Supporting Information

Employing omics to elucidate the hormetic response against oxidative stress

exerted by nC60 on Daphnia pulex

Pu Wang1,4, Qinxiang Ng2, Bo Zhang1*, Zhikai Wei1, Muhammad Hassan1, Yiliang

He1, Choon Nam Ong3

1.School of Environmental Science & Engineering, Shanghai Jiao Tong University,

800 Dongchuan Road, Shanghai 200240, P. R. China

2. Department of Medicine, National University Hospital, National University Health

System, Singapore 119074

3. NUS Environmental Research Institute, National University of Singapore,

Singapore 117597, Singapore

4. Graduate School at Shenzhen, Tsinghua University, Shenzhen 518055, P. R. China

* Corresponding Author: Bo Zhang, School of Environmental Science & Engineering,

Shanghai Jiao Tong University, Email: zhangbo214@sjtu.edu.cn

Preparation method of nC60 suspension solution

The nC60 used in this experiment was prepared according to the reported study

(Hoecke et al., 2010). In brief, 50 ml of nC60 powder was added to 100 ml of ultrapure

water and then stirred at 2000 rpm (40°C) for 4 weeks. The mixture was filtered with

a 700 nm glass fiber membrane, decanting the suspended nC60 suspension and stored

at 4°C until further use.

RNA sequencing

TRIzol@ Reagent (Invitrogen, America) was used to extract the total RNA of D.

pulex from the tissue homogenate. According to manufacturer's Illumina instructions,

oligo (dT) beads were used to isolate poly-(A) mRNA from tRNA. To splice mRNA

into short fragments we added fragmentation buffer. These fragments were employed

as templates for random hexamer priming of single-stranded cDNA, which are

thenconverted to double-stranded cDNA by DNA polymerase. The cDNA paired-end

library was constructed using the Truseq RNA Sample Preparation Kit (Illumina,

American). End Repair Mix and sequencing adapter were used to repair and ligate the

resulting short fragment (Mortazavi et al., 2008). A sequencing library was first

constructed by PCR amplification and stained with TBS380 Pico green staining, then

quantified with an Agilent 2100 and sequenced using an Illumina Hiseq 4000

platform.

UPLC-QTOF/MS and GC-QTOF/MS parameters and methods

UPLC-QTOF/MS analysis was performed on an ultrahigh pressure liquid

chromatography system (ACQUITY Arc, Waters, USA) coupled with a QTOF mass

detector equip (Xevo G2-XS, Waters, USA) with an electrospray ionization (ESI)

source. Metabolites were separated using a HT Zorbax SB-C18 column (2.1×50 mm,

1.8 µm, Waters, USA) at 50oC, with on-line filter (0.22 µm pore size, Waters,

America). The mobile phase flow rate was 0.4 mL/min and the injection volume was

0.3 μL. Mass spectra of metabolites were obtained in positive and negative modes by

ESI. The positive mode mobile phase included ultrapure water with 0.1% formic acid

(A) and acetonitrile containing 0.1% formic acid (B), respectively. The negative phase

mobile phase was a mixture of ultrapure water and 5 mM ammonium acetate (A),

acetonitrile containing 5 mM ammonium acetate (B) and ultrapure water (95:5, v/v).

The gradient of mobile phase for both ESI+ and ESI- was as follows: 5% B increased

to 45% in 9 min, to 100% in 6 minutes and kept for 3 min, decreased to 5% in 2 min

and kept for 5 min. The total run time was 25 min. Ion source parameters for ESI+

and ESI- were as follows: drying gas flow rate of 12 L/min, gas temperature of

325oC, sheath gas flow rate of 11 L/min, sheath gas temperature of 350oC, and

nebulizer pressure of 40 psig. The acquisition rate was 400 ms/spectrum and the mass

scan range was 40-1100 m/z. Real time reference standards were used to maintain the

high mass accuracy. MS-MS analysis was performed using the collision energy of 10,

20, 30, and 40 eV to obtain the molecule ion fragmentation and identify possible

metabolites by comparison with the online database.

GC-QTOF/MS analysis was performed using a series injector (7683B, Agilent,

America) coupled with a series GC-MS (7890A, Agilent, America) and a Q-TOF

mass detector (7200, Agilent, America). The GC column was HP-5 MS UI (30

m×0.25 mm×0.25 um, Agilent, America) with the carrier gas of helium and the flow

rate was 1 mL/min. Injection volume was 0.2 µL in splitless mode under 250oC while

the transfer line temperature was set at 280oC. The oven temperature was maintained

at 90oC for 1 min, and then increased to 130oC at the rate of 20oC/min and to 280oC

at 6oC/min. It was then increased again to 300oC at the rate of 25oC/min and held for

6 min. The solvent cut time was 4.5 min and the GC total run time was 34.8 min. The

ion source was operated at 230°C in electron ionization (EI) mode. The TOF scans

range was 50-800 m/z.

