Anti-Lyssaviral Activity of Interferons � and � from the Serotine Bat,Eptesicus serotinus

Xiaocui He,a Tomáš Korytár,a Juliane Schatz,b Conrad M. Freuling,b Thomas Müller,b Bernd Köllnera

Institute of Immunologya and Institute of Molecular Biology,b Friedrich-Loeffler-Institut, Federal Research Institute for Animal Health, Greifswald-Insel Riems, Germany

ABSTRACT

Interferons (IFNs) are cytokines produced by host cells in response to the infection with pathogens. By binding to the corre-sponding receptors, IFNs trigger different pathways to block intracellular replication and growth of pathogens and to impedethe infection of surrounding cells. Due to their key role in host defense against viral infections, as well as for clinical therapies,the IFN responses and regulation mechanisms are well studied. However, studies of type I IFNs have mainly focused on alphainterferon (IFN-�) and IFN-� subtypes. Knowledge of IFN-� and IFN-� is limited. Moreover, most studies are performed inhumans or mouse models but not in the original host of zoonotic pathogens. Bats are important reservoirs and transmitters ofzoonotic viruses such as lyssaviruses. A few studies have shown an antiviral activity of IFNs in fruit bats. However, the functionof type I IFNs against lyssaviruses in bats has not been studied yet. Here, IFN-� and IFN-� genes from the European serotinebat, Eptesicus serotinus, were cloned and functionally characterized. E. serotinus IFN-� and IFN-� genes are intronless and wellconserved between microchiropteran species. The promoter regions of both genes contain essential regulatory elements for tran-scription factors. In vitro studies indicated a strong activation of IFN signaling by recombinant IFN-�, whereas IFN-� displayedweaker activation. Noticeably, both IFNs inhibit to different extents the replication of different lyssaviruses in susceptible batcell lines. The present study provides functional data on the innate host defense against lyssaviruses in endangered Europeanbats.

IMPORTANCE

We describe here for the first time the molecular and functional characterization of two type I interferons (IFN-� and -�) fromEuropean serotine bat (Eptesicus serotinus). The importance of this study is mainly based on the fact that very limited informa-tion about the early innate immune response against bat lyssaviruses in their natural host serotine bats is yet available. Gener-ally, whereas the antiviral activity of other type I interferons is well studied, the functional involvement of IFN-� and -� has notyet been investigated.

Worldwide, more than 1,200 different species of bats (Chirop-tera) have been described; thus, bats represent the second

most diverse mammalian order (1). Bats have been identified asreservoirs for a plethora of viruses (2). Some, such as severe acuterespiratory syndrome coronavirus (SARS-CoV) and Hendra vi-rus, are associated with recent human and animal epidemics.Thus, bats present a potential threat to public health (2–4). Bats ofthe genus Eptesicus can transmit lyssaviruses (5). Surprisingly, re-ports about epidemics inside bat populations are very limited,indicating that viral pathogens do not seem to induce major dis-ease outbreaks and that certain pathogens, such as rabies virus(RABV), are better controlled within bats (2, 6, 7). Therefore, it isuncertain whether a coevolution of lyssaviruses and the bat im-mune system resulted in a partial resistance against infections dueto the specific adaptation of the innate immune system of bats(8–11).

Interferons (IFNs) are the first-line defenders against lyssavi-rus infections (12–15). IFNs are produced by host cells in responseto pathogens such as viruses, bacteria, fungi, and parasites andtrigger protective immune mechanisms. Vertebrate IFNs are clas-sified into three classes: type I IFNs, type II IFNs, and type III IFNs.Type I IFNs are the largest group in the IFN family. Due to theirversatility, they have expanded and diverged into many distinctsubfamilies: IFN-�, IFN-�, IFN-�, IFN-�, IFN-ε, IFN-�, IFN-�,and IFN-�, as well as a potentially new IFN, “IFNX” (16). With aconserved intronless structure and colocalized loci in the chromo-

some, type I IFNs are considered to have arisen and expandedfrom gene duplications (17, 18). Studies of their antiviral defensesand regulation mechanisms are rapidly mounting. Most of thesestudies focus on the IFN-� and IFN-� subtypes, and little isknown about other subtypes, even in humans and in mouse mod-els. IFNs seem to play a crucial role in host-virus interactions inbats (19–21). However, such studies have been limited to type IIFN-� and IFN-� from the Egyptian fruit bat (Rousettusae gyptia-cus) and type II IFN-, type III IFN-1, and type III IFN-2 fromthe Australian black flying fox, Pteropus alecto (22–24). In addi-tion to sequence characterization, IFN induction, the signalingpathway, and antiviral activity have all been investigated in celllines derived from Eidolon helvum and P. alecto after viral infec-tions (20–23). Similar to mammalian IFNs, P. alecto IFN- andIFN-2 showed antiviral activities against Semliki Forest virus andHendra virus and against Pulau virus, respectively (22, 23).

Surprisingly, although bats are known as the principal vectors

Received 19 November 2013 Accepted 21 February 2014

Published ahead of print 26 February 2014

Editor: D. S. Lyles

Address correspondence to Bernd Köllner, bernd.koellner@fli.bund.de.

Copyright © 2014, American Society for Microbiology. All Rights Reserved.

doi:10.1128/JVI.03403-13

5444 jvi.asm.org Journal of Virology p. 5444 –5454 May 2014 Volume 88 Number 10

on February 7, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

for RABV and other lyssaviruses, information on IFNs duringlyssavirus infections is scarce (2). In Europe, five different batspecies have been identified as potential reservoir hosts for lyssa-viruses: E. serotinus, E. isabellinus (European bat lyssavirus type 1[EBLV-1]), Myotis daubentonii, M. dasycneme (EBLV-2), M. nat-tereri (Bokeloh bat lyssavirus), and Miniopterus schreibersi (WestCaucasian bat lyssavirus and Lleida bat lyssavirus) (25–28). SinceE. serotinus, a the natural host for EBLV-1, is responsible for thevast majority of bat rabies cases reported in Europe (29), we fo-cused on a functional characterization of IFN from this species.

