ATP-bound Topoisomerase II as a Target for Antitumor Drugs

(Running Tittle: ATP/ADP modulation of topoisomerase II-mediated DNA cleavage)

Huimin Wang¶, Yong Mao¶, Nai Zhou¶, Tao Hu§, Tao-Shih Hsieh§ and Leroy F. Liu¶

¶Department of PharmacologyUMDNJ-Robert Wood Johnson Medical School

675 Hoes Lane, Piscataway, NJ 08854

§Department of BiochemistryDuke University Medical School

Durham, NC 27710

Please address all correspondence to:Dr. Leroy F. LiuDepartment of PharmacologyUMDNJ-Robert Wood Johnson Medical School675 Hoes LanePiscataway, NJ 08854.Tel: (732) 235-4592Fax: (732) 235-4073

e-mail: lliu@umdnj.edu

Abbreviations: TOP2, topoisomerase II; PBS, phosphate-buffered saline; DMSO,

dimethyl sulfoxide; AMPPNP, β,γ-imidoadenosine 5-triphosphate; DNP, dinitrophenol;

m-AMSA; 4-(9-acridinylamino)-methanesulfon-m-anisidide; VM-26, 4-

demethylepipodophyllotoxin thenylidene-β-D-glucoside; VP-16(etoposide),

demethylepipodophyllotoxin ethylidene-β-D-glucoside.

1

Copyright 2001 by The American Society for Biochemistry and Molecular Biology, Inc.

JBC Papers in Press. Published on February 23, 2001 as Manuscript M011143200 by guest on M

arch 28, 2018http://w

ww

.jbc.org/D

ownloaded from

Abstract

Topoisomerase II (TOP2) poisons interfere with the breakage/reunion reaction of

TOP2 resulting in DNA cleavage. In the current studies, we show that two different

classes (ATP-sensitive and ATP-insensitive) of TOP2 poisons can be identified based

on their differential sensitivity to the ATP-bound conformation of TOP2. First, in the

presence of 1 mM ATP or the non-hydrolyzable analog AMPPNP, TOP2-mediated

DNA cleavage induced by ATP-sensitive TOP2 poisons (e.g. doxorubicin, etoposide,

mitoxantrone, and mAMSA) was 30- to 100-fold stimulated, while DNA cleavage

induced by ATP-insensitive TOP2 poisons (e.g. amonafide, batracylin and menadione)

was only slightly (less than 3-fold) affected. In addition, ADP was shown to strongly

antagonize TOP2-mediated DNA cleavage induced by ATP-sensitive but not ATP-

insensitive TOP2 poisons. Second, C427A mutant human TOP2α, which exhibits

reduced ATPase activity, was shown to exhibit cross-resistance to all ATP-sensitive but

not ATP-insensitive TOP2 poisons. Third, using ciprofloxacin competition assay,

TOP2-mediated DNA cleavage induced by ATP-sensitive but not insensitive poisons

was shown to be antagonized by ciprofloxacin. These results suggest that ATP-bound

TOP2 may be the specific target of ATP-sensitive TOP2 poisons. Using Lac

repressor/operator complexes as roadblocks, we show that ATP-bound TOP2 acts as a

circular clamp capable of entering DNA ends and sliding on unobstructed duplex DNA.

2

by guest on March 28, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Introduction

Topoisomerase II (TOP2) catalyzes DNA topological reactions via a DNA

breakage/reunion mechanism. The DNA topological reactions allow the enzyme to

segregate interlocked chromosomal DNA at mitosis (1-3) and to remove excess DNA

supercoils generated during processes such as DNA replication, RNA transcription and

chromosome condensation (4-7). The breakage/reunion reaction of TOP2, which is

ATP-dependent, can be interrupted by many antitumor drugs (TOP2 poisons) resulting in

accumulation of a TOP2-DNA covalent intermediate, the cleavable complex (8).

Accumulation of TOP2 cleavable complexes tumor cell death (8).

The molecular mechanism(s) by which TOP2 poisons interfere with the

breakage/reunion reaction of TOP2 is largely unknown. Several studies have implicated

a possible role of ATP in modulating the pharmacological action of TOP2 poisons;

Uncouplers of oxidative phosphorylation (e.g. DNP and 2-deoxyglucose) have been

shown to enhance survival of adriamycin (doxorubicin)-treated Chinese hamster cells

(9). Similarly, DNP, 2-deoxyglucose and sodium cyanide, all of which affect ATP

metabolism, effectively protect L1210 cells from the cytotoxic action of VM-26 and m-

AMSA (10). Simultaneous co-treatment with DNP or novobiocin has been shown to

abrogate m-AMSA cytotoxicity in Chinese hamster cells (11). VP-16 (etoposide)-

induced chromosome-type aberrations (mainly breaks and exchanges) in cultured

Chinese hamster lung fibroblasts are also reduced by co-treatment with DNP (12).

