Big Idea #2 & 3: Structure Meets Function of Nucleic Acids

Replication

Transcription

Translation

Replication

• What function of DNA does this process accomplish?– Role of DNA polymerase

Diversity

• Mutation is the ultimate source for diversity.

• Mutation ONLY occurs during replication!

Transcription and Translation

Transcription

• Where?• Why is DNA read “backwards?”

• Molecules involved:– RNA polymerase:

Moves in the 5’ to 3’ direction…so what strand does it READ?

– DNA-->mRNA

Translation

• Where?• How does the concept

of structure meets function apply?

• Molecules involved:– mRNA “codons”– tRNA “anticodons”– rRNA

Function: DNA codes for proteins

• Actually “mRNA” is the “codon”

How can changing DNA

change a protein? A case study

• Sickle Cell:– What change in the

DNA alters the shape of the hemoglobin protein?

– Why does this change occur?

DNA Sequences

• HBB Sequence in Normal Adult Hemoglobin (Hb A Protein)– 3’CAAGTAAACATAGGACTTCTT 5’

• HBB Sequence in Mutant Adult Hemoglobin (Hb S Protein)– 3’CAAGTAAACATAGGACATCTT 5’

What to do?

• Determine the mutation that has been passed down (replication).

• Determine the Amino Acid sequence (using transcription and translation).

• Using an amino acid chart, determine WHY the shape change might occur. – Suggest what amino acid subsitutions may not have had

such a drastic effect. – Suggest which amino acid subsitutions would have a

similar effect.