Since we could clone first IFN-� and IFN-� genes from E.serotinus, we focused in the present study on the molecular andfunctional characterization of these two type I IFNs. After se-quence analysis, recombinant IFN-� and IFN-� proteins wereused in functional assays to investigate the initiation of the IFNsignaling pathway and antilyssaviral activity against EBLV-1,EBLV-2, and RABV infections in E. serotinus-derived cell lines.Our analysis sheds light on the function of IFNs within cells of thenatural host of RABV and other lyssaviruses and the virus-hostinteraction in these specific mammalian hosts.

MATERIALS AND METHODSAnimal sampling. E. serotinus bats submitted for rabies diagnosis in theframe of enhanced passive surveillance (J. Schatz, unpublished data) werescreened for their suitability to obtain immune system-related organ tis-sues. The spleens from two dead E. serotinus bats from the city of Berlin,Germany, that did not show any evidence of accelerated autolysis wereremoved and stored in RNAlater until further analysis.

Nucleic acid extraction from tissue. Total RNA extraction of the E.serotinus spleen was performed using an RNeasy minikit (Qiagen, Ger-many) according to the manufacturer’s protocol. Genomic DNA was alsoisolated from spleen tissue by using a DNeasy Blood & Tissue kit (Qiagen).The concentration and purity of RNA and genomic DNA were deter-mined by using NanoDrop (Thermo, USA) and then stored at �80°C forfurther use.

PCR amplification of IFN-� and IFN-� genes from E. serotinus(esIFN-� and esIFN-�). Since no appropriate genomic sequences for E.serotinus available were available, the following approach was used. IFN-�from P. vampyrus (GenBank accession no. HM636500) and IFN-� fromEquus caballus (GenBank accession no. NM_001114536) were used asquery sequences to search for the IFN-� and IFN-� genes, respectively,from a small brown bat, M. lucifugus, in the whole-genome sequence inthe Ensembl database using the BLAST algorithm (http://www.ensembl.org/index.html). The exons from the matching scaffolds were then sub-jected to the National Center for Biotechnology Information (NCBI)BLAST programs blastN and blastX to confirm the identities of IFN-� andIFN-�.

Reverse transcription-PCR (RT-PCR) was performed to amplify theIFN-� and IFN-� cDNA fragments from E. serotinus RNA using primerpairs based on the sequences of IFN-� and IFN-� genes from M. lucifugus(Table 1). The reactions were prepared according to the manufacturer’sinstructions with a One-Step RT-PCR kit (Qiagen). PCR was performedusing genomic DNA as the template with GoTaq Flexi DNA polymerase(Promega, USA) to obtain the DNA fragments. All of the PCR productswere cloned into PCR2.1 vector (Invitrogen, USA) and transformed intoEscherichia coli competent cells. Plasmids were extracted from positiveclones and sequenced by using an Applied Biosystems 3130 genetic ana-lyzer (Life Technologies, USA) at the Friedrich-Loeffler-Institut, Greif-swald-Insel Riems, Germany.

In order to obtain the complete gene sequences of esIFN-� andesIFN-�, a genome walking method was applied according to the GenomeWalker universal kit manual (Clontech, USA). esIFN-� and esIFN-� spe-cific genome walking primers were designed based on the gene fragmentsobtained above (Table 1). For 5=-end walking PCR, gwesIFN�-R1 and AP1 or

gwesIFN�-R1 and AP1 were used in the first-round PCR, and gwesIFN�-R2and AP2 or gwesIFN�-R2 and AP2 were used in the second-round PCR(Table 1). For 3=-end walking PCR, gwesIFN�-F1 and AP1 or gwesIFN�-F1and AP1 were used in the first-round PCR, and gwesIFN�-F2 and AP2 orgwesIFN�-F2 and AP2 were used in the second-round PCR (Table 1). Forlonger promoter sequences, other sets of gene-specific primers, gwesIFN�-R3/gwesIFN�-R4 and gwesIFN�-R3/gwesIFN�-R4, were used in an addi-tional round of PCR (Table 1). All of the specific PCR products were clonedand sequenced in both directions.

Sequence and phylogenetic analysis. The open reading frames(ORFs) of esIFN-� and esIFN-� were predicted by the NCBI ORF finderprogram (http://www.ncbi.nlm.nih.gov/projects/gorf/). The deducedamino acid sequences were BLAST searched against protein databases(http://www.ncbi.nlm.nih.gov/BLAST/) for a homologue search. Signalpeptide and protein domains were identified by SMART (http://smart.embl-heidelberg.de/). The transcription start site was predicted withthe promoter predictor program (http://www.fruitfly.org/seq_tools/promoter.html). Potential transcription factor binding sites were identi-fied by using the MatInspector program (http://www.genomatix.de). N-glycosylation sites were predicted by PROSITE (http://www.expasy.ch/prosite/). Sequence alignments were performed by the ClustalX program.Phylogenetic trees were constructed by MEGA5.05 using the neighbor-joining method with bootstrap value of n � 1,000. Protein sequences fromother species used in the phylogenetic analysis are shown in the legend toFig. 2.