Whether these effects are due to a direct effect of ATP on TOP2-mediated DNA

cleavage induced by TOP2 poisons is not known.

3

by guest on March 28, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Studies in bacteria have also demonstrated that the ATP/ADP ratio plays a critical

role in modulating the supercoiling state of chromosomal DNA as well as cytotoxicity of

quinolone antibiotics (13-15). In this case, the role of ATP/ADP has been shown to

directly affect TOP2-mediated DNA cleavage in the presence of quinolones (13).

Studies of a drug-resistant TOP2 from mammalian cells have also demonstrated that

ATP plays a direct role in modulating TOP2-mediated DNA cleavage in vitro (16,17).

In the current studies, we show that the ATP-bound conformation is the target of

a class of TOP2 poisons, ATP-sensitive TOP2 poisons, which include many clinically

useful TOP2-directed antitumor drugs such as doxorubicin, mitoxantrone, VP-16

(etoposide) and m-AMSA. The ATP bound form of TOP2 has been shown to be a

circular protein clamp based on biochemical and X-ray crystallographic studies (18-20).

Using Lac repressor/operator complexes as roadblocks, we have further demonstrated

that the circular TOP2 protein clamp is capable of sliding on unobstructed duplex DNA.

4

by guest on March 28, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Experimental Procedures

Chemicals and Drugs. VM-26 was a gift from Bristol-Myers Squibb Co. m-

AMSA, mitoxantrone, and amonafide were obtained from the Drug Synthesis and

Chemistry Branch, Division of Cancer Treatment, National Cancer Institute. Batracylin

was a gift from Dr. C. C. Cheng (University of Kansas). 5-hydroxy-1,4-

naphthoquinone was obtained from Aldrich Co. All drugs were dissolved in DMSO (10

mM) and kept frozen in aliquots at -20°C. Ciprofloxacin was obtained from Bayer.

ATP, AMPPNP and ADP were purchased from Sigma Chemical Co. Except for fetal

bovine serum which was obtained from Gemini Bio-Product Inc., media and other agents

for tissue culture were purchased from Gibco. α-32P-dATP (3000 Ci/mmol) was

obtained from DuPont.

Construction of Mutant Topoisomerase II Overexpression Plasmid. The mutation

C427A was generated by PCR-based site-directed mutagenesis. Three rounds of PCR

were carried out to introduce the C427A into human TOP2α cDNA in YEpWob6. The

resulting plasmid is named Yhtop2αC427A. The following four primers were used (the

mutations are marked in bold and the restriction sites underlined):

Primer A: 5- ACGCGTCGACGAATTCGACAGGTTATC - 3 SalI

Primer B: 5- ACAAGAAGGCCTCAGCTGTA -3’

Primer C: 5’- TACAGCTGAGGCCTTCTTGT -3’

Primer D: 5’- GCCTGGTACCAAACTGAC -3’ KpnI

Primers B and C contain the alanine codon instead of the wild type cysteine codon.

5

by guest on March 28, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Primers A and D contain the recognition sites for Sal I and Kpn I, respectively. Two

fragments, AC and BD, which have the alanine codon were generated during the 1st

round PCR in the presence of YEpWob6 DNA. After denaturation and renaturation of

fragments AC and BD, two cycles of a 2nd round of PCR without any primer was carried

out to generate a small amount of the fragment containing C427A as the template for the

3rd round of PCR. The 3rd round of PCR amplified the fragment containing C427A

using primers A and D. Sal I and Kpn I were used to digest both the fragment containing

C427A and YEpWob6 (partially digested with Sal I) and ligation was carried out at 14°C

overnight. The mutated site was confirmed by sequence analysis.

Enzymes and Nucleic Acids. TOP2 was purified to homogeneity from calf

thymus glands according to the published procedure (21). Full-length human TOP2β

cDNA (hTOP2β cDNA) was isolated by RT-PCR using mRNA isolated from human

U937 cells and primers with sequences according to the published sequence of HeLa

TOP2β (22). For overexpression, hTOP2β cDNA was used to replace the human TOP2α

cDNA (hTOP2α cDNA) in YEpWob6 (23). The resulting plasmid, YEphTOP2β, was

then used to transform protease deficient yeast BCY123 (23). Purification of both TOP2

isozymes and mutant enzyme were performed following the published procedure (23).