Data process and multivariate statistical analysis

The data analysis protocol was adopted from previous publications (Gao et al.,

2013; Shao-Min et al., 2013). Briefly, the LC-MS and GC-MS data were transformed

to mzData files in MassHunter Qualitative Analysis software and then exported to

MZ-mine software to detect and align features. The aligned features were normalized

through the abundance of internal standard (FMOC-glycine) and weight or number of

Daphnia. After normalization, the aligned features were screened using the criteria of

relative standard deviation (RSD, 30%) and detection frequency (DF, 100%) for the

same feature in the same group (i.e. control group or exposure group). The features

that had higher RSDs (>30%) and lower DFs (<100%) in all groups were not included

for statistical analysis. After screening, the missing values of features (i.e. peak

height) were replaced by half minimum. Principle component analysis (PCA) and

orthogonal partial least squares discriminant analysis (OPLS-DA) were performed in

SIMCA-P. Kruskal-Wallis test for comparison of multiple groups (n > 2) was

performed in Multi Experiment Viewer software (MeV). The features with variable

importance in projection (VIP) scores above 1 in OPLS-DA model and p values lower

than 0.05 in Kruskal-Wallis test were considered to be statistically significant in

separating groups. These features were selected to identify their corresponding

metabolites.

Metabolites identification

The metabolites in UPLC-MS analysis were identified on the basis of accurate

mass of molecular ion and mass spectra of MS-MS by searching possible candidates

in online databases (METLIN and HMDB). The metabolites in GC-MS analysis were

identified on the basis of mass spectra and accurate mass of fragments by searching

NIST 11 library. Retention time index was applied to confirm the identification of

metabolites in GC-MS analysis. The retention time index of identified metabolite was

calculated and compared with reported value in NIST 11 library.

Figure S1. (a) Transmission electron micrograph of C60 in suspension. (b)

hydrodynamic diameters of C60 aggregates in suspension. (c) Zeta-potentials of

dispersed C60 in suspension. Error bars denote the standard deviation (SD) of the

mean (n = 3).

Figure S2．Changes of antioxidant enzymes with time and nC60 concentration (a)

GSH (b) SOD (Error bars denote the standard deviation (SD) of the mean (n = 6). *p

< 0.05)

Figure S3 (a) Relative expression level based on FPKM (b) Relative expression level

based on RT-qPCR (Error bars denote the standard deviation (SD) of the mean (n =

6))

Figure S4. PCA scores plot of all samples together with QC. (a)LC-Positive PCA

(R2X:0.685 Q2:0.652) (b) LC-Negative PCA (R2X:0.733 Q2:0.624) (c) GC PCA

(R2X:0.786 Q2:0.587)

Figure S5. PCA of metabolites of Daphnia pulex exposed to various concentrations of

nC60 for 7days. (R2X:0.887 Q2:0.759) (C: control, L: 0.1 mg/L treatment, M: 0.5

mg/L treatment, H: 1.5 mg/L treatment)

Table S1. SOD activity and GSH concentrations at different endpoints and nC60 concentrations. (SD: standard deviation )

SOD activity (U)2day 0 mg/L 0.1 mg/L 0.3 mg/L 0.5 mg/L 0.8 mg/L 1.0 mg/L 1.3 mg/L 1.5 mg/Ltest1 31.2 34.2 35.2 37.9 42.0 43.9 32.9 27.0test2 31.3 35.2 34.8 35.3 41.2 43.4 32.7 27.1test3 30.8 33.6 33.3 34.6 38.1 41.2 34.9 25.5test4 30.5 31.7 31.6 36.1 39.9 42.9 33.5 26.3test5 29.9 31.7 35.6 37.0 40.1 42.5 35.5 26.1test6 30.2 32.3 33.5 38.2 40.1 42.9 35.6 26.0

average 30.7 33.1 34.0 36.5 40.2 42.8 34.2 26.3SD 0.50 1.29 1.36 1.29 1.20 0.85 1.18 0.5606

