ars.els-cdn.com · Web viewSupplementary material Cophylogenetic patterns in algal symbionts...

17
Supplementary material Cophylogenetic patterns in algal symbionts correlate with repeated symbiont switches during diversification and geographic expansion of lichen-forming fungi in the genus Sticta (Ascomycota, Peltigeraceae) Hanna Lindgren, Bibiana Moncada, Robert Lücking, Nicolas Magain, Antoine Simon, Bernard Goffinet, Emmanuël Sérusiaux, Matthew P. Nelsen, Joel A. Mercado-Díaz, Todd J. Widhelm, H. Thorsten Lumbsch Supplementary Table 1. Specimens included in this study and the Genbank accession codes of their DNA sequences. Species DNA# Locality Voucher Photobiont Photobiont sequences Mycobiont sequences rbcL 18S ITS nuLSU Mcm7 Sticta aff. granatensis 7382 Ecuador Dal Forno 1787b Symbiochloris MT31668 8 MT31440 5 MG367416 MG062990 - S. aff. laciniosa 7226 CostaRica Moncada 5789 Symbiochloris MT31667 6 - MG367401 MG062988 MF984240 S. ainoae UCONN4148 Chile Goffinet 12691 Symbiochloris MT31659 1 MT31436 0 MG457927 MG458140 MT316689 S. caperata LG386 Reunion Sérusiaux Heveochlorella MT31660 9 MT31437 3 MG457929 - - S. caperata LG625 Reunion Sérusiaux Heveochlorella MT31661 0 MT31434 7 MG457934 - - S. caperata LG626 Reunion Sérusiaux Heveochlorella MT31662 0 MT31437 4 MG457935 MT314325 MT316727 S. caperata LG627 Reunion Sérusiaux Heveochlorella MT31662 1 MT31437 5 MG457936 MT314305 MT316728 S. caperata LG962 Reunion Magain & Sérusiaux Heveochlorella MT31661 7 MT31435 8 JQ735979 JQ735996 MT316735 S. caperata LG994 Reunion Magain & Sérusiaux Heveochlorella MT31661 2 MT31438 2 MG457960 MT314311 MT316737 1

Transcript of ars.els-cdn.com · Web viewSupplementary material Cophylogenetic patterns in algal symbionts...

Page 1: ars.els-cdn.com · Web viewSupplementary material Cophylogenetic patterns in algal symbionts correlate with repeated symbiont switches during diversification and geographic expansion

Supplementary material

Cophylogenetic patterns in algal symbionts correlate with repeated symbiont switches during diversification and geographic expansion of lichen-forming fungi in the genus Sticta (Ascomycota, Peltigeraceae)

Hanna Lindgren, Bibiana Moncada, Robert Lücking, Nicolas Magain, Antoine Simon, Bernard Goffinet, Emmanuël Sérusiaux, Matthew P. Nelsen, Joel A. Mercado-Díaz, Todd J. Widhelm, H. Thorsten Lumbsch

Supplementary Table 1. Specimens included in this study and the Genbank accession codes of their DNA sequences.

Species DNA# Locality Voucher PhotobiontPhotobiont sequences Mycobiont sequencesrbcL 18S ITS nuLSU Mcm7

Sticta aff. granatensis 7382 Ecuador Dal Forno 1787b SymbiochlorisMT31668

8MT31440

5 MG367416 MG062990 -

S. aff. laciniosa 7226 CostaRica Moncada 5789 SymbiochlorisMT31667

6 - MG367401 MG062988 MF984240

S. ainoae UCONN4148 Chile Goffinet 12691 SymbiochlorisMT31659

1MT31436

0 MG457927 MG458140 MT316689

S. caperata LG386 Reunion Sérusiaux HeveochlorellaMT31660

9MT31437

3 MG457929 - -

S. caperata LG625 Reunion Sérusiaux HeveochlorellaMT31661

0MT31434

7 MG457934 - -

S. caperata LG626 Reunion Sérusiaux HeveochlorellaMT31662

0MT31437

4 MG457935 MT314325 MT316727

S. caperata LG627 Reunion Sérusiaux HeveochlorellaMT31662

1MT31437

5 MG457936 MT314305 MT316728

S. caperata LG962 Reunion Magain & Sérusiaux HeveochlorellaMT31661

7MT31435

8 JQ735979 JQ735996 MT316735

S. caperata LG994 Reunion Magain & Sérusiaux HeveochlorellaMT31661

2MT31438

2 MG457960 MT314311 MT316737

S. cinereoglauca 10080 New Zealand de Lange & Baird CH2547 SymbiochlorisMT31668

4MT31440

6 - - -

S. dichotoma LG632 Reunion van den Boom HeveochlorellaMT31661

1MT31435

3 MG457938 MT314306 MT316729

S. dichotoma LG646 Reunion Sérusiaux HeveochlorellaMT31662

4MT31437

7 MG457946 MT314316 MT316731

S. dichotoma LG647 Reunion Sérusiaux HeveochlorellaMT31662

5MT31437

9 MG457947 MT314308 MT316732

1

Page 2: ars.els-cdn.com · Web viewSupplementary material Cophylogenetic patterns in algal symbionts correlate with repeated symbiont switches during diversification and geographic expansion