Construction of recombinant constructs and expression of recom-binant esIFN-� and esIFN-�. An infusion cloning strategy was used tobuild the recombinant constructs for both prokaryotic and eukaryoticsystems. For prokaryotic expression, gene-specific PCR products ampli-fied with the primer pair PmalesIFN�-F/PmalesIFN�-R or PmalesIFN�-

TABLE 1 Primers used in this study

Primera Sequence (5=–3=)IFN�-F TGACCAATATGAGCAAATCAIFN�-R AAACTGCTTATCCTGTGGAAIFN�-F GACCACGTCCAGCTCAGCIFN�-R GCGCAGTCACTGTATTTCTTgwesIFN�-F1 CAAGGGGGCCTTCTATGAAATGTCCATGgwesIFN�-F2 TTCACTCAACCCACCTTCCAACCCACTTgwesIFN�-R1 CCCTGGTGTCTCCTCTCATCTCCTCCAgwesIFN�-R2 AAGTGGTTGGAAGGTGGGTGGAGTGAAgwesIFN�-R3 GAAGGCCCCCTTGATGTCTCTTTTCAgwesIFN�-R4 AATATGCAGCAAGTCACAGCCCAGTgwesIFN�-F1 AGCACCATCTCCCCTCTCTTCTGTCTGgwesIFN�-F2 ATCTCTGACCTCCTGCCCACAGAGAACgwesIFN�-R1 CAGGGCCATGAGTAGAGAGAGCAGGAGgwesIFN�-R2 CCTTGGGCCAGAAGTTCTCCTATGACCgwesIFN�-R3 GCCCTAATGGTTTGGCTCAGTGGATgwesIFN�-R4 GGTGTGCAGGAGGCAGCTTATCAGTAP1 GTAATACGACTCACTATAGGGCAP2 ACTATAGGGCACGCGTGGTPmalesIFN�-F AAGGATTTCAGAATTCCTGGGCTGTGACTTGCTGPmalesIFN�-R TAGAGGATCCGAATTCTTATTTCCTTCTGAGTAGTTCPmalesIFN�-F AAGGATTTCAGAATTCTGTGACCTGCCTGAGGACCPmalesIFN�-R TAGAGGATCCGAATTCTCAAGGTGACCCCAGGTCpcDNAesIFN�-F CAGTGTGCTGGAATTCCACCATGAAAACCAAGTCTGATATGpcDNAesIFN�-R GATATCTGCAGAATTCTTATTTCCTTCTGAGTAGTTCpcDNAesIFN�-F CAGTGTGCTGGAATTCCACCATGGCCCTCCTGCTCTCpcDNAesIFN�-R GATATCTGCAGAATTCTCAAGGTGACCCCAGGTCGAPDH-F TCGGAGTGAACGGATTTGGAPDH-R CCTTGAACTTGCCATGAGTAGISG56-F CAGGCTAAATCCAGAAGATGISG56-R TTCCAGAGCAAATTCAAAATMx1-F TCTACTGCCAAGACCAAGCGTMx1-R CGAGGGAGCAAGTCAAAGGAIFIT3-F AGCAGAGGAGCTTGCAGAAGIFIT3-R CCGGAAAGCCATAAACAAGAEBLV1-F GAAAGGKGACAAGATAACACCEBLV1-R ARAGAAGAAGTCCAACCAGAGEBLV2-F GGTGTCTGTAAAGCCAGAAGEBLV2-R TTATAAGCTCTGTTCAAGRABV-F GATCCTGATGAYGTATGTTCCTARABV-R GATTCCGTAGCTRGTCCA

a F, forward primer; R, reverse primer.

Antiviral Activity of IFN-� and -� from E. serotinus

May 2014 Volume 88 Number 10 jvi.asm.org 5445

on February 7, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

F/PmalesIFN�-R (Table 1) were inserted into pMAL-c2X plasmids whichcontain the maltose-binding protein (MBP) tag by using an In-Fusion HDCloning Plus kit (Clontech). Likewise, for specific eukaryotic constructs,the primer pair pcDNAesIFN�-F/pcDNAesIFN�-R or pcDNAesIFN�-F/

pcDNAesIFN�-R (Table 1) was used, in which a Kozak sequence wasincorporated in the forward primers to favor the initiation of translation(30). PCR products were inserted into pcDNA plasmids by using an In-Fusion HD Cloning Plus kit (Clontech). All of the constructs were con-

FIG 1 The genomic sequence and deduced amino acid sequences of esIFN-� (A) and esIFN-� (B) genes. The start and stop codons are shown in bold. The signalpeptide is in gray. The IFabd domain is shaded gray and underlined. The predicted transcription start site is shaded gray and bold. The TATA box element isunderlined. and core sequence is in boldface. Some of the predicted transcription factor binding sites are in bold and boxed.

He et al.

5446 jvi.asm.org Journal of Virology

on February 7, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

firmed to contain the correct inserts by sequencing. To obtain MBP-tagged recombinant esIFN-� and esIFN-�, the pMAL protein fusion andpurification system (NEB, United Kingdom) was used. Protein inductionand purification analysis were performed as described previously (31). Inaddition, endotoxins were removed from the purified proteins by using anToxinEraser endotoxin removal kit (GenScript, USA). The concentrationof purified proteins was determined by using NanoDrop.

Cell culture and activity evaluation of esIFN-� and esIFN-�. A nat-urally immortalized cell line from E. serotinus brain tissue (FLG-R) ob-tained from the cell culture collection of the Friedrich-Loeffler-Institut(cell bank number FLI-1093) was used to investigate esIFN-� and esIFN-�activity. Cells were cultured in Dulbecco modified Eagle medium supple-mented with 10% fetal calf serum at 37°C and 5% CO2. The cells wereseeded at a density of 4 105 cells/well into 12-well tissue culture plates 10to 12 h before IFN stimulation. After a washing step with 1 phosphate-buffered saline (PBS), the cells were treated with purified MBP-taggedesIFN-� or esIFN-� at concentrations of 1 and 10 �g/ml. Cells treatedwith MBP tag purified from empty pMAL-c2X served as a negative con-trol. Untreated cells were used as blanks. All cells were harvested in RLTbuffer (Qiagen) 3 h after stimulation and stored at �80°C for further RNAextraction.