Lac repressor was a kind gift from Dr. Kathleen S. Matthews (Rice University). YEpG

(24) is a derivative of YEP24. pYβYOm was constructed by inserting a 42 bp DNA

oligomer containing a 21 bp essential Lac repressor binding site (25) into the NotI site in

pBRβY (26). pYβYOd, which contains two Lac repressor binding sites, was constructed

6

by guest on March 28, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by inserting the same 42 bp oligomer into the XbaI site in pYβYOm. All plasmids were

purified using the Qiagen purification kit.

Preparation of End-labeled DNA Fragments. 3 end-labeling of plasmid DNA

was performed as described previously (21). Briefly, 10 µg of DNA was digested with a

proper restriction enzyme, followed by labeling at its 3 ends with the large fragment of

Escherichia coli DNA polymerase I and α-32P-dATP. Unincorporated triphosphates

were removed by two cycles of ethanol precipitation in the presence of 2.5 M ammonium

acetate.

TOP2 Cleavage Assay. TOP2 cleavage assay was performed as described

previously (27). The reaction mixture (20 µl each) containing 40 mM Tris-HCl, pH 7.5,

100 mM KCl, 10 mM MgCl2, 1.0 mM ATP, 0.5 mM dithiothreitol, 0.5 mM EDTA, 30

µg/ml bovine serum albumin, 20 ng of 3 end-labeled DNA, 10 ng of TOP2, and various

drugs were incubated at 37°C for 30 min. The reactions were terminated by the addition

of 5 µl of 5% SDS and 150 µg/ml proteinase K and incubated for an additional 60 min at

37°C. Following addition of sucrose (5% final concentration) and bromophenol blue

(0.05 mg/ml final concentration), DNA samples were loaded onto a 1% agarose gel in

TPE (90 mM Tris-phosphate, 2 mM EDTA, pH 8.0) buffer. Gels were then dried onto

Whatman 3MM chromatographic paper and autoradiographed at -80°C using Kodak

XAR-5 films.

7

by guest on March 28, 2018

http://ww

w.jbc.org/

Dow

nloaded from

P4 Unknotting Assay. Knotted P4 phage DNA was used to assay the strand-

passing activity of TOP2 (28). Reactions (20 µl) containing 40 mM Tris-HCl, pH 7.5,

100 mM KCl, 10 mM MgCl2, 0.5 mM dithiothreitol, 0.5 mM EDTA, 30 µg/ml of bovine

serum albumin, calf thymus TOP2 (titrated prior to the experiment), and various amount

of ADP and/or ATP as indicated were incubated at 37°C for 30 min. Reactions were

terminated by adding 5 µl of a solution containing 20% Ficoll, 5% of sarkosyl, 50 mM

EDTA and 0.05 mg/ml bromophenol blue. Reaction products were analyzed by

electrophoresis in 1% agarose gel containing TPE buffer.

ATPase Assay. ATPase assay was performed as described (29) except that a 8.6-

kilobase plasmid DNA, pCaSpeRhs83 (30), was used. Radioactivities were quantified by

PhosphorImager (Molecular Dynamics, Sunnyvale, CA).

8

by guest on March 28, 2018

http://ww

w.jbc.org/

Dow

nloaded from

RESULTS

Differential ATP Stimulation of TOP2-mediated DNA Cleavage Induced by

TOP2 Poisons. The possible effect of ATP on TOP2-mediated DNA cleavage was

studies using purified TOP2 and various TOP2 poisons. As shown in Fig. 1A, 1 mM

ATP stimulated calf thymus TOP2-mediated DNA cleavage induced by VM-26 by

about 60-fold (Fig. 1A) (ATP stimulation is estimated as the fold of increased drug

concentration in the absence of ATP for achieving the same extent of cleavage in the

presence of ATP). By contrast, TOP2-mediated DNA cleavage induced by amonafide

was only slightly affected (less than 3-fold) by 1 mM ATP (Fig. 1B). The non-

hydrolyzable ATP analog, AMPPNP, gave similar results as ATP (data not shown).

Similar results were obtained with recombinant human TOP2α and TOP2β (data not

shown). TOP2 poisons which are highly (about 30- to 100-fold) stimulated by ATP in

TOP2-mediated DNA cleavage assay include VM-26, VP-16, m-AMSA, doxorubicin

and mitoxantrone (referred to as ATP-sensitive TOP2 poisons). TOP2 poisons which are

only slightly (less than 3-fold) affected by ATP include amonafide, batracylin and

menadione (referred to as ATP-insensitive TOP2 poisons).