P-value 0.13420 0.30073 0.03908 0.00069 5.38E-05 0.47329 0.000387day 0 mg/L 0.1 mg/L 0.3 mg/L 0.5 mg/L 0.8 mg/L 1.0 mg/L 1.3 mg/L 1.5 mg/Ltest1 32.7 41.1 55.1 60.9 55.0 40.9 29.0 15.9test2 31.5 42.6 54.9 62.1 53.2 42.3 30.2 16.6test3 31.9 41.9 50.1 58.7 49.1 36.4 32.4 13.2test4 33.6 45.2 52.1 56.2 50.0 37.1 28.1 16.1test5 33.7 45.9 50.5 59.2 51.0 36.9 26.2 18.9test6 30.1 45.9 53.5 58.9 51.9 37.0 26.9 17.9

average 32.3 43.8 52.7 59.3 51.7 38.4 28.8 16.4SD 1.26 1.96 1.98 1.88 1.97 2.29 2.09 1.77

P-value 0.00963 0.00134 0.00027 0.00118 0.39170 0.03133 0.0014214day 0 mg/L 0.1 mg/L 0.3 mg/L 0.5 mg/L 0.8 mg/L 1.0 mg/L 1.3 mg/L 1.5 mg/Ltest1 36.9 45.0 47.3 47.1 37.8 28.3 21.2 17.0test2 35.5 44.9 45.2 45.2 36.5 27.6 22.5 16.3test3 35.0 43.1 47.2 46.3 33.9 27.9 19.1 15.1test4 36.0 40.2 42.9 38.1 34.2 24.1 19.9 12.0test5 36.7 39.9 41.6 40.0 37.2 22.3 20.1 12.3test6 38.1 42.5 39.1 37.2 34.0 23.9 22.0 15.9

average 36.4 42.6 43.9 42.3 35.6 25.7 20.8 14.7

SD 1.01 2.00 2.98 4.00 1.62 2.33 1.18 1.93P-value 0.20507 0.65863 0.32530 0.38994 0.04765 7.84E-05 0.0002621day 0 mg/L 0.1 mg/L 0.3 mg/L 0.5 mg/L 0.8 mg/L 1.0 mg/L 1.3 mg/L 1.5 mg/Ltest1 40.3 35.6 33.6 35.0 24.1 24.0 20.1 10.2test2 42.1 32.2 34.2 35.0 27.8 25.5 19.5 14.2test3 42.6 33.3 32.1 33.2 24.1 25.6 18.9 12.3test4 39.6 30.1 30.1 29.1 27.6 25.3 16.2 12.1test5 41.8 35.9 30.0 30.1 29.1 24.0 16.0 15.2test6 42.0 32.5 29.0 33.9 27.5 23.0 16.1 15.1

average 41.4 33.3 31.5 32.7 26.7 24.5 17.8 13.2SD 1.06 2.00 1.95 2.31 1.92 0.99 1.75 1.80

P-value 0.14658 0.07749 0.13505 0.01189 0.00074 0.00062 6.61E-05GSH concentration (mg GSH/g protein)

2day 0 mg/L 0.1 mg/L 0.3 mg/L 0.5 mg/L 0.8 mg/L 1.0 mg/L 1.3 mg/L 1.5 mg/Ltest1 5.45 8.01 9.02 10.0 10.5 12.0 9.58 9.01test2 5.74 7.12 8.12 9.96 11.2 11.5 10.1 8.85test3 5.62 7.53 7.99 9.01 11.0 11.0 10.0 8.96test4 5.012 7.44 8.02 8.88 10.6 10.9 9.95 8.01test5 5.36 7.16 8.66 8.96 10.3 10.8 9.65 7.99test6 6.02 6.98 8.95 8.56 11.1 9.86 9.12 8.42

average 5.53 7.37 8.46 9.23 10.8 11.0 9.74 8.54SD 0.31 0.34 0.43 0.55 0.32 0.66 0.33 0.426