Recombinant IFN from E. coli system without glycosylation may loseits activity; thus, the E. serotinus brain cell line was used for the expressionof esIFN-� and esIFN-�. Cells were seeded as described above and then

transfected with 1.2 �g of pcDNAesIFN� or pcDNAesIFN� plasmid using2 �l of Lipofectamine 2000 (Invitrogen) according to the manufacturer’sinstructions. Transfection with empty plasmid pcDNA3 was used as anegative control, with 10 �g of polyinosinic-polycytidylic acid [poly(I·C);Invivogen]/ml as a positive control and without transfection as a blankcontrol. After transfection and incubation in a humidified atmosphere at37°C and 5% CO2 for 24 h, the supernatants were harvested and stored at�20°C for an IFN activity test. Cells were collected into RLT bufferand used for RNA extraction. To measure the capability of esIFN-� andesIFN-� to activate IFN signaling, the expression level of IFN-stimulatedgene 56 (ISG56), myxovirus resistance 1 (Mx1), and IFN-induced proteinwith tetratricopeptide repeat 3 (IFIT3) as downstream indicators of thepathway were determined by quantitative RT-PCR (qRT-PCR) as de-scribed below.

Antiviral assay. To study the inhibitory effect of IFN-� and IFN-� onviral replication, in vitro E. serotinus brain cells were seeded into 24-wellplates at a density of 2 105 cells/well. At 3 h after seeding, cells werewashed with PBS and subsequently stimulated with MBP-tagged esIFN-�or esIFN-� at concentrations of 1 and 10 �g/ml for 24 h. Similarly, to testthe activity of recombinant esIFN-� and esIFN-� overexpressed from thebat cell line, serial dilutions (1:2, 1:8, and 1:32) of the supernatants fromtransfected cells described above were added instead of MBP-tagged pro-teins into a final volume of a 500-�l stimulation system. After 24 h, thecells were washed with PBS twice and infected with EBLV-1 (E. serotinus

FIG 1 continued

Antiviral Activity of IFN-� and -� from E. serotinus

May 2014 Volume 88 Number 10 jvi.asm.org 5447

on February 7, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

isolate), EBLV-2 (M. daubentoni isolate), or RABV (European fox isolate)at a multiplicity of infection (MOI) of 0.1 for another 24 h. Subsequently,the cells were washed with PBS and collected into RLT, and RNA wasprepared by using an RNeasy minikit (Qiagen). The relative viral load wasanalyzed by qRT-PCR as described below.

qRT-PCR. The qRT-PCR method was introduced to measure themRNA expression levels of IFN-�, IFN-�, and IFN-induced genes in re-sponse to stimulation. The primers used for target genes and internalcontrol GAPDH (glyceraldehyde-3-phosphate dehydrogenase) are listedin Table 1. Likewise, to determine the relative viral loads indicative of virusreplication after IFN stimulation in E. serotinus brain cells, qRT-PCR wasperformed using EBLV-1-, EBLV-2-, and RABV-specific primers to targetlyssavirus nucleoprotein genes (Table 1). qRT-PCR was performed usingthe CFX96 TouchDetection system (Bio-Rad, USA) with a SensiFASTSYBR one-step kit (Bioline, United Kingdom) according to the manufac-turer’s instructions. To assess the specificity of the PCR amplification, amelting-curve analysis was performed at the end of the reaction. Therelative expression levels of targets were calculated by the 2���CT method(32).

Statistical analysis. All data are presented as means � the standarddeviations. Statistically significant differences were analyzed by one-wayanalysis of variance using the SPSS software package.

Nucleotide sequence accession numbers. Complete ORFs and partialpromoter regions were submitted to GenBank under accession numbersKF758763 (esIFN-�) and KF758764 (esIFN-�).

RESULTSSequence characteristics of esIFN-� and esIFN-�. IFN-� (scaf-fold no. GL430113; bp 491398 to 492675) and IFN-� (scaffold no.GL429988; bp 1422681 to 1423811) genes of M. lucifugus in En-sembl were used as reference sequences to design primers to am-plify 376 bp of esIFN-� and 404 bp of esIFN-� specific fragmentsfrom E. serotinus. Complete ORFs and partial promoter regionswere further obtained by Genome walking and submitted toGenBank. ORFs of esIFN-� and esIFN-� consisted of 627 bp (encod-ing 208 amino acids) and 588 bp (encoding 195 amino acids),respectively (Fig. 1). Both IFNs contain a signal peptide and inter-feron alpha, beta, and delta domains (IFabd) (Fig. 1). Sequenceanalysis revealed that both esIFN-� and esIFN-� genes are intron-less. The potential transcription start sites of both genes were in-dicated by a promoter predictor revealing 2,038 bp for esIFN-�and 1,071 bp for esIFN-� promoter sequences (Fig. 1). Transcrip-tion factor binding sites such as IRFs, ISREs, and NF-�B werefound in both promoter regions by MatInspector (Fig. 1). N-gly-cosylation sites were identified in esIFN-� (50-NMSK-53) andesIFN-� (95-NSSV-98) by the PROSITE tool (Fig. 1).

Phylogenetic analysis. Phylogenetic trees of IFN-� and IFN-�were constructed based on alignments of protein sequences fromE. serotinus with sequences from 12 mammal species, includingone human and five Chiroptera, by the neighbor-joining method.The results showed that the IFNs of bats are distantly related tothose of other mammals and humans, with Megachiroptera andMicrochirotpera obviously forming two separate genetic groups(Fig. 2). By sharing 87 to 95% protein sequence similarities,IFN-�s from E. serotinus, M. lucifugus, and M. brandtii formed asister branch. In contrast, IFN-� from the megabat P. vampyrusclustered first into a nonbat mammalian group. The selectedIFN-� protein sequences of different bat species share 59 to 90%sequence similarities and were grouped together.