S. dichotoma LG1005 Reunion Magain & Sérusiaux HeveochlorellaMT31662

9 - MG457963 MG458085 MT316738

S. dichotoma LG1050 Reunion Magain & Sérusiaux HeveochlorellaMT31663

0MT31435

6 MG457966 MT314312 MT316739

S. filix 10079 New Zealand de Lange 12557 ElliptochlorisMT31667

7MT31442

0 MT279736 MT314289 -

S. filix 15075 New Zealand Lücking et al. 38851 ElliptochlorisMT31659

4MT31436

4 MT279728 MT314319 MT316724

S. filix 15076 New Zealand Lücking et al. 39009 ElliptochlorisMT31659

2MT31436

5 MT279729 MT314320 -

S. filix 15077 New Zealand Lücking et al. 38148 ElliptochlorisMT31659

3MT31437

0 MT279730 MT314321 MT316725

S. filix 15078 New Zealand Lücking et al. 38107 ElliptochlorisMT31659

5MT31437

1 MT279731 MT314303 MT316749

S. filix 15079 New Zealand Lücking et al. 38112 ElliptochlorisMT31659

6MT31436

6 MT279727 MT314304 MT316726

S. filix 13785 New Zealand Lücking et al. 38864 ElliptochlorisMT31659

7MT31436

7 MF373770 MT314291 MT316709

S. filix 13790 New Zealand Lücking et al. 38190 Elliptochloris -MT31436

8 MF373775 MT314334 MT316742

S. filix 13792 New Zealand Lücking et al. 39003 ElliptochlorisMT31659

8MT31436

9 MF373777 MT314278 -

S. laciniata 7223 CostaRica Moncada 5778 SymbiochlorisMT31667

8 - MG367399 MG062984 -

S. laciniosa 14985 Cuba Mercado-Díaz CoccomyxaMT31660

1 - - - -

S. laciniosa 14991 Cuba Mercado-Díaz CoccomyxaMT31659

9 - - - -

S. laciniosa 14992 Cuba Mercado-Díaz CoccomyxaMT31660

0 - - - -

S. latifrons 10076 New Zealand Lücking et al. 38763 HeveochlorellaMT31660

2MT31438

7 MF373786 MT314287 MT316707

S. latifrons 13826 New Zealand Lücking et al. 38657 HeveochlorellaMT31667

9MT31439

0 MF373785 MT314279 MT316694

S. latifrons 15059 New Zealand Lücking et al. 38669 HeveochlorellaMT31668

1MT31439

1 MT279738 MT314293 MT316711

S. latifrons 15060 New Zealand Lücking et al. 38447 HeveochlorellaMT31668

2 - MT279739 MT314294 MT316746

S. latifrons 15061 New Zealand Lücking et al. 38662 HeveochlorellaMT31667

0MT31435

7 MT279718 MT314295 MT316712

S. latifrons 15064 New Zealand Lücking et al. 38318 HeveochlorellaMT31666

0MT31434

4 MT279741 MT314336 MT316745

S. latifrons 13822 New Zealand Lücking et al. 38327 HeveochlorellaMT31665

4 - MF373781 MT314328 MT3166932

Page 3: ars.els-cdn.com · Web viewSupplementary material Cophylogenetic patterns in algal symbionts correlate with repeated symbiont switches during diversification and geographic expansion