P-value 0.70454 0.02460 0.05059 8.54E-05 0.02555 0.01307 0.012407day 0 mg/L 0.1 mg/L 0.3 mg/L 0.5 mg/L 0.8 mg/L 1.0 mg/L 1.3 mg/L 1.5 mg/Ltest1 5.85 8.54 12.8 12.1 13.0 8.72 6.69 4.78test2 6.65 10.2 11.2 13.5 13.0 9.32 6.21 4.21test3 6.32 10.1 12.3 12.5 12.8 9.97 6.03 4.46test4 5.73 9.98 11.6 13.0 13.1 9.90 6.35 4.66test5 7.25 8.46 12.3 13.2 13.3 8.65 5.68 4.31test6 6.58 8.65 11.5 13.6 13.0 9.13 5.88 3.21

average 6.40 9.33 11.9 13.0 13.0 9.28 6.14 4.27

SD 0.51 0.78 0.55 0.53 0.14 0.51 0.32 0.51P-value 0.00157 2.04E-05 8.05E-07 5.14E-07 0.00246 0.51050 0.0028814day 0 mg/L 0.1 mg/L 0.3 mg/L 0.5 mg/L 0.8 mg/L 1.0 mg/L 1.3 mg/L 1.5 mg/Ltest1 7.23 11.0 8.99 8.02 7.02 5.62 5.52 4.25test2 7.01 10.9 9.45 8.22 7.00 5.99 5.02 4.00test3 6.85 11.0 9.63 7.02 6.62 6.63 4.44 3.89test4 6.91 10.2 10.0 7.11 6.12 4.32 5.96 3.21test5 7.01 9.99 9.02 8.01 6.00 5.23 4.01 2.99test6 7.12 10.5 8.96 8.44 4.98 5.62 4.65 3.52

average 7.02 10.6 9.34 7.80 6.29 5.57 4.93 3.64SD 0.12 0.40 0.39 0.54 0.70 0.70 0.65 0.44

P-value 6.02E-05 0.00140 0.12115 0.71546 0.06404 0.00813 9.1E-0521day 0 mg/L 0.1 mg/L 0.3 mg/L 0.5 mg/L 0.8 mg/L 1.0 mg/L 1.3 mg/L 1.5 mg/Ltest1 7.12 6.98 5.89 5.98 5.02 5.01 3.88 3.00test2 6.99 7.22 5.45 5.88 5.33 5.09 4.00 2.56test3 6.59 7.56 6.32 6.60 4.21 4.02 3.00 2.98test4 7.12 6.43 6.22 5.01 4.45 3.99 2.99 3.12test5 7.02 6.11 6.65 5.23 5.21 4.01 4.01 3.30test6 7.36 7.75 6.05 5.16 4.98 3.96 4.11 2.89

average 7.03 7.01 6.10 5.64 4.87 4.35 3.66 2.97SD 0.22 0.58 0.37 0.56 0.40 0.49 0.47 0.22

P-value 0.93384 0.06971 0.09131 0.00034 0.00104 7.11E-05 1.07E-05

Table S2 Physiological responses of Daphnia pulex after 21-dexposure to C60

C60 concentration (mg/L) Average length after 21days (mm)

Average dry mass per Daphnia after 21 days (mg) Average neonate per living parent

Control 1.945±0.021 0.2831±0.0324 20±2.30.1 2.005±0.071 0.3154±0.0561 11±1.80.5 2.069±0.093 0.3436±0.0683 9±1.21.5 1.961±0.033 0.2848±0.0721 12±2.2

Table S3. Signal of typical m/z of identified compounds by GC-MS and LC-MS and analysis of identified compounds

Compound Platform RT M/Z Formula GroupP-value VIP Average Area

LvsC MvsC HvsC LvsC MvsC HvsC C L M H

Phenylalanine GC 0.470 166.0863 C9H11NO2 Amino acids 0.0150 0.8160 0.0260 0.27 0.59 1.04 75048.44 85354.06 88249.85 91243.88

2-Oxoglutarate GC 2.636 146.0215 C5H6O5 Organic acids 0.0127 0.0035 0.0009 2.10 2.65 4.14 59631.69 217940.10 245240.08 59785.54

L-Valine GC 4.010 116.0140 C5H11NO2 Amino acids 0.0301 0.0773 0.0704 0.17 0.15 0.16 99625.00 127518.50 89678.65 93053.33

Citrate GC 4.824 251.1142 C9H12O7 Lipids 0.0063 0.0069 0.0063 1.32 1.58 1.41 233988.65 200631.23 154692.24 177562.29

L-Tyrosine GC 5.191 181.0699 C9H11NO3 Amino acids 0.0358 0.0471 0.0429 0.75 0.53 0.24 248012.40 307534.60 324895.60 335488.59

L-Leucine GC 5.320 131.0946 C6H13NO2 Amino acids 0.0283 0.1602 0.1459 0.83 0.33 0.40 32947.35 48102.02 54757.88 60159.14

Succinic acid GC 5.695 119.0345 C4H6O4 Organic acids 0.9638 0.9647 0.8789 0.36 0.66 0.59 192594.79 182851.90 176762.30 175795.72