Recombinant esIFN-� and esIFN-� initiate IFN signaling inthe E. serotinus brain cell line. To evaluate the biological activitiesof both IFNs, the expression levels of ISG56 mRNA were assessedby qRT-PCR after activation by E. coli-derived recombinantesIFN-� and esIFN-�. In esIFN-�-treated cells, ISG56 expressionappeared to be dose dependent, with increases of 2-fold in the1-�g/ml group and �17-fold in the 10-�g/ml group (P � 0.05)(Fig. 3A). In contrast to esIFN-� stimulation, ISG56 expressionwas not induced by esIFN-� (Fig. 3A).

To ensure that the expression in E. coli does not influence bio-logical activity, esIFN-� and esIFN-� were also expressed in the E.serotinus cell line. The qRT-PCR results showed that both recom-binant esIFN-� and recombinant esIFN-� can induce the expres-sion of ISG56 (Fig. 3B). In particular, in pcDNAesIFN�-trans-fected cells ISG56 expression was 100-fold higher than in thepositive control transfected with poly(I·C) (P � 0.01) (Fig. 3B).The upregulation of ISG56 in pcDNAesIFN�-transfected cells in-duced a 9-fold enhancement compared to empty plasmid (P �0.05) (Fig. 3B). In addition to ISG56, Mx1 and IFIT3 were alsoelevated 5- and 14-fold, respectively, in response to poly(I·C)

FIG 2 Phylogenetic analysis of IFN-� (A) and IFN-� (B) protein sequences byneighbor-joining method with bootstrap value at n � 1,000. (A) Protein se-quences used for IFN-�: dog, Canis lupus familiaris (XP_003639432); human,Homo sapiens (NP_064509); horse, Equus caballus (XP_001497233); pig, Susscrofa (NP_001158329); monkey, Nomascus leucogenys (XP_003281871);sheep, Ovis aries (XP_004004472); cattle, Bos Taurus (NP_001193352); andbats, P. vampyrus (ADK60922), M. brandtii (EPQ20610), M. lucifugus(GL430113:491398:492675:1), and E. serotinus (KF758763). (B) Protein se-quences used for IFN-�: human, H. sapiens (EAW58624); horse, E. caballus(XP_003364007); pig, S. scrofa (ACF17563); sheep, O. aries (AAA31507); cat-tle, B. taurus (XP_876525); cat, Felis catus(NP_001095910); and bats, P. alecto(ELK15819), Eidolon helvum (AFH73816), M. davidii (ELK26495), M. brandtii(EPQ20230), M. lucifugus (GL429988:1422681:1423811:1), and E. serotinus(KF758764). A triangle (Œ) indicates a bat species.

He et al.

5448 jvi.asm.org Journal of Virology

on February 7, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

stimulation (P � 0.05) and 30- and 41-fold, respectively, in re-sponse to pcDNAesIFN� transfection (P � 0.01) (Fig. 3B).

esIFN-� and esIFN-� inhibit the replication of lyssavirusesin a bat cell line. The inhibition of lyssavirus replication wasdetermined by qRT-PCR to measure the relative virus RNAlevels after infection in esIFN-�- and esIFN-�-pretreated celllines. Generally, both esIFN-� and esIFN-� can inhibit lyssavi-rus EBLV-1, EBLV-2, and RABV replication in the E. serotinusbrain cell line to different extents. Although esIFN-� did notinfluence the viral replication of EBLV-1, esIFN-� showed adose-dependent suppression (58 to 91% reduction) (P � 0.05)(Fig. 4A). The control tag MBP did not inhibit EBLV-1 repli-cation (Fig. 4A).

In further step, both esIFN-�- and esIFN-�-containing super-natants were used for the antiviral assays against EBLV-2 andRABV, in addition to EBLV-1. In the EBLV-1-infected group, su-pernatants from poly(I·C)- and pcDNAesIFN�-transfected cellsshowed moderately inhibitory effects (54 to 69% reduction) on

EBLV-1 replication (P � 0.05), whereas the empty plasmidpcDNA3 supernatant showed no effect (Fig. 4B). The esIFN-�supernatant led to a dose-dependent reduction of virus RNA from92 to 98% (P � 0.01) (Fig. 4B).

In the EBLV-2-infected group, poly(I·C)-transfected superna-tants showed a slight inhibitory potency to EBLV-2 infection (Fig.4C). Although esIFN-� reduced 11 to 46% of the virus RNA atdifferent concentrations, esIFN-� decreased 67 to 86% (P � 0.01)(Fig. 4C). In the RABV-infected group, the negative control andpoly(I·C)-transfected supernatants had no effect on RABV infec-tion (Fig. 4D). Suppression effects were observed in the esIFN-�-treated groups at high concentrations (78% reduction) and in theesIFN-�-treated groups at all concentrations used (87 to 91%)(P � 0.01; Fig. 4D). Overall, both recombinant esIFN-� and es-IFN-� showed antiviral properties in the E. serotinus brain cellline, but esIFN-� had a stronger effect than esIFN-�. The inhibi-tory effect of esIFN-� against different lyssaviruses varies, with theorder EBLV-1 � RABV � EBLV-2.

FIG 3 esIFN-� and esIFN-� initiate IFN signaling in an E. serotinus brain cell line. (A) Cells were treated with either recombinant esIFN-� and esIFN-�MBP-tagged proteins (1 and 10 �g/ml) or MBP alone (1 and 10 �g/ml) for 3 h as described in the text. Only the higher concentration (10 �g/ml) of recombinantesIFN-� induced a significant increase in ISG56 mRNA (*, P � 0.05), as measured by qRT-PCR. (B) Cells were transfected with esIFN-� and esIFN-� expressionplasmids (1.2 �g/well in a 12-well plate) or poly(I·C) at 10 �g/ml as a positive control. Note that eukaryotic expressed esIFN-� and esIFN-� induced a muchstronger ISG56 mRNA level, as measured by qRT-PCR. The expressions of Mx1 and IFIT3 were also upregulated by esIFN-�.

