Art science practices and collaborations in bangalore, india
-
Upload
hlab14 -
Category
Art & Photos
-
view
176 -
download
1
Transcript of Art science practices and collaborations in bangalore, india
![Page 1: Art science practices and collaborations in bangalore, india](https://reader030.fdocuments.net/reader030/viewer/2022032616/55a8e3881a28ab3a6a8b47d8/html5/thumbnails/1.jpg)
Open Source ArtScience practices and collaborations in Bangalore,
IndiaYashas Shetty
(Art)ScienceBLR
![Page 2: Art science practices and collaborations in bangalore, india](https://reader030.fdocuments.net/reader030/viewer/2022032616/55a8e3881a28ab3a6a8b47d8/html5/thumbnails/2.jpg)
Bangalore,India
![Page 3: Art science practices and collaborations in bangalore, india](https://reader030.fdocuments.net/reader030/viewer/2022032616/55a8e3881a28ab3a6a8b47d8/html5/thumbnails/3.jpg)
![Page 4: Art science practices and collaborations in bangalore, india](https://reader030.fdocuments.net/reader030/viewer/2022032616/55a8e3881a28ab3a6a8b47d8/html5/thumbnails/4.jpg)
![Page 5: Art science practices and collaborations in bangalore, india](https://reader030.fdocuments.net/reader030/viewer/2022032616/55a8e3881a28ab3a6a8b47d8/html5/thumbnails/5.jpg)
Indian Institute of Science
![Page 6: Art science practices and collaborations in bangalore, india](https://reader030.fdocuments.net/reader030/viewer/2022032616/55a8e3881a28ab3a6a8b47d8/html5/thumbnails/6.jpg)
Infosys campus
![Page 7: Art science practices and collaborations in bangalore, india](https://reader030.fdocuments.net/reader030/viewer/2022032616/55a8e3881a28ab3a6a8b47d8/html5/thumbnails/7.jpg)
Srishti School of Art, Design and Technology
![Page 8: Art science practices and collaborations in bangalore, india](https://reader030.fdocuments.net/reader030/viewer/2022032616/55a8e3881a28ab3a6a8b47d8/html5/thumbnails/8.jpg)
Srishti School of Art, Design and Technology
![Page 9: Art science practices and collaborations in bangalore, india](https://reader030.fdocuments.net/reader030/viewer/2022032616/55a8e3881a28ab3a6a8b47d8/html5/thumbnails/9.jpg)
(Art)ScienceBLR
![Page 10: Art science practices and collaborations in bangalore, india](https://reader030.fdocuments.net/reader030/viewer/2022032616/55a8e3881a28ab3a6a8b47d8/html5/thumbnails/10.jpg)
National Center for Biological Sciences
![Page 11: Art science practices and collaborations in bangalore, india](https://reader030.fdocuments.net/reader030/viewer/2022032616/55a8e3881a28ab3a6a8b47d8/html5/thumbnails/11.jpg)
![Page 12: Art science practices and collaborations in bangalore, india](https://reader030.fdocuments.net/reader030/viewer/2022032616/55a8e3881a28ab3a6a8b47d8/html5/thumbnails/12.jpg)
International Genetically Engineered Machines competion
![Page 13: Art science practices and collaborations in bangalore, india](https://reader030.fdocuments.net/reader030/viewer/2022032616/55a8e3881a28ab3a6a8b47d8/html5/thumbnails/13.jpg)
![Page 14: Art science practices and collaborations in bangalore, india](https://reader030.fdocuments.net/reader030/viewer/2022032616/55a8e3881a28ab3a6a8b47d8/html5/thumbnails/14.jpg)
![Page 15: Art science practices and collaborations in bangalore, india](https://reader030.fdocuments.net/reader030/viewer/2022032616/55a8e3881a28ab3a6a8b47d8/html5/thumbnails/15.jpg)
![Page 16: Art science practices and collaborations in bangalore, india](https://reader030.fdocuments.net/reader030/viewer/2022032616/55a8e3881a28ab3a6a8b47d8/html5/thumbnails/16.jpg)
![Page 17: Art science practices and collaborations in bangalore, india](https://reader030.fdocuments.net/reader030/viewer/2022032616/55a8e3881a28ab3a6a8b47d8/html5/thumbnails/17.jpg)
Teenage Gene Poems(2009)
![Page 18: Art science practices and collaborations in bangalore, india](https://reader030.fdocuments.net/reader030/viewer/2022032616/55a8e3881a28ab3a6a8b47d8/html5/thumbnails/18.jpg)
BBa_K221000 Teenage gene Poems(2009)