S. latifrons 15065 New Zealand Lücking et al. 38357 ChloroidiumMT31665

5 - MT279720 MT314299 MT316715

S. latifrons 15073 New Zealand Lücking et al. 38202 ChloroidiumMT31666

4MT31435

9 MT279725 MT314302 MT316722

S. lobarioides 5028 Colombia Alfonso 5 SymbiochlorisMT31668

7 - KC732555 MT314323 MT316755

S. menziesii 13829 New Zealand Lücking et al. 39001 ElliptochlorisMT31665

1MT31439

7 MF373788 MG063014 MF984254

S. menziesii 13834 New Zealand Lücking et al. 39010 ElliptochlorisMT31664

3MT31441

4 MF373793 - MT316754

S. menziesii 13828 New Zealand Lücking et al. 38008 ElliptochlorisMT31660

6MT31439

6 MF373787 MT314280 MT316695

S. menziesii 13833 New Zealand Lücking et al. 38009 ElliptochlorisMT31664

4MT31439

9 MF373792 MT314330 -

S. menziesii 15072 New Zealand Lücking et al. 38048 ElliptochlorisMT31664

7MT31441

2 MT279724 MT314301 MT316721

S. menziesii 13831 New Zealand Lücking et al. 38194 ElliptochlorisMT31664

5MT31439

8 MF373790 MT314282 MT316697

S. menziesii 13830 New Zealand Lücking et al. 38782 ElliptochlorisMT31666

3MT31441

3 MF373789 MT314329 MT316696

S. menziesii 15074 New Zealand Lücking et al. 38941 ElliptochlorisMT31664

8MT31439

4 MT279726 MT314318 MT316723

S. puracensis 6198 Colombia Díaz L1 SymbiochlorisMT31668

5MT31442

1 KC732701 MT314285 MT316756

S. sp. 4676 Colombia Moncada 10475 SymbiochlorisMT31666

6MT31440

2 MT279712 MT314332 MT316702

S. sp. 4677 Colombia Moncada 10473 SymbiochlorisMT31666

7MT31440

3 MT279734 MT314284 MT316703

S. sp. 4691 Colombia Moncada 10580 SymbiochlorisMT31665

3MT31441

7 - - MT316704

S. sp. 4704 Colombia Moncada 10478 SymbiochlorisMT31666

8MT31441

8 - - MT316705

S. sp. 4758 Colombia Moncada 10519 SymbiochlorisMT31666

9MT31440

4 - - MT316706

S. sp. 2 LG4074 Madagascar Sérusiaux HeveochlorellaMT31663

5 - MG457996 MG458107 -

S. sp. 4 LG4083 Madagascar Sérusiaux HeveochlorellaMT31663

7MT31434

9 MG458001 MG458110 MT316750

S. sp. 5 LG4110 Madagascar Sérusiaux HeveochlorellaMT31664

0 - MG458022 MG458120 -

S. sp. 6 LG4084 Madagascar Sérusiaux Heveochlorella -MT31437

6 MG458002 MG458111 MT316751

S. sp. 6 LG4088 Madagascar Sérusiaux HeveochlorellaMT31661

8MT31438

3 MG458006 MT314317 MT3167403

Page 4: ars.els-cdn.com · Web viewSupplementary material Cophylogenetic patterns in algal symbionts correlate with repeated symbiont switches during diversification and geographic expansion