Uracil GC 6.170 112.0273 C4H4N2O2 Pyrimidines 0.6700 0.2739 0.2495 0.64 0.01 0.02 48284.90 39798.94 32965.70 30221.79

L-cysteine GC 6.530 121.0197 C3H7NO2S Amino acids 0.0003 0.0002 0.0001 2.57 3.99 3.17 51018.17 397316.23 408955.01 113333.80

L-Aspartic acid GC 6.817 134.0439 C4H7NO4 Amino acids 0.0124 0.1821 0.1659 1.26 0.09 0.15 363241.18 472213.50 559349.40 563109.31

Aspartate GC 8.140 133.0375 C4H7NO4 Amino acids 0.0247 0.0131 0.0070 2.46 3.65 3.17 32366.07 54914.87 64406.87 28667.93

Arginine GC 8.900 174.1117 C6H14N4O2 Amino acids 0.0361 0.0281 0.0218 2.09 2.64 3.91 566338.45 756956.64 939487.52 434613.79

Stearamide GC 9.180 284.2948 C18H37NO Fatty amides 0.7236 0.8810 0.1390 1.37 0.21 0.44 72585.84 85030.65 90553.74 96435.58

Glutamate GC 10.064 147.0532 C5H9NO4 Amino acids 0.0251 0.0136 0.0073 1.94 2.26 2.08 55943.69 167975.40 221845.81 27332.41

Eicosapentaenoic acid GC 10.396 149.0589 C9H8O2 Organic acids 0.1714 0.0304 0.0277 0.68 0.65 0.35 257608.80 363542.90 557071.90 578022.69

9,12-Octadecadiynoic acid GC 12.160 275.2016 C18H28O2 Fatty acids 0.0749 0.3180 0.0340 1.01 0.98 0.68 74854.77 79504.30 76766.03 74122.08

Pinolenic acid GC 12.620 277.2173 C18H30O2 Fatty acids 0.2400 0.6600 0.0450 0.75 0.36 0.75 70984.88 74046.57 70218.46 66588.27

Glycerophosphocholine GC 12.730 180.1600 C6H12O6 Carbohydrates 0.0256 0.6195 0.5643 0.60 0.60 0.54 1691852.45 1473086.00 1641884.00 1525730.64

Myoinositol GC 13.298 259.1175 C6H12O6 Carbohydrates 0.1034 0.6012 0.5477 0.82 1.45 1.30 79327.32 42611.40 60759.18 58831.21

D-Glucose GC 15.480 180.0634 C6H12O6 Carbohydrates 0.0371 0.0022 0.0048 1.27 1.50 1.35 604801.15 516892.09 415839.50 571611.48

L-Lysine GC 15.530 146.1055 C6H14N2O2 Amino acids 0.0225 0.7725 0.7038 0.22 1.03 0.50 88108.60 115421.90 158594.90 155905.02

L-Threonine GC 18.230 119.1200 C4H9NO3 Fatty acids 0.0242 0.2529 0.2304 0.30 0.09 0.17 464690.00 604448.20 697035.10 658187.96

Palmitic acid GC 18.882 255.2319 C16H32O2 Fatty acids 0.0387 0.5935 0.5407 0.90 1.29 1.16 101412.82 39321.02 73719.79 79951.14

Stearic acid GC 20.110 284.2715 C18H36O2 Fatty acids 0.0984 0.6955 0.6336 0.91 0.75 0.61 132518.03 62361.53 101746.50 105646.34

L-Arginine LC 0.307 175.1186 C6H14N4O2 Amino acids 0.3863 0.0039 0.0353 1.44 0.54 0.48 127884.08 186568.90 773175.60 734784.92

Pyruvate LC 0.307 88.0160 C3H4O3 Organic acids 0.0096 0.0020 0.0004 2.84 4.88 4.18 109786.39 369519.05 562255.32 83323.98

Inosine LC 0.337 267.0734 C10H12N4O5 Nucleosides 0.3207 0.0286 0.0261 1.03 0.24 0.99 8193.51 15504.10 20617.76 19695.37

Uridine LC 0.337 243.0610 C9H12N2O6 Nucleosides 0.0087 0.0011 0.0010 1.25 1.60 1.43 20498.81 11337.29 9225.09 9336.32

L-Histidine LC 0.358 156.0760 C6H9N3O2 Amino acids 0.5685 0.8269 0.7533 0.78 0.23 0.20 17262.10 17953.91 17475.26 17053.88

L-Proline LC 0.375 116.0700 C5H9NO2 Amino acids 0.0139 0.0403 0.0367 0.55 0.78 0.70 627085.23 454859.20 483399.30 488702.05

Guanine LC 0.460 152.0561 C5H5N5O Purines 0.3782 0.7988 0.7277 1.36 0.54 0.49 409338.14 452715.80 415102.70 376376.30

Hypoxanthine LC 0.460 137.0455 C5H4N4O Purines 0.7855 0.0017 0.0002 1.32 0.92 0.83 535617.87 653587.10 43554.59 40857.53

Isocitrate LC 0.460 192.0270 C6H8O7 Organic acids 0.0029 0.0002 0.0000 3.17 6.06 3.62 130879.05 248500.05 261943.94 43522.52

Malate LC 0.460 135.0295 C4H6O5 Organic acids 0.0048 0.0295 0.0269 1.49 1.56 1.50 133433.56 226646.25 266410.79 88405.07

Tryptophan LC 0.520 205.0972 C11H12N2O2 Amino acids 0.0060 0.4630 0.0180 1.23 0.61 0.84 42551.77 44748.48 42780.53 40899.13

L-Tryptophan LC 0.520 205.0972 C11H12N2O2 Amino acids 0.0201 0.0131 0.0119 1.10 0.98 0.88 93853.68 138902.30 167058.30 175343.67

Fumarate LC 0.520 116.0110 C4H4O4 Organic acids 0.0029 0.0002 0.0000 2.57 3.98 2.94 63810.48 170364.42 340555.27 42255.94

L-Phenylalanine LC 2.872 166.0848 C9H11NO2 Amino acids 0.7870 0.0002 0.0002 1.32 0.92 0.83 535617.87 653587.10 43554.59 46826.88

D-Galactose LC 4.860 180.1600 C6H12O6 Carbohydrates 0.0985 0.0123 0.0112 0.56 0.49 0.44 31304.01 41957.89 44317.43 41798.15

L-Isoleucine LC 5.700 290.1880 C16H20N2O3 Amino acids 1.2446 1.9836 1.8071 0.04 0.99 0.88 63144.43 76468.54 125656.70 117167.72

Glycine LC 5.780 1313.0000 C2H5NO2 Amino acids 0.0090 0.0037 0.0150 1.32 1.80 1.86 71503.08 133318.43 169082.39 49884.23

Dodecanoic acid LC 5.780 199.1940 C12H24O2 Fatty acids 0.0193 0.0036 0.0032 1.93 1.45 1.30 23763.94 27480.53 31455.89 32941.73

Hexadecanedioic acid LC 5.810 381.2550 C16H28O4 Organic acids 0.3763 0.0000 0.0000 0.82 0.30 0.16 56861.79 50399.83 285152.30 278601.53

Succinate LC 5.810 118.0266 C4H6O4 Organic acids 0.0415 0.0371 0.0331 2.11 2.69 2.61 52216.79 225920.14 260905.39 52664.81

Nonanoic acid LC 6.360 1359.0000 C9H18O2 Fatty acids 0.6830 0.4710 0.0090 0.34 0.26 0.00 71826.43 76305.62 73694.66 71173.05

L-Serine LC 6.490 1368.0000 C3H7NO3 Amino acids 0.0140 0.3100 0.0040 1.38 0.73 0.49 77221.72 91737.50 99074.44 106998.18

α-Linolenoyl-ACP LC 6.530 322.2740 C20H35NO2 Amines 0.0191 0.0310 0.0230 1.02 1.18 1.11 52425.16 62469.12 67670.32 73304.59

Stearidonic acid LC 6.866 291.2303 C19H30O2 Fatty acids 0.0446 0.0236 0.0215 1.10 0.80 0.71 63144.43 62512.54 43569.57 42162.34

2-hexadecenal LC 8.120 239.2369 C16H30O Lipids 0.4340 0.0080 0.0190 0.50 1.52 0.68 59856.46 70507.65 75503.78 80853.94

1-Monopalmitin LC 8.120 331.2843 C19H38O4 Lipids 0.0423 0.0080 0.0090 1.55 1.58 1.10 55895.72 65555.63 69895.43 74522.52

Arachidic acid LC 8.140 312.5300 C20H40O2 Fatty acids 0.6423 0.0075 0.0069 1.69 0.36 0.32 127956.17 145731.80 219578.60 216343.60

Oleic acid LC 8.860 283.2632 C18H34O2 Fatty acids 0.1079 0.9651 0.8792 1.20 0.56 0.50 152539.68 90549.98 137986.90 149386.23

L-Pyroglutamic acid LC 8.900 1531.0000 C5H7NO3 Amino acids 0.0090 0.0550 0.0100 0.16 0.09 0.15 74371.19 78788.47 75880.11 73079.11

Linoelaidic acid LC 9.240 281.2475 C18H32O2 Lipids 0.0658 0.0728 0.0256 1.20 1.01 0.90 60858.74 46860.93 31037.79 32181.50

Cinnamic acid LC 9.430 149.0597 C9H8O2 Organic acids 0.0241 0.4924 0.4485 1.08 0.94 0.84 37722.70 18708.53 29267.62 32187.72

Arabonate LC 9.430 148.0520 C5H10O5 Organic acids 0.7954 0.0112 0.0102 0.84 0.25 0.12 59461.73 63727.30 366883.10 337674.44

Alpha-Linolenic acid LC 10.064 277.2165 C18H29O2 Fatty acids 0.9330 0.9597 0.8743 1.08 0.67 0.60 660068.12 609378.20 622165.30 607428.52

Putrescine LC 12.470 1751.0000 C4H12N2 Amines 0.0030 0.0390 0.0060 2.23 1.23 1.05 65202.43 67286.89 63125.45 59221.37

glycerate LC 15.530 106.0266 C3H6O4 Organic acids 0.0084 0.0015 0.0003 2.79 4.70 3.04 51356.84 79717.64 84886.70 34141.00

Maltose LC 27.400 2817.0000 C12H22O11 Sugars 0.0020 0.0020 0.0050 0.55 0.68 0.98 69500.80 74606.09 72805.82 71048.98

Table S4. Total RNA was checked using NanoDrop 2000 UV-Vis Spectrophotometer. (C: control, L: 0.1 mg/L treatment, M: 0.5 mg/L treatment,

H:1.5 mg/L treatment)

Swimming Lane (No.) Samples (No.) Concentration (ng/μL) 260/280 260/230 Volume (μL) Total RNA (μg)

1 C1 547.1389 1.98 2.49 45 23.0563 2 C2 428.6613 1.98 2.15 45 22.2297 3 C3 510.8896 1.98 2.39 45 23.4391 4 C4 482.4599 1.98 2.48 45 24.1555 5 C5 569.4496 1.98 2.51 45 25.0583 6 C6 464.6253 1.98 1.21 45 75.3773 7 L1 452.5191 1.96 2.73 45 22.7516 8 L2 317.8554 1.98 2.33 45 16.0042 9 L3 524.1261 1.97 2.24 45 22.4515 10 L4 457.0507 1.94 2.35 45 21.8037 11 L5 557.9498 1.95 2.47 45 23.9720 12 L6 464.3929 1.84 2.43 45 12.8520 13 M1 448.0680 1.88 2.24 45 19.5296 14 M2 449.9502 1.94 2.63 45 21.9283 15 M3 460.2090 1.90 2.57 45 20.8553 16 M4 483.7934 1.94 2.41 45 18.5309

17 M5 566.2592 1.93 2.69 45 19.3467 18 M6 462.7081 1.92 2.62 45 21.6833 19 H1 491.9241 1.88 2.48 45 27.0069 20 H2 318.8588 1.95 2.26 45 24.5212 21 H3 516.2869 1.91 2.48 45 30.8445 22 H4 419.6566 1.89 2.32 45 22.7679 23 H5 577.6153 1.96 2.39 45 19.4223 24 H6 424.6730 1.94 2.57 45 18.2783

Table S5. The paired-end raw reads for four samples (C: control, L: 0.1 mg/L exposure, M: 0.5 mg/L exposure, H: 1.5 mg/L exposure)

Sample Raw reads Clean Reads Total Bases Error% Q20% Q30% GC%

C 62745143 61436746 9135593099 0.0123 98.31 94.95 46.96

H 59835786 57575772 8569043900 0.0121 98.35 95.15 46.48

L 59094116 58659040 8725166966 0.0123 98.31 94.95 46.43

M 58725802 57872228 8610577002 0.0122 98.3 95.01 46.9

Table S6. Annotation of transcripts and unigenes of Daphnia pulex

DatabaseNumber of annotated

transcriptsPercent of annotated transcripts (%) Number of annotated unigenes Percent of annotated unigenes (%)