ADP Antagonizes ATP-stimulated DNA Cleavage Activity and ATP-dependent

Strand-passing Activity of TOP2. While ATP strongly stimulated TOP2-mediated DNA

cleavage induced by VM-26, ADP alone had no such effect (Fig. 2). However, in the

presence of ATP, ADP effectively antagonized the ATP stimulatory effect on TOP2-

mediated DNA cleavage induced by VM-26 (Fig. 2). The antagonistic effect of ADP on

VM-26-induced DNA cleavage was also observed with other ATP-sensitive TOP2

9

by guest on March 28, 2018

http://ww

w.jbc.org/

Dow

nloaded from

poisons (data not shown). By contrast, ATP had minimum effect on TOP2-mediated

DNA cleavage in the presence of amonafide, an ATP-insensitive TOP2 poison. In this

case, ADP had a minimal effect on TOP2-mediated DNA cleavage induced by

amonafide in the presence of ATP (Fig. 2). These results suggest that ADP specifically

antagonizes ATP-stimulatory effect on TOP2-mediated DNA cleavage induced by

ATP-sensitive TOP2 poisons. We had also tested the effect of ADP on the catalytic

activity of TOP2 using a P4 unknotting assay. As shown in Fig. 3, ADP also effectively

antagonized the P4 unknotting activity of TOP2.

C427A Mutant TOP2α is Cross-Resistant to ATP-Sensitive but not ATP-

Insensitive TOP2 Poisons. In order to further characterize the role of ATP in the action

of TOP2 poisons, we generated C427A mutant TOP2α. The cysteine 427 is located in

the ATPase domain of TOP2α (31). In the absence of ATP, C427A mutant TOP2α

exhibited almost identical sensitivity to both VM-26 and amonafide compared to wild

type TOP2α in a standard DNA cleavage assay (Fig. 4). Strikingly, in the presence of 1

mM ATP, C427A mutant TOP2α was at least 10-fold more resistant to VM-26 as

compared to the wild-type enzyme. The resistance of C427A mutant TOP2α to VM-26

is apparently due to a reduced ATP-stimulatory effect on DNA cleavage as compared to

the wild-type enzyme (Fig. 4). By contrast, both mutant and wild-type TOP2α were

equally sensitive to amonafide (Fig. 4). We also tested other ATP-sensitive drugs, such

as doxorubicin, m-AMSA, mitoxantrone, and CP115, 953. Similar results as VM-26

were observed (data not shown). These results suggest that C427A mutant TOP2α can

10

by guest on March 28, 2018

http://ww

w.jbc.org/

Dow

nloaded from

distinguish between ATP-sensitive and ATP-insensitive TOP2 poisons, possibly due to

its altered interaction with ATP.

C427A Mutant Enzyme Exhibits Reduced ATPase Activity and Increased ATP

Requirement for Its Catalytic Activity. Previous studies on another multidrug resistant

mutant TOP2α mutant have shown that the mutant enzyme exhibits increased ATP

requirement for catalysis (16). To test whether C427A behaves similarly, the catalytic

activity of the C427A mutant TOP2α was measured by P4 unknotting assay in the

presence of two different concentrations of ATP. As shown in Fig. 5, C427A mutant

TOP2α was about 5-fold less active than the wild type enzyme in the presence of 1 mM

ATP. However, in the presence of 50 µM ATP, C427A was at least 25-fold less active

that the wild type enzyme. This result is similar to the result from the experiment

performed on another mutant TOP2α enzyme (R450Q TOP2α) which is cross-resistant

to ATP-sensitive TOP2 poisons and exhibits increased ATP requirement for enzyme

catalysis (17).

The DNA-stimulated ATPase activity of C427 mutant TOP2α was also measured

and shown to be much reduced relative to the wild-type enzyme. The Vmax(mMmin-1)

was reduced from 60 to 11 and Km (mM) was increased from 0.78 to 3.2.

Ciprofloxacin Antagonizes TOP2-mediated DNA Cleavage Induced by ATP-

sensitive but not ATP-insensitive TOP2 Poisons. Ciprofloxacin is known to interact

11

by guest on March 28, 2018

http://ww

w.jbc.org/

Dow

nloaded from

with TOP2 but does not induce significant TOP2-mediated DNA cleavage (32).

Consequently, ciprofloxacin has been used to compete with other TOP2 poisons in a

standard DNA cleavage assay to assess possible overlap of interaction domains on TOP2

(32). Based on this kind of ciprofloxacin competition assay, it has been suggested that

various TOP2 poisons including etoposide, mAMSA, genistein, and the antineoplastic

quinolone, CP-115,953 share a common interaction domain with ciprofloxacin on TOP2

(32). To test whether or not ATP-sensitive and -insensitive TOP2 poisons may interact

with different domains on TOP2, we performed the ciprofloxacin competition assay (32).