S. sp. 6 LG4102 Madagascar Sérusiaux HeveochlorellaMT31661

6MT31438

4 MG458015 MT314314 MT316752

S. sp. 6 LG4139 Madagascar Sérusiaux HeveochlorellaMT31664

1 - MG458029 MT314315 -

S. sp. 8 LG4109 Madagascar Sérusiaux HeveochlorellaMT31663

9 - MG458021 MG458119 -

S. sp. 10 LG3453 Mauritius Sérusiaux HeveochlorellaMT31663

2 - MG457980 MG458096 -

S. sp. 11 LG640 Reunion Sérusiaux HeveochlorellaMT31661

5MT31438

5 MG457942 - MT316748

S. sp. 11 LG641 Reunion Sérusiaux HeveochlorellaMT31661

9MT31435

4 MG457943 - -

S. sp. 12 LG797 Madagascar Sérusiaux HeveochlorellaMT31662

6MT31438

0 MG457949 MT314309 MT316733

S. sp. 12 LG802 Madagascar Sérusiaux HeveochlorellaMT31662

7MT31435

5 MG457952 MT314310 MT316734

S. sp. 14 LG4066 Madagascar Sérusiaux HeveochlorellaMT31663

3 - MG457989 MG458103 -

S. sp. 19 LG4085 Madagascar Sérusiaux HeveochlorellaMT31663

8 - MG458003 MG458112 -

S. sp. 21 LG4070 Madagascar Sérusiaux HeveochlorellaMT31663

4 - MG457993 MG458105 -

S. sp. 21 LG4077 Madagascar Sérusiaux HeveochlorellaMT31663

6 - MG457998 MG458108 MT316741

S. sp. 25 LG1250 Madagascar Sérusiaux HeveochlorellaMT31661

4MT31434

8 MG457970 - -

S. squamata 13535 New Zealand Lücking et al. 39092 HeveochlorellaMT31666

1 - MT279710 MT314326 MT316690

S. squamata 13534 New Zealand Lücking et al. 39157 ElliptochlorisMT31665

9MT31435

0 MF373762 MT314286 MT316691

S. squamata 15069 New Zealand Lücking et al. 39149 HeveochlorellaMT31665

7MT31434

6 MT279742 MT314298 MT316718

S. stipitata 14461 Australia Lumbsch, Grewe, Widhelm 2174 ElliptochlorisMT31664

9MT31440

7 MT279717 MT314335 -

S. stipitata 14462 Australia Lumbsch, Grewe, Widhelm 2210 ElliptochlorisMT31667

1MT31440

8 MG754197 MG063024 MF984274

S. stipitata 14455 Australia Lumbsch, Grewe, Widhelm 2050a ElliptochlorisMT31660

4MT31436

3 MT279715 MT314288 MT316743

S. stipitata 14457 Australia Lumbsch, Grewe, Widhelm 2078a ElliptochlorisMT31660

5MT31436

1 MT279716 MT314292 MT316710

S. stipitata 14463 Australia Lumbsch, Grewe, Widhelm 2212 ElliptochlorisMT31660

7MT31436

2 MT279737 MT314276 MT316744

S. subcaperata 10084 New Zealand Lücking et al. 38852 ElliptochlorisMT31660

3MT31438

6 MT279714 MT314290 MT3167084

Page 5: ars.els-cdn.com · Web viewSupplementary material Cophylogenetic patterns in algal symbionts correlate with repeated symbiont switches during diversification and geographic expansion

S. subcaperata 15062 New Zealand Lücking et al. 38013 ElliptochlorisMT31667

2MT31439

2 MT279719 MT314296 MT316713

S. subcaperata 15063 New Zealand Lücking et al. 38095 ElliptochlorisMT31667

5MT31440

9 MT279740 MT314297 MT316714

S. subcaperata 13859 New Zealand Lücking et al. 38155 ElliptochlorisMT31668

0MT31440

0 MF373797 MT314331 MT316700

S. subcaperata 13860 New Zealand Lücking et al. 38819 ElliptochlorisMT31668

3MT31441

6 MG754199 MG063023 MT316701

S. subcaperata 13852 New Zealand Lücking et al. 38189 ElliptochlorisMT31667

4MT31441

5 MT279735 MT314281 MT316698

S. subcaperata 13814 New Zealand Lücking et al. 38656 HeveochlorellaMT31668

6MT31437

2 MT279732 MT314277 MT316692

S. subcaperata 13821 New Zealand Lücking et al. 38991 ChloroidiumMT31667

3MT31438

8 MT279733 MT314327 MT316753

S. subcaperata 15066 New Zealand Lücking et al. 38044 ElliptochlorisMT31665

0MT31441

0 MT279709 MT314275 MT316747

S. subcaperata 15067 New Zealand Lücking et al. 38119 ElliptochlorisMT31665

2MT31441

1 MT279743 MT314337 MT316716

S. subcaperata 13853A New Zealand Lücking et al. 38581 HeveochlorellaMT31665

8MT31435

1 MT279711 MT314283 MT316699

S. subcaperata 15068 New Zealand Lücking et al. 38694 HeveochlorellaMT31665

6MT31434

5 MT279721 MT314322 MT316717

S. subcaperata 10077 New Zealand Lücking et al. 38937 ElliptochlorisMT31660

8MT31441

9 MT279713 MT314333 -

S. subcaperata 15070 New Zealand Lücking et al. 38045 ElliptochlorisMT31664

2MT31439

3 MT279722 MT314324 MT316719

S. subcaperata 15071 New Zealand Lücking et al. 38818 ChloroidiumMT31666

2MT31438

9 MT279723 MT314300 MT316720

S. subcaperata 13861 New Zealand Lücking et al. 38949 ElliptochlorisMT31666

5MT31440

1 MG754200 MG063022 MF984273

S. subcaperata 13537 New Zealand Lücking et al. 39061 ElliptochlorisMT31664

6MT31439

5 MG754198 MG063017 MF984231

S.variabilis LG631 Reunion van den Boom HeveochlorellaMT31662

2MT31435

2 MG457937 - -

S.variabilis LG636 Reunion Sérusiaux HeveochlorellaMT31661

3MT31437

8 MG457939 MT314307 MT316730

S.variabilis LG637 Reunion van den Boom HeveochlorellaMT31662

3 - MG457940 - -

S.variabilis LG977 Reunion Magain & Sérusiaux HeveochlorellaMT31662

8MT31438

1 MG457957 - MT316736

S.variabilis LG1114 Reunion Magain & Sérusiaux HeveochlorellaMT31663

1 - MG457969 MT314313 -

5

Page 6: ars.els-cdn.com · Web viewSupplementary material Cophylogenetic patterns in algal symbionts correlate with repeated symbiont switches during diversification and geographic expansion

Supplementary Table 2. Specimens included in the Sticta ITS phylogeny.