Pfam 84719 39.36 23503 29.65

String 31434 14.6 8816 11.12

KEGG 77678 36.09 27199 34.32

Swissprot 89690 41.67 28950 36.53

NR 140981 65.49 45615 57.55

Table S7. Statistics of changed genes between experiment and control groups (C: control, L: 0.1 mg/L treatment, M: 0.5 mg/L treatment, H: 1.5

mg/L treatment)

Experiment group Up-regulated Down-regulated Unchanged genes

C vs L 11550 11905 55802

C vs M 12712 10776 55769

C vs H 12229 10981 56047

Table S8. Primer sequences for the RT-qPCR analyses.Gene ID Primer sequences (5'to3'） Base number

3635.36760-1F TGAACATGGCATCGTCACCA 20

3635.43414-2R GCGTTACCATGAAATCGGGC 20

3635.8137-1F GATCATCGAGCGTGACTCGT 20

3635.8137-1R AATTGTGGCGAGTAAGGCCA 20

3635.36760-1F TGAACATGGCATCGTCACCA 20

3635.36760-1R CATCTTCTCACGGTTGGCCT 20

3635.36000-1F CCAGATCATTCCTACGGCCC 20

3635.36760-1R CATCTTCTCACGGTTGGCCT 20

3635.20104-1F TGAGGTAGCCGTCTGCTAGT 20

3635.20104-1R AACACGCAATCAGAGAGCCA 20

3635.20410-1F CCAACCGCACAACATTCCTG 20

3635.20410-1R TCAGTTTTCACGCCTCTCCC 20

3635.21348-1F CACGTTGTTTGGCGCTGTAA 20

3635.21348-1R CAGTGTTGACGGCCAAAAGG 20

3635.35479-1F GCCATGGAGGCCTTTCTCTT 20

3635.35479-1R TTGGCAGCAGCTATCTTCCC 20

3635.41053-1F GTGGACGGTATTATCGGCGT 20

3635.41053-1R TGCATCGACCCAAGACGAAA 20

3635.43414-2F TCCGAGTGAATAGGCCTGGA 20

3635.32118-1F GGGAGGCTGGTGAGTGTAAC 20

3635.32118-1R CAAATTCGCTAGCGTTGCCA 20

3635.35560-1F AATTGAACGCTCTCGGTGGT 20

3635.35560-1R TCCGTTCTTCCAGGCTTGTC 20

3635.37038-1F AATTGAACGCTCTCGGTGGT 20

3635.37038-1R TCCGTTCTTCCAGGCTTGTC 20

3635.36000-1R ACGACGATTGAGCACACCAT 20

3635.38598-1F AATTGAACGCTCTCGGTGGT 20

3635.38598-1R TCCGTTCTTCCAGGCTTGTC 20

3635.31974-1F TCCATTGAGTAGGCAAGCCC 20

3635.31974-1R TTGAACTGGCTGACGAGCAT 20

3635.35708-1F AATTGAACGCTCTCGGTGGT 20

3635.35708-1R TCCGTTCTTCCAGGCTTGTC 20

3635.34892-1F CAAGACGCCCTTCCATGAGT 20

3635.34892-1R CTTTGGCCGTCTGTTGTTGG 20

1334.00000-1F ACAGGGGAAGGGGTCAGATT 20

1334.00000-1R CTCTCCCCTACTCCACCGAA 20

3635.36573-1F GGTCAGAACTCCCTTCCACG 20

3635.36573-1R GTTACACTCACCAGCCTCCC 20

Reference

Gao, L., Wen, Z., Wu, C., Wen, T., Ong, C.N., 2013. Metabolic Profiling of Plasma from Benign and Malignant Pulmonary Nodules Patients Using Mass Spectrometry-Based Metabolomics. Metabolites 3, 539-551.Hoecke, K.V., Schamphelaere, K.D., Meeren, P.V.d., Lucas, S., Janssen, C., 2010. Ecotoxicity of silica nanoparticles to the green alga Pseudokirchneriella subcapitata: importance of surface area.

Environmental Toxicology and Chemistry 27, 1948-1957.Mortazavi, A., Williams, B.A., McCue, K., Schaeffer, L., Wold, B., 2008. Mapping and quantifying mammalian transcriptomes by RNA-Seq. Nat Methods 5, 621-628.Shao-Min, H., Fengguo, X., Siew Hong, L., Zhiyuan, G., Choon Nam, O., 2013. Metabolomics of developing zebrafish embryos using gas chromatography- and liquid chromatography-mass spectrometry. Molecular Biosystems 9, 1372-1380.