Antiviral Activity of IFN-� and -� from E. serotinus

May 2014 Volume 88 Number 10 jvi.asm.org 5449

on February 7, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

Expression patterns of IFNs and IFN-induced genes duringlyssavirus infection. To investigate the interaction between hostIFN signaling and lyssavirus, the mRNA expression of esIFN-�,esIFN-�, and the IFN-induced genes ISG56, Mx1, and IFIT3 wasmeasured by qRT-PCR after lyssavirus infection. Overall, a si-lent expression pattern was observed (Fig. 4A and B). IFN-�expression did not change during infection, whereas IFN-� wasactually downregulated 50% by all three viruses (P � 0.01)(Fig. 5A). Similarly, the three tested IFN-induced genes re-mained silent or at a nearly silent level with the exception ofISG56, which slightly increased in response to EBLV-2 infec-tion (P � 0.05) (Fig. 5B).

To further evaluate whether the esIFN-�- and esIFN-�-medi-ated antiviral responses were still induced efficiently after viralinfection, the expression levels of IFN-induced genes were quan-tified. ISG56, Mx1, and IFIT3 expression displayed a variouslyupregulated level in IFN-�-pretreated, subsequently infected cells

(P � 0.05) (Fig. 6). In contrast, no induced expression was seen inthe IFN-�-pretreated, subsequently infected cells (Fig. 6).

DISCUSSION

The identification of bats as a potential reservoir for zoonoticdiseases, such as those caused by RABV, SARS-CoV, or Hendravirus, has drawn attention to the bat immune system (6). In par-ticular, the ability of bats to host these infections without obviousclinical signs is still enigmatic to the scientific community (33, 34).Presumably, the long coevolution contributed to the developmentof protective mechanisms, allowing a long coexistence of bats to-gether with their viruses. As in other species, IFNs play a pivotalrole in the antiviral protection of the host. To address this issue forEuropean bats in the context of lyssavirus infections, we studiedthe activities of IFNs in vitro using established an bat cell line.

Thus, we focused here on cloning and characterizing type IIFNs from E. serotinus. First, IFN-� and -� were cloned com-

FIG 4 esIFN-� and esIFN-� inhibit lyssavirus replication in an E. serotinus brain cell line. (A) Cells pretreated for 24 h with recombinant E. coli-derived esIFN-�and esIFN-� MBP-tagged proteins (1 and 10 �g/ml) or MBP alone (1 and 10 �g/ml) and then infected with EBLV-1 (MOI of 0.1) for 24 h. (B to D) Cellspretreated 24 h with recombinant eukaryotic expressed IFN in supernatants from an esIFN-�- and esIFN-�-transfected E. serotinus brain cell line and infectedwith EBLV-1 (B), EBLV-2 (C), or RABV (D) (MOI of 0.1) for 24 h. The viral replication was determined by qRT-PCR for lyssavirus nucleoprotein gene. Only theE. coli-derived esIFN-� MBP-tagged proteins inhibited the EBLV-1 replication in a dose-dependent manner. In contrast, both recombinant eukaryotic derivedesIFN-� and esIFN-� inhibited the replication of EBLV-1 (B), EBLV-2 (C), or RABV (D) in a dose-dependent manner. However, esIFN-� showed a much weakeractivity, especially against EBLV-2 and RABV.

He et al.

5450 jvi.asm.org Journal of Virology

on February 7, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

pletely, whereas IFN-� and -� sequences could not be found.Therefore, we concentrated on molecular and functional character-ization of IFN-� and -� from the serotine bat. The sequence charac-teristics of intronless genomic organization, conserved N-glycosyla-tion sites of esIFN-� and esIFN-� demonstrated the structuralsimilarities of these two type I IFNs from serotine bat to those of othermammals (35). Furthermore, these findings indicate that bat IFN-�and IFN-� probably share similar functions with the IFNs of othermammals; this was also confirmed by structural conservation of theesIFN-� and esIFN-� promoter region. Transcription factors such asIRF, ISRE, ATF2/c-Jun, and NF-�B binding sites could be identifiedin the proximal promoter regions of esIFN-�and esIFN-�, suggestingthat the transcriptional regulation of bat type I IFNs is fundamentallysimilar to that of other mammals. However, the different IRF mem-bers and various positions of IRF and NF-�B binding elements sug-gested that esIFN-� and esIFN-� are likely to be regulated in a differ-ent manner. The identification of transcription factor binding sites isjust the first step in investigating the intricate regulatory network ofthe less-studied type I IFN members � and �. To address the interac-tions between these regulatory elements and transcription factors and

to understand how the transcription factors cooperate to regulate theexpression of IFN-� and IFN-�, functional studies are required.

All type I IFN genes have been identified in mammals in onesingle chromosomal region and expanded by duplication duringevolution (17, 36). However, the IFN-� gene is found outside thetype I IFN locus, suggesting an independent development in dif-ferent mammalian families (36). Given the evolutionary related-ness of bats (37, 38), IFN-� gene sequences in bat species should bemore diversified. In fact, the results of our phylogenetic analysis,in which IFN-� sequences from microchiroptera and megachirop-tera grouped separately from other mammals (including hu-mans), support this hypothesis. Interestingly, both IFNs of E. se-rotinus grouped with other microbat-associated sequences, albeita clear separation from Myotis IFNs—i.e., M. lucifugus, M.brandtii, and M. davidii—is visible. A similar genetic separationbetween these two bat families was also observed following com-parison of the cytochrome b sequences used for species identifica-tion (39). The sequence conservation, as well as the diversificationof IFN-� and IFN-� in different bat families, implies the presenceof evolving and adaptable IFNs in bat species.