As shown in Fig. 6, ciprofloxacin reduced TOP2-mediated DNA cleavage induced by

VM-26 as evidenced by the gradual increase in band intensity of the uncleaved DNA

bands (see the arrow) with increasing ciprofloxacin concentrations (see lanes labeled 0.1

µM VM). By contrast, ciprofloxacin had little effect on TOP2-mediated DNA cleavage

induced by amonafide (see the intensity of the uncleaved DNA bands in lanes labeled 1.0

µM AM). Similar ciprofloxacin competition assays were performed with other TOP2

poisons. All ATP-sensitive but not ATP-insensitive TOP2 poisons were antagonized by

ciprofloxacin in this DNA cleavage assay (data not shown).

ATP-bound TOP2 is a sliding protein clamp. Previous studies have suggested

that yeast TOP2 when bound to AMPPNP can undergo a conformational change into a

circular protein clamp (19,20) consistent with results from X-ray crystallographic studies

(18). To test whether calf thymus TOP2 can also form a circular protein clamp in its

ATP-bound form, we have designed a more stringent assay requiring TOP2 protein

12

by guest on March 28, 2018

http://ww

w.jbc.org/

Dow

nloaded from

clamp to slide on unobstructed DNA under physiological conditions. As shown in Fig. 7,

a linear DNA (8310 bp, 32P end-labeled) with two internally bound Lac repressor

molecules at their respective Lac operator sites was used to demonstrate entry and sliding

of AMPPNP-bound TOP2. Calf thymus TOP2 was first reacted with AMPPNP to form

a circular protein clamp and then incubated with the linear DNA bound by Lac

repressors. VM-26 or amonafide was subsequently used to locate the TOP2 sliding

clamps on DNA by inducing TOP2-mediated DNA cleavage. As shown in Fig. 7, in the

presence of ATP, TOP2-mediated DNA cleavage sites induced by VM-26 (lane 3)

scattered all over the linear DNA (a similar result was obtained in the absence of ATP,

data not shown). However, in the presence of AMPPNP, TOP2-mediated DNA cleavage

induced by VM-26 (lane 5) occurred primarily near the two ends of the linear DNA and

extended up to the Lac repressor binding sites. Similar results were obtained in the

absence of VM-26 (compare background DNA cleavage in lanes 2 and 4 with VM-26

induced DNA cleavage in lanes 3 and 5, respectively). The lower part of the gel was

overexposed to reveal cleavage sites from the other end (Fig. 7). The results from this

experiment support the previous claim that AMPPNP-bound TOP2 is in the form of a

circular protein clamp. In addition, this experiment has demonstrated that AMPPNP-

bound TOP2 is a protein clamp capable of entering DNA ends and sliding on

unobstructed duplex DNA, while retaining sensitivity to VM-26.

13

by guest on March 28, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Discussion

Our results have demonstrated that different TOP2-mediated DNA cleavage

induced by various TOP2 poisons exhibit different degree of ATP-dependence. The

differences in ATP dependence among various TOP2 poisons may reflect differences in

their interaction with TOP2 and/or TOP2-DNA complexes. Based on our current results,

there appears to be two distinct classes of TOP2 poisons, ATP-sensitive and ATP-

insensitive TOP2 poisons.

These two classes of TOP2 poisons show quite different response to ATP

stimulation in the standard DNA cleavage assay. The specific antagonistic effect of ADP

against ATP-sensitive but not insensitive TOP2 poisons has further demonstrated the

differences between these two classes of TOP2 poisons. The fact that ADP also strongly

inhibits ATP-dependent catalytic activity of TOP2 suggests that ADP may compete with

ATP both in enzyme catalysis and cleavable complex formation by the same mechanism.

Studies in bacteria have established that the ATP/ADP ratio is a critical determinant for

the supercoiling state in cells probably due to the sensitivity of DNA gyrase to the

ATP/ADP ratio (14,15). More recent studies have also demonstrated that quinolone-

induced DNA cleavage is strongly dependent on the ATP/ADP ratio both in cells and

using purified gyrase (13). These results suggest that the ATP/ADP ratio may be a

common determinant for sensitivity/resistance to both antibiotics and antitumor drugs

directed against TOP2. Although ATP-sensitive TOP2 poisons used in this work have

very disparate structures, their interaction domains with TOP2 have been suggested to

overlap (32).

14

by guest on March 28, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Previous studies have demonstrated that a multidrug resistant mutant TOP2α is

cross-resistant to all ATP-sensitive TOP2 poisons (17). This multidrug resistant mutant

TOP2α was shown to exhibit increased requirement of ATP for catalysis and cleavage. It

has been suggested that the R450Q mutation on this mutant TOP2α is responsible for

altered ATP utilization and cross-resistance to ATP-sensitive TOP2 poisons (17). This

mutation is located in a Walker consensus motif (17). In the current study, we have

created another mutation C427A on TOP2α. Like R450Q mutant TOP2α, C427A mutant

TOP2α also exhibits multidrug resistance to all ATP-sensitive poisons. Interesting,

C427A mutant TOP2α retains the same sensitivity to ATP-insensitive TOP2 poisons as

compared to the wild-type enzyme. C427A mutant TOP2α exhibits reduced ATPase

activity and increased requirement of ATP for catalysis. Taken together, these results

suggest that ATP-sensitive and ATP-insensitive TOP2 poisons interfere with the

breakage/reunion reaction of TOP2 by distinct mechanisms and that ATP-sensitive

TOP2 poisons may specifically interfere with a step in TOP2 catalysis requiring ATP

utilization.