Species GenBank accessionDNA number Locality Collector

Collection number

Lobaria pulmonaria AF129284 Switzerland unknown Mu30Sticta aff-granatensis MG367416 DNA7382 MON0843 Ecuador DalForno 1787bSticta aff-rhizinata-1 AY173393 USA McCune 23609Sticta aff-rhizinata-2 MT132696 DNA8136 MON1267 Hawaii-Maui Moncada 7000Sticta aff-tomentosa MG367406 DNA7260 MON0721 Costa-Rica Moncada 5694Sticta ainoae MG457927 UCONN4303 Chile Goffinet 12691Sticta albocyphellata KC732519 DNA4979 MON0134 Colombia Moncada 4058Sticta andensis KC732547 DNA5016 MON0199 Colombia Alfonso 2Sticta andina MT132693 DNA8133 MON1264 Hawaii-Maui Moncada 6997Sticta andina KC732481 DNA4938 MON0058 Colombia Moncada 499Sticta andreana MG367393 DNA6237 MON0651 Colombia Vargas 634Sticta arachnofuliginosa KC732524 DNA4985 MON0143 Colombia Moncada 4007aSticta arachnosylvatica KC732588 DNA5451 MON0320 Colombia Moncada 4730bSticta arbuscula KC732505 DNA4966 MON0101 Colombia Moncada 4595bSticta arbusculotomentosa KC732572 DNA5424 MON0293 Colombia Betancourt 326Sticta atlantica KT281737 LG3858 Azores Sérusiaux unknownSticta atroandensis KC732527 DNA4988 MON0146 Colombia Fonseca 188aSticta azorica* MT526263 LG3095 Azores Sérusiaux unknownSticta babingtonii MF373809 DNA14284 MON4284 New-Zealand DeLange 12631bSticta beauvoisii AY173374 USA McDonald 289Sticta borinquensis MG367397 MON574 Puerto-Rico Lücking 33919Sticta brevior KC732499 DNA4962 MON0093 Colombia Moncada 3130bSticta caliginosa MF373767 DNA13782 MON3782 New-Zealand Lücking 39038Sticta canariensis KT281733 LG3741 Ireland Sérusiaux unknownSticta caperata MG457994 LG4072 Madagascar Sérusiaux snSticta carolinensis AY173380 USA McDonald 558Sticta caulescens EU558737 Argentina unknown unknownSticta ciliata MT132672 DNA8086 MON1217 Hawaii-Maui Moncada 6953Sticta ciliata KC732699 DNA6186 MON0600 Colombia Vargas 64bSticta ciliata KT281712 LG2751 Canary-Islands Sérusiaux unknownSticta ciliata KT281715 LG3099 Azores Sérusiaux unknownSticta ciliosylvativa MG367395 DNA6336 MON0553 Colombia Moncada 4870

6

Page 7: ars.els-cdn.com · Web viewSupplementary material Cophylogenetic patterns in algal symbionts correlate with repeated symbiont switches during diversification and geographic expansion

