

PPARα il8 1.02 -2.50* -1.85* -1.67 1.00 2.04 2.47 2.21 1.00 1.33 1.49 1.13

PPARα lpl 1.03 1.39 -1.32 -1.51 1.00 -1.10 1.28 1.47 1.03 1.11 1.02 -1.79

PPARα ppara 1.00 -1.13 -1.02 -1.00 1.00 1.15 1.26 -1.18 1.01 1.10 1.40 -1.08

S13

PPARα pparg 1.02 -1.17 -1.22 1.24 1.01 1.50 -1.01 -2.26 1.01 -1.06 -1.23 -1.20

PPARα ppargcla 1.00 1.24 1.18 -1.05 1.00 2.02 1.01 -1.27 1.00 1.07 -1.16 -1.79*

PxR abcb3l1 1.03 -1.08 1.12 1.04 1.05 -1.19 -1.15 -1.02 1.02 1.53 1.25 1.04

PxR cyp24a1 1.00 1.01 1.07 2.05* 1.04 -1.22 -1.28 -3.13* 1.01 1.69 1.42 -1.61

PxR cyp3a65 1.00 1.08 1.05 1.22 1.00 1.12 -1.23 -3.03* 1.01 1.18 1.03 -2.04*

PxR hnf4a 1.00 1.34* 1.38* 1.33* 1.00 1.19 1.15 -1.56 1.00 1.08 -1.06 -1.56*

PxR pou1f1 1.02 -1.06 1.14 1.16 1.01 -1.02 1.17 1.21 1.01 1.31 1.19 1.53*

PxR pxr 1.02 1.12 1.23 -1.07 1.02 1.58 -1.20 -1.23 1.01 -1.03 -1.18 -1.43

PxR ugtlal 1.02 1.05 1.08 1.12 1.00 2.23* 1.05 -3.13 1.00 1.15 -1.25 -2.70*

TR c1d 1.01 -1.49* -1.23 -1.08 1.00 1.00 1.06 -1.09 1.00 -1.04 -1.03 1.13

TR fus 1.01 1.10 1.22 -1.37 1.00 1.11 -1.16 -1.85* 1.00 1.33 1.13 -1.11

TR hdac3 1.08 1.04 1.52 1.04 1.00 -1.37 -1.34 -1.33 1.00 1.05 1.30 1.69

TR ncor 1.00 1.14 -1.12 -1.45* 1.00 1.24 -1.19 -2.08* 1.00 1.17 1.61 1.06

TR thra 1.00 1.27 1.37 1.05 1.00 1.42 -1.01 -2.17* 1.00 -1.05 1.13 -1.22

References

1. Wen, Q.; Liu, H. L.; Zhu, Y. T.; Zheng, X. M.; Su, G. Y.; Zhang, X. W.; Yu, H. X.; Giesy, J. P.; Lam, M. H., Maternal transfer, distribution,

and metabolism of BDE-47 and its related hydroxylated, methoxylated analogs in zebrafish (Danio rerio). Chemosphere 2014, 120C, 31-36.

2. Wen, Q.; Liu, H. L.; Su, G. Y.; Wei, S.; Feng, J. F.; Yu, H. X., Determination of Polybrominated Diphenyl Ethers and Their Derivates in

Zebrafish Eggs. Chine. J Anal. Chem. 2012, 40, (11), 1698-1702.

3. Zheng, X.; Zhu, Y.; Liu, C.; Liu, H.; Giesy, J. P.; Hecker, M.; Lam, M. H.; Yu, H., Accumulation and biotransformation of BDE-47 by

zebrafish larvae and teratogenicity and expression of genes along the hypothalamus-pituitary-thyroid axis. Environ. Sci. Technol. 2012, 46, (23),

12943-12951.

845845supp

Bioaccumulation, Biotransformation, and Toxicity of BDE-47 ... · to compare their accumulation,...

Documents

Transcript of Bioaccumulation, Biotransformation, and Toxicity of BDE-47 ... · to compare their accumulation,...