• atgacgcaacagcccttccaactcccgcacttctacctgccgcaccccgcacggctcaacccgcatctcgacgaggcccgcgcccactcgacgacgtggg cgcgcgagatgggcatgctggagggctccggggtctgggagcagtccgacctcgaagcccacgactacggcctgctctgcgcctacacccaccccgactg cgacgggccggcgctctccctcatcaccgactggtacgtgtgggtcttcttcttcgacgaccacttcctggagaagtacaaacgcagccaggaccgcctc gccggcaaggcccacctggaccggctcccgctgttcatgccgctcgacgacgccgccgggatgcccgagccgcggaacccggtggaggccggactcgccg acctgtggacccgcacggtgcccgcgatgtcggccgactggcgccgccgcttcgccgtcgccaccgagcacctcctcaacgagtccatgtgggagctgtc caacatcaacgaggggcgggtcgccaacccggtcgagtacatcgagatgcgccgcaaggtcggcggcgccccgtggtcggccgggctcgtggagtacgcg accgccgaggtgcccgccgccgtcgccgggaccaggccgctcagggtgctgatggagacgttctccgacgccgtgcacctgcgcaacgacctcttctcct accagcgcgaggtcgaggacgagggcgagctgagcaacggggtgctggtgttggagaccttcttcggctgcaccacccaggaggccgccgacctggtcaa cgacgtcctcacctcgcggctgcaccagttcgagcacaccgcgttcaccgaggtgcccgccgtcgccctggagaagggcctgaccccgttggaggtcgcc gccgtcggcgcgtacacgaagggcctccaggactggcagtccggcggccacgagtggcacatgcgttccagccgctacatgaacaagggggagcggcccc tggccggctggcaggcgctgaccgggcccggcacctccgcggcggacgtgggagcactgctcgccgacgcggtcgcccaacgggcccgctcctacacg
![Page 19: Art science practices and collaborations in bangalore, india](https://reader030.fdocuments.net/reader030/viewer/2022032616/55a8e3881a28ab3a6a8b47d8/html5/thumbnails/19.jpg)
Synthetic/Post Natural Ecologies(2010)
![Page 20: Art science practices and collaborations in bangalore, india](https://reader030.fdocuments.net/reader030/viewer/2022032616/55a8e3881a28ab3a6a8b47d8/html5/thumbnails/20.jpg)
DIY LAB equipment
![Page 21: Art science practices and collaborations in bangalore, india](https://reader030.fdocuments.net/reader030/viewer/2022032616/55a8e3881a28ab3a6a8b47d8/html5/thumbnails/21.jpg)
DIY Lab Equipment
![Page 22: Art science practices and collaborations in bangalore, india](https://reader030.fdocuments.net/reader030/viewer/2022032616/55a8e3881a28ab3a6a8b47d8/html5/thumbnails/22.jpg)
Autonomous Public Lab
![Page 23: Art science practices and collaborations in bangalore, india](https://reader030.fdocuments.net/reader030/viewer/2022032616/55a8e3881a28ab3a6a8b47d8/html5/thumbnails/23.jpg)
Searching for Genetically Engineered Machines(2011)
![Page 24: Art science practices and collaborations in bangalore, india](https://reader030.fdocuments.net/reader030/viewer/2022032616/55a8e3881a28ab3a6a8b47d8/html5/thumbnails/24.jpg)
Searching for Genetically Engineered Machines(2011)
![Page 25: Art science practices and collaborations in bangalore, india](https://reader030.fdocuments.net/reader030/viewer/2022032616/55a8e3881a28ab3a6a8b47d8/html5/thumbnails/25.jpg)
Searching for Genetically Engineered Machines(2011)
![Page 26: Art science practices and collaborations in bangalore, india](https://reader030.fdocuments.net/reader030/viewer/2022032616/55a8e3881a28ab3a6a8b47d8/html5/thumbnails/26.jpg)
![Page 27: Art science practices and collaborations in bangalore, india](https://reader030.fdocuments.net/reader030/viewer/2022032616/55a8e3881a28ab3a6a8b47d8/html5/thumbnails/27.jpg)
Searching for Genetically Engineered Machines(2011)
![Page 28: Art science practices and collaborations in bangalore, india](https://reader030.fdocuments.net/reader030/viewer/2022032616/55a8e3881a28ab3a6a8b47d8/html5/thumbnails/28.jpg)
Biodesign for the Real World
LifePatch(Indonesia) + ArtScienceBLR(India) + EPFL(Swiss)
![Page 29: Art science practices and collaborations in bangalore, india](https://reader030.fdocuments.net/reader030/viewer/2022032616/55a8e3881a28ab3a6a8b47d8/html5/thumbnails/29.jpg)
Metamap.in
![Page 30: Art science practices and collaborations in bangalore, india](https://reader030.fdocuments.net/reader030/viewer/2022032616/55a8e3881a28ab3a6a8b47d8/html5/thumbnails/30.jpg)
SeasonWatch.in
National Center for Biological Sciences, Bangalore
![Page 31: Art science practices and collaborations in bangalore, india](https://reader030.fdocuments.net/reader030/viewer/2022032616/55a8e3881a28ab3a6a8b47d8/html5/thumbnails/31.jpg)
Migrantwatch.in
National Center for Biological Sciences, Bangalore
![Page 32: Art science practices and collaborations in bangalore, india](https://reader030.fdocuments.net/reader030/viewer/2022032616/55a8e3881a28ab3a6a8b47d8/html5/thumbnails/32.jpg)
GubbiLabs.in
![Page 33: Art science practices and collaborations in bangalore, india](https://reader030.fdocuments.net/reader030/viewer/2022032616/55a8e3881a28ab3a6a8b47d8/html5/thumbnails/33.jpg)
India’s most famous DIY hacker
![Page 34: Art science practices and collaborations in bangalore, india](https://reader030.fdocuments.net/reader030/viewer/2022032616/55a8e3881a28ab3a6a8b47d8/html5/thumbnails/34.jpg)
![Page 35: Art science practices and collaborations in bangalore, india](https://reader030.fdocuments.net/reader030/viewer/2022032616/55a8e3881a28ab3a6a8b47d8/html5/thumbnails/35.jpg)
Thank you
• Dr. Mukund Thattai, NCBS• Dr. Geetha Narayanan, Srishti• Dr. Marc Dusseiller, Dusjagr Labs, Hackteria• Dr. Sachiko Hirosue, EPFL• LifePatch