FIG 5 Expression patterns of esIFN-�, esIFN-�, and IFN-induced genes after lyssavirus infection. An E. serotinus brain cell line was infected with EBLV-1,EBLV-2, or RABV (MOI of 0.1) for 24 h, and the expression of esIFN-� and esIFN-� (A) and IFN-induced genes ISG56, Mx1, and IFIT3 (B) was measured byqRT-PCR. Note the downregulation of esIFN-� by 50% in the virus-infected cells (A) and the weakly increased expression of ISG56 after EBLV-2 infection,whereas the expression level of all of the other IFN-induced genes was not changed (B).

Antiviral Activity of IFN-� and -� from E. serotinus

May 2014 Volume 88 Number 10 jvi.asm.org 5451

on February 7, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

FIG 6 Expression patterns of IFN induced genes in esIFN-�- and esIFN-�-pretreated cells after lyssavirus infection. The cells were pretreated with recombinanteukaryotic expressed IFN in supernatants from esIFN-�- and esIFN-�-transfected E. serotinus brain cell line and then infected with EBLV-1 (A), EBLV-2 (B), andRABV (C) (MOI of 0.1) for 24 h. The expression of IFN-induced genes ISG56, Mx1, and IFIT3 was determined by qRT-PCR. Only in IFN-�-pretreated cells didISG56, Mx1, and IFIT3 expression displayed a low upregulation, whereas in IFN-�-pretreated cells, no induced induction of these genes was seen.

He et al.

5452 jvi.asm.org Journal of Virology

on February 7, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

To determine the functional characteristics of IFN-� and IFN-�in bats against virus infection, recombinant IFN-� and IFN-� fromE. serotinus were expressed in both prokaryotic and eukaryoticsystems and used for functional studies. The upregulation of IFN-induced genes by esIFN-� and esIFN-� demonstrated that bothIFNs work as functional molecules, inducing IFN signal pathwaysin bat cell lines. Particularly, different properties of esIFN-� andesIFN-� in the activation of IFN-induced genes implied theirfunctional divergence in downstream signaling or effecting celltypes.

To further study their antiviral functions, the activities ofesIFN-� and esIFN-� were investigated against different lyssavi-ruses (EBLV-1, EBLV-2, and RABV) in an E. serotinus brain cellline. Both esIFN-� and esIFN-� proteins demonstrated antiviralactivity. This is consistent with type I IFNs limiting RABV infec-tion in mice (12). Previous studies reported that recombinant typeIII IFN and type II IFN from P. alecto can inhibit Pulau virusreplication and Semliki Forest virus and Hendra virus replication,respectively (22, 23). However, the antiviral activity of bat type IIFNs is less studied. In addition, no study has yet shownwhether bat IFNs are pathogen associated. In the present study,the different inhibitory extents of esIFN-� and esIFN-� toEBLV-1, EBLV-2, and RABV provided evidence for such anassociation between IFNs and different viruses. The strong in-hibition of EBLV-1 replication in the E. serotinus cell line bythese two type I IFNs suggests that esIFN-� and esIFN-� areinvolved in an anti-lyssavirus innate immune defense mecha-nisms in natural hosts.

However, as shown by the experiments performed here, theinteraction between the virus and the bat IFN response seems to bemore complex. Although the restriction of viral replication in theIFN pretreated cells suggested a robust IFN-mediated innate im-mune reaction limiting virus spread at an early infection stage, thegeneral silencing of esIFN-�, esIFN-�, and their induced genesduring infection indicates that bat-associated lyssaviruses can in-terfere with the signaling cascades, leading to transcriptional acti-vation of the IFN system. This further highlights the importanceof lyssaviral countermeasures against the host type I IFN systemfor the establishment of an infection (14, 40, 41). Taken together,these results indicate a balance of persistent infection and limitedviral growth, elucidating our understanding of the coexistence oflyssaviruses in bats under natural conditions.

To conclude, type I IFN-� and IFN-� were cloned and func-tionally characterized from E. serotinus. Sequence and functionalanalysis revealed that whereas type I IFNs are generally conservedamong mammals, these IFNs are evolutionally divergent andadapted in bats. Analysis of the promoter regions of esIFN-� andesIFN-� provided evidence for the control architecture of IFN-�and IFN-� transcription, and functional studies indicated theirdifferent capacities in antiviral activity. Overall, the present studyof esIFN-� and esIFN-� provides functional data on the interac-tions of the IFN system and lyssaviruses in bats, add to our under-standing of the long-term coexistence of bats with rabies, andexpands our general knowledge of type I IFNs in mammals. In anongoing functional study, we are investigating type I IFNs, includ-ing IFN-�, -�, -�, and -�, in order to understand the complexinteractions between lyssaviruses and their natural host in vitro ina more comprehensive way.

ACKNOWLEDGMENTS

This study was financially supported by the Bundesministerium für Bil-dung und Forschung (grant 01KI1016A).

We thank Stefan Finke for the RABV strain, Günther Keil for thepcDNA3 plasmid, and Yang Zhang for the pMAL-c2X plasmid.

REFERENCES1. Altringham JD. 2011. Bats: from evolution to conservation, 2nd ed, p 319.

Oxford University Press, Inc, New York, NY.2. Calisher CH, Childs JE, Field HE, Holmes KV, Schountz T. 2006. Bats:

important reservoir hosts of emerging viruses. Clin. Microbiol. Rev. 19:531–545. http://dx.doi.org/10.1128/CMR.00017-06.