Results from the ciprofloxacin competition experiment have suggested that the

ATP-insensitive TOP2 poisons do not share the same interaction domain on TOP2 with

ATP-sensitive TOP2 poisons. This result suggests that ATP-sensitive TOP2 poisons

may target TOP2 with a distinct conformation compared to ATP-insensitive poisons.

Based on our results, it seems plausible that ATP-sensitive TOP2 poisons may

specifically target an ATP-bound conformation of TOP2. Our current studies have

suggested that AMPPNP-bound TOP2 is capable of entering duplex DNA only from its

15

by guest on March 28, 2018

http://ww

w.jbc.org/

Dow

nloaded from

ends, consistent with the closed circular clamp conformation of ATP-bound TOP2

proposed previously based on studies of yeast TOP2 (19). Our results also indicate that,

upon entry, AMPPNP-bound TOP2 can slide on unobstructed DNA under physiological

conditions. Previous studies on Drosophila TOP2 and yeast TOP2 have implicated linear

diffusion in high salt conditions which presumably weaken protein-DNA interactions to

allow mobility of the protein circular clamp (19,33). Our results, however, show that

AMPPNP-bound mammalian TOP2 is able to linearly diffuse under physiological

conditions. The ability of TOP2 to slide on DNA under physiological conditions may

imply a role of limited linear diffusion, dictated by ATP binding and hydrolysis, in its

strand-passing reaction. Our limited understanding of the role of ATP in TOP2 catalysis

precludes us from any meaningful speculation on the mechanistic and/or functional

implications of the sliding action of ATP-bound TOP2. The resistance of TOP2 poisons

has been studied in cells under stress conditions (e.g. hypoxia and glucose deprivation)

which are often associated with solid tumors (9-12,34-38). Reduced TOP2α levels in

stressed cells have been found and suggested to be in part responsible for the observed

resistance (38-40). Our results raise the possibility that alteration in ATP/ADP ratios,

which is known to occur in hypoxic and nutrient depleted cells (41) may contribute to the

overall resistance mechanisms through its modulation on TOP2-mediated DNA

cleavage. Thus, it seems plausible that ATP-insensitive TOP2 poisons may be

particularly useful for treating hypoxic tumors which have compromised ATP/ADP

ratios.

16

by guest on March 28, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Acknowledgment

We are grateful to Dr. Kathleen S. Matthews for supplying us with purified Lac

repressor. This work was supported by NIH grants GM27731 (LFL) and CA39662

(LFL) and GM29006 (TSH).

17

by guest on March 28, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Figure Legends

Fig. 1. ATP stimulation of TOP2-mediated DNA cleavage induced by

TOP2 poisons. TOP2 cleavage assays were performed as described in

Experimental Procedures. The presence or absence of ATP (1.0 mM) is

indicated on top of each lane. All reactions contained 1% DMSO. The

concentrations of VM-26 (panel A) and amonafide (panel B) are as

indicated.

Fig. 2. ADP antagonizes the cleavage-stimulatory effect of ATP. TOP2 cleavage assays

were performed using calf thymus TOP2. The concentrations of ATP and ADP are as

indicated on top of each lane.

Fig. 3. ADP inhibits the P4 unknotting activity of TOP2. P4 unknotting

assay for the catalytic activity of TOP2 was performed as described in

Experimental Procedures. Various concentrations of ATP and ADP were

present as indicated on top of each lane. The P4 knotted DNA migrated as a

smear as indicated. The unknotted P4 DNA migrated as a band as indicated.

18

by guest on March 28, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Fig. 4. C427A mutant TOP2α is resistant to VM-26 but not amonafide. TOP2

cleavage assays were performed as described in Experimental Procedures. The

concentrations of VM-26 and amonafide are as indicated on top of each lane. 1 mM

ATP was used in the +ATP lanes.

Fig. 5. The P4 unknotting activity of C427A mutant TOP2α exhibits an increased

requirement for ATP. P4 unknotting assay for the catalytic activity of C427A mutant

TOP2α and wild-type TOP2α were performed as described in Experimental Procedures.

The concentrations of TOP2 and ATP were as indicated on top of the figure.