Sticta cinereoglauca MF373794 DNA13835 MON3835 New-Zealand Lücking 38776Sticta cometia KC732627 DNA5527 MON0396 Colombia Coca 1058Sticta cometiella KC732516 DNA4976 MON0127 Colombia Moncada 4404Sticta cordillerana MT507785 DNA11674 MON1674 Colombia Silano 140Sticta corymbosa MN065843 DNA14657 Puerto-Rico Mercado-Díaz 2378Sticta cyphellulata MT152343 UCONN4315 China Wang 1547096Sticta delicatula MG367391 DNA6179 MON0593 Colombia Vargas 556aSticta dendroides-Dendriscocaulon MF373805 MON New-Zealand Lücking 39007aSticta densiphyllidiata MG367398 DNA6358 MON0575 Puerto-Rico Lücking 33871Sticta deyana KP659654 UCONN3481 USA Lendemer 34107Sticta dichotoma MG457975 LG3448 Mauritius Sérusiaux snSticta dilatata KC732647 DNA5550 MON0419 Colombia Coca 1077aSticta dioica-isidiate KC732486 DNA4945 MON0067 Colombia Moncada 3119Sticta duplolimbata MT526264 LG1112 Reunion Magain unknownSticta filix MF373770 DNA13785 MON3785 New-Zealand Lücking 38864Sticta fragilinata AY173384 USA McDonald 562Sticta fuliginoides MT526262 LG3399 La-Palma Sérusiaux unknownSticta fuliginosa MT526260 LG0S10 Devon Sérusiaux unknownSticta fuliginosa MG367426 DNA8112 MON1243 Hawaii-Maui Moncada 6978Sticta fuscotomentosa KC732661 DNA5568 MON0437 Colombia Coca 1207Sticta gallowayana KC732507 DNA4968 MON0108 Colombia Moncada 4013Sticta gaudichaudii EU558736 Argentina Stenroos 5369Sticta globulifuliginosa KC732562 DNA5313 MON0129 Colombia Moncada 4046Sticta gracilis AB239346 Japan Takahashi 2083Sticta guilartensis MN065861 DNA14941 Puerto-Rico Mercado-Díaz 2429Sticta gyalocarpa KC732577 DNA5438 MON0307 Colombia Lücking 33344Sticta gyalocarpoides MG367403 DNA7250 MON0711 Costa-Rica Moncada 5649Sticta harrisii KC732774 DNA6356 MON0573 Puerto-Rico Lücking 33905Stictahirsutofuliginosa KC732612 DNA5479 MON0348 Colombia Moncada 4734aSticta hirsutogyalocarpa KC732531 DNA4996 MON0158 Colombia Moncada 4660aSticta hirta KC732563 DNA5322 MON0153 Colombia Moncada 4659Sticta humboldtii MT507786 DNA14382 MON4382 Colombia Lücking 39360Sticta hypochra EU558732 Argentina Stenroos 5391Sticta hypoglabra KC732667 DNA5586a MON0455a Colombia Lücking 33541Sticta isidioimpressula KC732762 DNA6339b MON0556b Colombia Moncada 4992aSticta isidiornata MG367408 DNA7297 MON0758 Colombia Fonseca 255Sticta isidiosubfilicinella MT507787 DNA12545 MON2545 Colombia Moncada 8637Sticta jaguirreana MG754195 DNA5607 MON0476 Colombia Moncada 4804

7

Page 8: ars.els-cdn.com · Web viewSupplementary material Cophylogenetic patterns in algal symbionts correlate with repeated symbiont switches during diversification and geographic expansion

Sticta laciniata MG367399 DNA7223 MON0684 Costa-Rica Moncada 5778Sticta laevis MG367409 DNA7301 MON0762 Colombia Fonseca 259Sticta laselvae KC732600 DNA5463 MON0332 Colombia Moncada 4683Sticta latifrons MF373781 DNA13822 MON3822 New-Zealand Lücking 38327Sticta latior KC732568 DNA5405 MON0273 Brazil Lücking 30122Sticta leucoblepharis KC732597 DNA5460 MON0329 Colombia Moncada 4689aSticta limbata MT132695 DNA8135 MON1266 Hawaii-Maui Moncada 6999Sticta limbata KT281709 LG3105 Azores Sérusiaux unknownSticta lobarioides KC732555 DNA5028 MON0236 Colombia Alfonso 5Sticta lobulata KC732482 DNA4939 MON0060 Colombia Alvaro 41218aSticta lumbschiana KC732578 DNA5439 MON0308 Colombia Lücking 33364Sticta luteocyphellata KC732671 DNA5588a MON0457a Colombia Lücking 33512Sticta macrocyphellata KC732662 DNA5569 MON0438 Colombia Coca 1267Sticta macrofuliginosa KC732747 DNA6316 MON0533 Colombia Moncada 4042Sticta macrogyalocarpa KC732619 DNA5511 MON0380 Colombia Fonseca 49Sticta macrophylla MG457979 LG3452 Mauritius Sérusiaux snSticta macrothallina KC732655 DNA5562a MON0431a Colombia Coca 1376Sticta maculofuliginosa KC732456 DNA4909 MON0009 Colombia Moncada 4156cSticta marginalis MT526261 LG4071 Madagascar Sérusiaux unknownSticta marginifera MT132630 DNA7863 MON0947 India Schumm 18900Sticta marilandia KC732756 DNA6332 MON0549 Colombia Moncada 4901Sticta martinii MF373778 DNA13816 MON3816 New-Zealand Lücking 38807Sticta menziesii MF373761 DNA13522 MON3522 New-Zealand Lücking 39050Sticta minutula KC732511 DNA4972 MON0114 Colombia Moncada 280Sticta neopulmonarioides KC732630 DNA5530 MON0399 Colombia Coca 1132aSticta ocaniensis KC732744 DNA6309 MON0526 Colombia Simijaca 4996Sticta orinoquensis AF524905 Guyana Stenroos 4816Sticta paleoweigelii AB245124 Taiwan Harada 2231303Sticta papillata KC732552 DNA5021 MON0216 Colombia Alfonso 3bSticta parahumboldtii KC732573 DNA5425 MON0294 Colombia Betancourt 144fSticta paralimbata KC732466 DNA4921 MON0030 Colombia Valbuena 126Sticta parvilobata MG367375 JM112 DNA14510 Puerto-Rico Mercado-Díaz 2260Sticta peltigerella MT132629 DNA7803 MON0887 Colombia Lücking 35239Sticta phyllidiata KC732476 DNA4932 MON0046 Colombia Barragan 12Sticta phyllidiofuliginosa KC732764 DNA6342 MON0559 Colombia Moncada 4972Sticta phyllidiokunthii KC732593 DNA5456 MON0325 Colombia Moncada 4758Sticta plumbea MG457972 LG1257 Reunion Magain snSticta plumbeociliata KC732767 DNA6346 MON0563 Colombia Moncada 4820