3. Li W, Shi Z, Yu M, Ren W, Smith C, Epstein JH, Wang H, Crameri G, HuZ, Zhang H, Zhang J, McEachern J, Field H, Daszak P, Eaton BT, ZhangS, Wang LF. 2005. Bats are natural reservoirs of SARS-like coronaviruses.Science 310:676–679. http://dx.doi.org/10.1126/science.1118391.

4. Halpin K, Young PL, Field HE, Mackenzie JS. 2000. Isolation of Hendravirus from pteropid bats: a natural reservoir of Hendra virus. J. Gen. Virol.81:1927–1932.

5. Muller T, Cox J, Peter W, Schafer R, Johnson N, McElhinney LM, GeueJL, Tjornehoj K, Fooks AR. 2004. Spill-over of European bat lyssavirustype 1 into a stone marten (Martes foina) in Germany. J. Vet. Med. BInfect. Dis. Vet. Public Health 51:49 –54. http://dx.doi.org/10.1111/j.1439-0450.2003.00725.x.

6. Wibbelt G, Moore MS, Schountz T, Voigt CC. 2010. Emerging diseasesin Chiroptera: why bats? Biol. Lett. 6:438 – 440. http://dx.doi.org/10.1098/rsbl.2010.0267.

7. Harris SL, Brookes SM, Jones G, Hutson AM, Fooks AR. 2006. Passivesurveillance (1987 to 2004) of United Kingdom bats for European bat lyssa-viruses. Vet. Rec. 159:439–446. http://dx.doi.org/10.1136/vr.159.14.439.

8. Baker ML, Schountz T, Wang LF. 2013. Antiviral immune responses ofbats: a review. Zoonoses Public Health 60:104 –116. http://dx.doi.org/10.1111/j.1863-2378.2012.01528.x.

9. Dobson AP. 2005. Virology: what links bats to emerging infectious dis-eases? Science 310:628 – 629. http://dx.doi.org/10.1126/science.1120872.

10. Paul BN, Chakravarty AK. 1986. In vitro analysis of delayed immuneresponse in a bat, Pteropus giganteus: process of con-A mediated activation.Dev. Comp. Immunol. 10:55– 67. http://dx.doi.org/10.1016/0145-305X(86)90044-3.

11. Chakravarty AK, Sarkar SK. 1994. Immunofluorescence analysis of im-munoglobulin bearing lymphocytes in the Indian fruit bat: Pteropus gigan-teus. Lymphology 27:97–104.

12. Chopy D, Detje CN, Lafage M, Kalinke U, Lafon M. 2011. The type Iinterferon response bridles rabies virus infection and reduces pathogenicity. J.Neurovirol. 17:353–367. http://dx.doi.org/10.1007/s13365-011-0041-6.

13. Chopy D, Pothlichet J, Lafage M, Megret F, Fiette L, Si-Tahar Lafon MM.2011. Ambivalent role of the innate immune response in rabies virus patho-genesis. J. Virol. 85:6657–6668. http://dx.doi.org/10.1128/JVI.00302-11.

14. Rieder M, Conzelmann KK. 2011. Interferon in rabies virus infection.Adv. Virus Res. 79:91–114. http://dx.doi.org/10.1016/B978-0-12-387040-7.00006-8.

15. Rieder M, Finke S, Conzelmann KK. 2012. Interferon in lyssavirusinfection. Berl. Munch. Tierarztl. Wochenschr. 125:209 –218.

16. Walker AM, Roberts RM. 2009. Characterization of the bovine type I IFNlocus: rearrangements, expansions, and novel subfamilies. BMC Genom-ics 10:187. http://dx.doi.org/10.1186/1471-2164-10-187.

17. Diaz MO, Pomykala HM, Bohlander SK, Maltepe E, Malik K, Brown-stein B, Olopade OI. 1994. Structure of the human type-I interferon genecluster determined from a YAC clone contig. Genomics 22:540 –552. http://dx.doi.org/10.1006/geno.1994.1427.

18. LaFleur DW, Nardelli B, Tsareva T, Mather D, Feng P, Semenuk M,Taylor K, Buergin M, Chinchilla D, Roshke V, Chen G, Ruben SM,Pitha PM, Coleman TA, Moore PA. 2001. Interferon-kappa, a novel typeI interferon expressed in human keratinocytes. J. Biol. Chem. 276:39765–39771. http://dx.doi.org/10.1074/jbc.M102502200.

19. Zhou P, Cowled C, Wang LF, Baker ML. 2013. Bat Mx1 and Oas1, but notPkr, are highly induced by bat interferon and viral infection. Dev. Comp.Immunol. 40:240–247. http://dx.doi.org/10.1016/j.dci.2013.03.006.

20. Biesold SE, Ritz D, Gloza-Rausch F, Wollny R, Drexler JF, CormanVM, Kalko EK, Oppong S, Drosten C, Muller MA. 2011. Type I inter-feron reaction to viral infection in interferon-competent, immortalized

Antiviral Activity of IFN-� and -� from E. serotinus

May 2014 Volume 88 Number 10 jvi.asm.org 5453

on February 7, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

cell lines from the African fruit bat Eidolon helvum. PLoS One 6:e28131.http://dx.doi.org/10.1371/journal.pone.0028131.

21. Virtue ER, Marsh GA, Baker ML, Wang LF. 2011. Interferon productionand signaling pathways are antagonized during henipavirus infection offruit bat cell lines. PLoS One 6:e22488. http://dx.doi.org/10.1371/journal.pone.0022488.

22. Janardhana V, Tachedjian M, Crameri G, Cowled C, Wang LF, BakerML. 2012. Cloning, expression, and antiviral activity of IFN from theAustralian fruit bat, Pteropus alecto. Dev. Comp. Immunol. 36:610 – 618.http://dx.doi.org/10.1016/j.dci.2011.11.001.

23. Zhou P, Cowled C, Todd S, Crameri G, Virtue ER, Marsh GA, Klein R, ShiZ, