“Proteomics & Bioinformatics” A Practical Approach to Proteomics … · 2009. 4. 23. ·...
Transcript of “Proteomics & Bioinformatics” A Practical Approach to Proteomics … · 2009. 4. 23. ·...
“Proteomics & Bioinformatics”
A Practical Approach to Proteomics and the associated Technologies and the Data Mining Tools.
Sean Taylor, Ph.D.
DNA Genome “Genomics”
Proteins
Cell functions
Proteome “Proteomics”
DNA sequencing
cDNA arrays
2D PAGE, HPLC
CGTCCAACTGACGTCTACAAGTTCCTAAGCT
RNA Transcriptome
“-ome”
Reactome, the chemical reactions involving a nucleotide
• Proteins are the mediators of functions in the cell
• Deviations from normal status denotes disease
• Proteins are drug/therapeutic targets
• Protein expression levels do not correlate strongly with mRNA
Why are we studying proteins?
The Proteome
The proteome in any cell represents a subset of all possible gene products
Not all the genes are expressed in all the cells.
It will vary in different cells and tissue types in the same organism and between different growth and developmental stages
The proteome is dependent on environmental factors, disease, drugs, stress, growth conditions.
1485 protein spots detected
2D Gel of Mouse Brain
Proteome complexity
•More than 100 modification forms known•A single protein may carry several modifications•Modified proteins show different properties compared to unmodified counterparts•In most cases, we do not know the origin or the biological significance of the observed heterogeneities
Much larger number of spots compared to protein species they represent
H.influenza : 1500 spots 500 different proteins
Protein Heterogeneity
Complexity
Tools of ProteomicsProtein extraction
Solubilize proteins from cells or tissue
Protein separation technologySimplify complex protein mixturesTarget specific proteins for analysis
Mass spectrometry (MS)Provide accurate molecular mass measurements of intact proteins and peptides
DatabaseProtein, EST, and complete genome sequence databases
Software collectionMatch the MS data with specific protein sequences in databases
Detergents: solubilize membrane proteins-separation from lipids
Reductants: Reduce S-S bonds
Denaturing agents: Disrupt protein-protein interactions-unfold proteins
Enzymes: Digest contaminating molecules (nucleic acids etc)
Protease inhibitors
Aim: High recovery-low contamination-compatibility with separation method
Protein extraction
ESI-MS
Electrospray Ionization tandem MS
MALDI-TOF
Matrix Assisted Laser Desorption Ionization –Time of Flight
Workflow of proteomics analysisproteins digestionseparation
MALDI, MS/MS
digestion
peptides
(LC)-MS/MSIdentification
The less complex a mixture of proteins is, the better chance we have to identify more proteins.
Detergents
Reductants
Denaturing agents
Enzymes
digestion
Separation of Protein Mixtures
Separation techniques
1D- and 2D-SDS PAGE
Preparative IEF isoelectricfocusing
HPLC
Separating intact proteins to take advantage of their diversity in physical properties
Separation techniques for peptides
MS-MS
HPLC (MudPIT)
SELDI
Separation techniques used with intact proteins
Differential display proteomicsDifference gel electrophoresis (DIGE)
Isotope-coded affinity tagging (ICAT)
H.J. Issaq, 2003M.F. Lopez, 2000
Apolipo-A1
1%
Apolipo-B
AGP
Ceruloplasmin
Factor H
Lipoprotein A
C4-Comp factor
Comp factor B
Pre-albumin
C9-Comp factorC1q-Comp
factorC8-Comp factor
Deep Proteome™
Large number of Low abundance
proteins
Albumin
IgG
Transferrin
FibrinogenIgA
α2 macroglobulinIgM
α1-ATC3 Comp factor
10%Haptoglobulin
Dynamic Range of the Plasma Proteome
Limitations of Immunodepletion
To alleviate the dynamic range problem in serum & plasma, immunodepletion products have been developed
Immunodepletion suffers from many limitationsReliant upon predefined set of antibodiesDilutes the sampleInadvertently lose associated proteins when high abundant proteins are removedExpensive, due to the use of antibodies
94 Yellow5 Blue3 Green1 Red1 Pink
BindWash away Excess
Elute
4 Yellow4 Blue3 Green1 Red1 Pink
ProteoMiner Technology
Each bead may bind an unique protein, or protein complex
With sufficient diversity, there will be a ligand to most, if not all, proteins in the mixture
Diverse Ligand Library
Benefits of ProteoMiner Technology
Decreases the amount of high-abundance proteins without losing associated proteins
Enriches and concentrates low-abundance proteins that cannot be detected through traditional methods
Not dependent on a predefined set of antibodies
Can be used to decrease the dynamic range of the protein concentration in a variety of biological fluids
Serum: Treated vs. Untreated
Molecular Mass (M/Z)
Surface enhanced laser desorption/ ionization (SELDI) MS
µA
untreated
flowthrough
eluate
1-D gel
Sample Treated with ProteoMiner
Gel electrophoresisClassical processHigh resolving power: visualization of thousands of protein forms
QuantitativeIdentifying proteins within proteomeUp/ down regulation of proteinsDetection of post-translational modifications
Protein fixing and staining or blotting
General detection methods (staining)Organic dye – and silver based methods Coomassie blue, SilverRadioactive labeling methodsReverse stain methodsFluorescence methods (Supro Ruby)
Gel scanning(storage of image in a database)
Coomassie blue stained gels
Silver stained
Ruby red
2D Gel Electrophoresis
pH 3 pH 10
The strip is loaded onto a SDS gel Mw
pI
Staining !
Proteins that wereseparated on IEF gelare next separated inthe second dimensionbased on theirmolecular weights.
Limitations/difficulties - 2D gels
ReproducibilitySamples must be run at least in triplicate to rule out effects from gel-to-gel variation (statistics)
Incompatibility of some proteins with the first dimension IEF step (hydrophobic proteins)
Marginal solubility leads to protein precipitation and degradation- smearing
(Glycolysation, oxidation)
Small dynamic range of protein staining as a detection technique- visualization of abundant proteins while less abundant might be missed.
Posttranscriptional control mechanismsCo-migrating spots forming
a complex region
Streaking and smearing
Weak spots and background
Vacuum assisted aspiration into sample tubes
Large amount of proteins (up to 3g protein)
Preparative IEF
The protein mixture is injected into the focusing chamber
Proteins are focused as in standard IEF
The pH gradient is achieved with soluble ampholytes
Gel Image Analysis
Image analysis is extracting perceptible data out of the 2DE image, and storing it in a database.
It involves detecting spots and warping separate images to align like-spots of the same proteins.
Spot data comes from the levels of spot darkness which is proportional to the level of proteins staining or dye labeling of particular amino acids.
staining Image acquisition Image analysis /quantification
Film or Imager?
DensitometerDensitometerDensitometerDensitometer
VersaDoc VersaDoc FamilyFamily
VersaDoc VersaDoc FamilyFamily GelDoc GelDoc
FamilyFamily
Film
ChemiDoc XRS
Time (seconds)15
Molecular ImagerSystem
Dynamic Range ChemiDoc XRS System vs. Film
Harta LED test targets imaged with Bio-Rad's Molecular Imaging ChemiDoc XRS Systems, as well as exposed to film, for 15 seconds. The Harta target produces illumination that range from bright to very faint. It is controlled tool for testing the dynamic range of any luminescence detection system, without the variables usally introduced during sample prep, electrophoresis, and blotting.
The ChemiDoc XRS System displays a high linear dynamic range, enabling it to see all 7out of 9 spots in 15 seconds, without saturating the brightest signal. This quantitative data is due to the 16,000 electron well capacity of the CCD and low 4.5 electron noise. The high quantum efficiency of the CCD also enables the system to detect signal fast, avoiding building up of background noise. In 15 seconds, film also detected 7 out of 9 spots, and the 4 brightest spots are saturated. This illustrates the limited dynamic range of film. While film is a good tool to see the absence or presence of a sample, it is not quantitative.
PDQuest 2-D Analysis Software
http://www.bio-rad.com/
PDQuest Features
http://www.bio-rad.com/
•Quick guides to lead a beginner through the major applications of the software
•Onscreen context-sensitive help
•Context-sensitive, right-mouse-click menus that offer ready access to common commands
•Experiment setup wizard
Identification
Quantification
General workflow of proteomics analysis
MALDI, MS/MS Store peak lists and all meta data
PMF
MS/MS
DIGE
LC-MS & Tags
Proteins/peptides2D gel image aquisition andstorage
Digestion and/or separation
KEGG PDB DIPOMIMReactomePROSITPfamSPINBONDSTRINGAmiGODavidPubMedMEDLINE
Strategy for Biomarker Discovery
Large # samplesSmall # candidates
DiscoveryCandidate gene
Validationin situ hybridization Immunohistochemistry
Application
Disease vs. Normal Proteomic analysis(2D gels / MS)
Genomic analysismRNA level
Diagnostic Therapeutic
Clinical Application
Prognostic
Conclusions
The success of proteomics (structural, functional, expressional) hinges almost entirely on successful sample preparation and separation. Time taken to design proteomics experiments will save in downstream analysis and productivity. Bioinformatics (web databases, servers, data mining tools, NN’s, HMM’s) can and does play an increasingly important role in optimizing or improving experimental design and data interpretation.