8

Page 9: ars.els-cdn.com · Web viewSupplementary material Cophylogenetic patterns in algal symbionts correlate with repeated symbiont switches during diversification and geographic expansion

Sticta pseudobeauvoisii KC732571 DNA5422 MON0291 Colombia Ardila 1bSticta pseudodilatata MT507788 DNA12042 MON2042 Colombia Moncada 7287Sticta pseudohumboldtii KC732463 DNA4917 MON0025 Colombia Moncada 4586Sticta pseudolimbata KC732467 DNA4922 MON0031 Colombia Moncada 4009Sticta pseudolobaria KC732653 DNA5559 MON0428 Colombia Coca 1094Sticta pseudosylvatica KC732724 DNA6276 MON0493 Colombia Suarez 306Sticta pulmonarioides KC732632 DNA5533 MON0402 Colombia Coca 1451Sticta puracensis KC732706 DNA6207 MON0621 Colombia Diaz L6Sticta rhizinata KC732545 DNA5014 MON0196 Colombia Moncada 4063Sticta riparia MG367373 JM130 DNA14513 Puerto-Rico Mercado-Díaz 2342Sticta roseocyphellata MG367412 DNA7357 MON0818 Colombia Moncada 6131Sticta scabrosa MG367387 DNA4948 MON0073 Colombia Moncada 4306Sticta scabrosa-subsp-hawaiiensis MT132738 DNA8217 MON1348 Hawaii-Kauai Moncada 7072Sticta scabrosa-subsp-hawaiiensis MT132741 DNA8221 MON1352 Hawaii-Kauai Moncada 7076Sticta scabrosa-subsp-hawaiiensis MT132700 DNA8146 MON1277 Hawaii-Maui Moncada 7010Sticta sorediata* MT526265 LG1029 Reunion Magain unknownSticta spec-17 MG458048 UCONN4102 Madagascar Goffinet 12247Sticta spec-19 MG458003 LG4085 Madagascar Sérusiaux snSticta spec-22 MG458017 LG4104 Madagascar Sérusiaux snSticta spec-3 MG458023 LG4111 Madagascar Sérusiaux snSticta spec-4 MG458001 LG4083 Madagascar Sérusiaux snSticta spec-7 MG458028 LG4118 Madagascar Sérusiaux snSticta sp-nov-1 MT132726 DNA8202 MON1333 Hawaii-Kauai Moncada 7058bSticta sp-nov-2 MG367434 DNA8197 MON1328 Hawaii-Kauai Moncada 7055bSticta sp-nov-3 MT132648 DNA8055 MON1186 Hawaii-Oahu Moncada 6923Sticta sp-nov-4 MG754196 DNA8047 MON1178 Hawaii-Oahu Moncada 6916Sticta squamata MF373796 DNA13854 MON3854 New-Zealand Lücking 38673Sticta squamifera KC732473 DNA4928 MON0037 Colombia Moncada 4053aSticta subcaperata MF373797 DNA13859 MON3859 New-Zealand Lücking 38155Sticta subfilicinella KT354937 DNA5579 MON0448 Colombia Coca 1110Sticta sublimbata AB245118 Japan Takahashi 2140Sticta sublimbatoides KC732540 DNA5006 MON0183 Colombia Moncada 4012Sticta subscrobiculata KC732549 DNA5018 MON0204 Colombia Simijaca 1697aSticta sylvatica KT281730 LG3723 Devon Sérusiaux unknownSticta tainorum MG367371 JM111 DNA14509 Puerto-Rico Mercado-Díaz 2256Sticta tatamana KC732621 DNA5519 MON0388 Colombia Coca 1336Sticta tomentosa MT132667 DNA8079a MON1210a Hawaii-Maui Moncada 6947Sticta tomentosa KC732663 DNA5573 MON0442 Colombia Coca 996

9

Page 10: ars.els-cdn.com · Web viewSupplementary material Cophylogenetic patterns in algal symbionts correlate with repeated symbiont switches during diversification and geographic expansion

Sticta tunjensis KC732521 DNA4981 MON0138 Colombia Alvaro 474Sticta variabilis MG457984 LG4060 Madagascar Sérusiaux snSticta viviana KC732680 DNA5593 MON0462 Colombia Lücking 33311Sticta weigelii MG367370 JM066 DNA14519 Puerto-Rico Mercado-Díaz 2246

* Descriptions of these species have not been published yet.