Fig. 6. Ciprofloxacin antagonizes TOP2-mediated DNA cleavage induced by VM-26.

TOP2 cleavage assays were performed as described in Experimental Procedures. 0.1 µM

VM-26 (lanes labeled 0.1 µM VM) and 1.0 µM amonafide (lanes labeled 1.0 µM AM)

were used in the cleavage assays with increasing concentrations of ciprofloxacin (0, 125

and 250 µM). The control experiment in the presence of 1% DMSO (solvent control for

VM-26 and amonafide) and increasing concentrations of ciprofloxacin is shown in lanes

labeled 1% DMSO. All drugs were present in the reaction mixture prior to the addition

of TOP2. The arrow points to the uncleaved DNA bands.

Fig. 7. AMPPNP-bound TOP2 is a sliding protein clamp. pYβYOd DNA, containing

two Lac repressor binding sites, was digested with HindIII and 3 end- labeled with α-

19

by guest on March 28, 2018

http://ww

w.jbc.org/

Dow

nloaded from

32P-dATP by the Klenow polymerase. The labeled DNA was then digested with ScaI,

resulting in two one-end labeled DNA of the sizes of 8310 bp and 546 bp, respectively.

The two Lac repressor binding sites are located at 808-829 bp and 4527-4548 bp from

the labeled end of the 8310 bp fragment. Demonstration of entry and sliding of

AMPPNP-bound TOP2 was performed in three sequential steps: (a) calf thymus TOP2

(30 ng each) was incubated with 2 mM AMPPNP or ATP at 37°C for 10 min. (b) 3 ×

10-13 M labeled DNA was incubated with 2 × 10-11 M Lac repressor protein in 40 mM

Tris-HCl, pH 7.5, 100 mM KCl, 10 mM MgCl2, 0.5 mM dithiothreitol, 0.5 mM EDTA

and 30 µg/ml bovine serum albumin at room temperature for 7 min. (c) AMPPNP-

bound TOP2 and repressor-bound DNA were mixed together followed by incubation at

37°C for 7 min in the presence of 0.5 µM VM-26. After treatment with SDS (final 1%)

and proteinase K (final 200 µg/ml) for 1 hr at 37°C, the samples were subjected to

electrophoresis in 1% agarose gel. Lane 1: DNA alone; Lane 2: contained Lac repressor

and TOP2; Lane 3: contained Lac repressor, TOP2 and VM-26; Lanes 4 and 5 were

identical to lanes 2 and 3, respectively, except that AMPPNP rather than ATP was

present in each reaction. Lane 6: DNA size markers. To the right of the panel, the 8310

bp DNA, which is 3’-end labeled with 32P (see the asterisk), is schematically aligned

with the gel to indicate the cleavage sites relative to the Lac repressor binding sites on

DNA. In the presence of AMPPNP, TOP2 is shown as a protein doughnut which can

enter linear DNA only through DNA ends. Drug-induced (also background) cleavage

sites mark the accessible regions of DNA to the TOP2 sliding clamp.

20

by guest on March 28, 2018

http://ww

w.jbc.org/

Dow

nloaded from

References:

1. Uemura, T., Ohkura, H., Adachi, Y., Morino, K., Shiozaki, K., and Yanagida, M.

(1987) Cell 50, 917-925

2. Holm, C., Stearns, T., and Botstein, D. (1989) Mol Cell Biol 9, 159-168

3. Sumner, A. T. (1991) Chromosoma 100, 410-418

4. Brill, S. J., DiNardo, S., Voelkel-Meiman, K., and Sternglanz, R. (1987) Nature

326, 414-416

5. Wu, H. Y., Shyy, S. H., Wang, J. C., and Liu, L. F. (1988) Cell 53, 433-440

6. Tsao, Y. P., Wu, H. Y., and Liu, L. F. (1989) Cell 56, 111-118

7. Yang, L., Wold, M. S., Li, J. J., Kelly, T. J., and Liu, L. F. (1987) Proc Natl Acad

Sci U S A 84, 950-954

8. Liu, L. F. (1989) Annu Rev Biochem 58, 351-375

9. Colofiore, J. R., Ara, G., Berry, D., and Belli, J. A. (1982) Cancer Res. 42, 3934-

3940

10. Kupfer, G., Bodley, A. L., and Liu, L. F. (1987) NCI Monogr 4, 37-40

11. Utsumi, H., Shibuya, M. L., Kosaka, T., Buddenbaum, W. E., and Elkind, M. M.

(1990) Cancer Res 50, 2577-2581

12. Suzuki, H., Ikeda, T., Yamagishi, T., Nakaike, S., Nakane, S., and Ohsawa, M.

(1995) Mutat Res 328, 151-161

13. Li, T. K., and Liu, L. F. (1998) Antimicrob Agents Chemother 42, 1022-1027

14. Hsieh, L. S., Burger, R. M., and Drlica, K. (1991) J. Mol. Biol. 219, 443-450

21

by guest on March 28, 2018

http://ww

w.jbc.org/

Dow

nloaded from

15. Hsieh, L. S., Rouviere-Yaniv, J., and Drlica, K. (1991) J Bacteriol 173, 3914-

3917

16. Danks, M. K., Schmidt, C. A., Deneka, D. A., and Beck, W. T. (1989) Cancer

Commun 1, 101-109

17. Mao, Y., Yu, C., Hsieh, T. S., Nitiss, J. L., Liu, A. A., Wang, H., and Liu, L. F.

(1999) Biochemistry 38, 10793-10800

18. Berger, J. M., Gamblin, S. J., Harrison, S. C., and Wang, J. C. (1996) Nature 379,

225-232

19. Roca, J., and Wang, J. C. (1992) Cell 71, 833-840

20. Lindsley, J. E., and Wang, J. C. (1991) Proc Natl Acad Sci U S A 88, 10485-

10489

21. Halligan, B. D., Edwards, K. A., and Liu, L. F. (1985) J Biol Chem 260, 2475-

2482

22. Jenkins, J. R., Ayton, P., Jones, T., Davies, S. L., Simmons, D. L., Harris, A. L.,

Sheer, D., and Hickson, I. D. (1992) Nucleic Acids Res 20, 5587-5592

23. Wasserman, R. A., Austin, C. A., Fisher, L. M., and Wang, J. C. (1993) Cancer

Res 53, 3591-3596

24. Wyckoff, E., and Hsieh, T. S. (1988) Proc Natl Acad Sci U S A 85, 6272-6276

25. Wu, H. Y., and Liu, L. F. (1991) J Mol Biol 219, 615-622

26. Bi, X., and Liu, L. F. (1994) J. Mol. Biol. 235, 414-423

27. Tewey, K. M., Rowe, T. C., Yang, L., Halligan, B. D., and Liu, L. F. (1984)

Science 226, 466-468

22

by guest on March 28, 2018

http://ww

w.jbc.org/

Dow

nloaded from

28. Liu, L. F., Davis, J. L., and Calendar, R. (1981) Nucleic Acids Res. 9, 3979-3989

29. Osheroff, N., Shelton, E. R., and Brutlag, D. L. (1983) J Biol Chem 258, 9536-

9543

30. Horabin, J. I., and Schedl, P. (1993) Mol Cell Biol 13, 1408-1414

31. Beck, W. T., Danks, M. K., Wolverton, J. S., Chen, M., Granzen, B., Kim, R., and

Suttle, D. P. (1994) in DNA topoisomerases: topoisomerase-targeting drugs (Liu, L. F.,

ed), pp. 145-69, Academic Press, New York

32. Elsea, S. H., Westergaard, M., Burden, D. A., Lomenick, J. P., and Osheroff, N.

(1997) Biochemistry 36, 2919-2924

33. Osheroff, N. (1986) J Biol Chem 261 9944-9950.

34. Yamauchi, T., Raffin, T. A., Yang, P., and Sikic, B. I. (1987) Cancer Chemother

Pharmacol 19, 282-286

35. Shen, J., Hughes, C., Chao, C., Cai, J., Bartels, C., Gessner, T., and Subjeck, J.

(1987) Proc. Natl. Acad. Sci. USA 84, 3278-3282

36. Hughes, C. S., Shen, J. W., and Subjeck, J. R. (1989) Cancer Res 49, 4452-4454

37. Yun, J., Tomida, A., Nagata, K., and Tsuruo, T. (1995) Oncol Res 7, 583-590

38. Chatterjee, S., Cheng, M. F., Berger, S. J., and Berger, N. A. (1994) Cancer Res

54, 4405-4411

39. Kang, Y., Greaves, B., and Perry, R. R. (1996) Biochem Pharmacol 52, 669-676

40. Shen, J. W., Subjeck, J. R., Lock, R. B., and Ross, W. E. (1989) Mol Cell Biol 9,

3284-3291

41. Kennedy, K. A. (1987) Anticancer Drug Des. 2, 181-194

23

by guest on March 28, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on March 28, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on March 28, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on March 28, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on March 28, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on March 28, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on March 28, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on March 28, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Huimin Wang, Yong Mao, Nai Zhou, Tao Hu, Tao-Shih Hsieh and Leroy F. LiuATP-bound topoisomerase II as a target for anti tumor drugs

published online February 23, 2001J. Biol. Chem. 

  10.1074/jbc.M011143200Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

by guest on March 28, 2018

http://ww

w.jbc.org/

Dow

nloaded from