Supplementary Table 3. Primers using in PCR and sequencing.

Marker Primer Primer sequence Orientation Partner type ReferencerbcL a-ch-rbcL-203-5′-MPN GAATCWTCWACWGGWACTTGGACWAC forward alga Nelsen et al., 2011rbcL a-ch-rbcL-991-3′-MPN CCTTCTARTTTACCWACAAC reverse alga Nelsen et al., 201118S a(treb)-nu-SSU-0078-5′-mpn CATGTCTAAGTATAAACTGCT forward alga Dal Grande et al., 201418S nu-SSU-0402-5′ (NS19UCB) CCGGAGAAGGAGCCTGAGAAAC forward alga Gargas & Taylor, 199218S nu-SSU-0553-3′ (NS2) GGCTGCTGGCACCAGACTTGC reverse alga White et al., 199018S a(treb)-nu-SSU-0803-3′-mpn TAGGCCAGAGTCCTATCGTGTTAT reverse alga Dal Grande et al., 2014ITS ITS1F CTTGGTCATTTAGAGGAAGTAA forward fungus Gardes & Bruns, 1993 ITS ITS4 TCCTCCGCTTATTGATATGC reverse fungus White et al., 1990nuLSU nuLSU_Sticta_F CCAACAGGGATTGCCTCAGT forward fungus Widhelm et al., 2018nuLSU nuLSU_Sticta_R ATTACGCCAGCATCCTAGCC reverse fungus Widhelm et al., 2018Mcm7 MCM7_Sticta_1F AAGCCATCGGTGCAGGTAAA forward fungus Widhelm et al., 2018Mcm7 MCM7_Sticta_1R CGATTTAGCCACACCAGGGT reverse fungus Widhelm et al., 2018

Supplementary Table 4. PCR conditions.

PCR rbcL 18S ITS nuLSU Mcm7

Initial denaturation 95°C (5 min) 95°C (5 min) 94°C (5 min) 95°C (3 min) 94°C (10 min)Denaturation 95°C (1 min) 95°C (1 min) 94°C (30 s) 95°C (30 s) 95°C (45 s)Annealing 50°C (1 min) 50°C (1 min) 48°C (30 s) 48°C (30 s) 56°C (50 s)

10

Page 11: ars.els-cdn.com · Web viewSupplementary material Cophylogenetic patterns in algal symbionts correlate with repeated symbiont switches during diversification and geographic expansion

Extension 72°C (1 min) 72°C (1 min) 72°C (1.5 min) 72°C (30 s) 72°C (1 min)Number of cycles 40 35 39 35 39Final extension 72°C (7 min) 72°C (7 min) 72°C (5 min) 72°C (3 min) 72°C (5 min)

Supplementary Table 5. Cophylogenetic scenarios tested in JANE.

Cost scheme C-D-D+S-L-FD C D D+S L FD Total CostA 0-1-2-1-1 1 1 2 8 26 39B 2-1-1-1-1 0 1 3 9 26 39C 1-1-1-1-1 1 1 2 8 26 38D 0-1-1-1-1 1 1 2 8 26 37E 1-0-0-1-1 0 1 3 9 26 35F 2-1-1-1-0 0 1 3 9 26 13G 2-1-1-0-0 0 2 2 12 26 4

C: cospeciation, D: duplication, D+S: duplication with a host switch, L: loss, FD: failure to diverge.

Supplementary Figure 1. 18S ML phylogeny of algae in Trebouxiophyceae. Highlighted clades represent different genera of algae associated with Sticta. Bootstrap support values ≥75 from ML analysis and Bayesian posterior probabilities ≥95 are shown at nodes.

11

Page 12: ars.els-cdn.com · Web viewSupplementary material Cophylogenetic patterns in algal symbionts correlate with repeated symbiont switches during diversification and geographic expansion

12

Page 13: ars.els-cdn.com · Web viewSupplementary material Cophylogenetic patterns in algal symbionts correlate with repeated symbiont switches during diversification and geographic expansion

Supplementary Figure 2. JANE cophylogeny showing cost scenario G with the lowest total cost. Phylogeny of Sticta shown in black and phylogeny of algal symbiont in blue. Dotted line = loss of symbiont, serrated line= failure of the symbiont to diverge with its host, dot and small arrow = duplication and host switch.

13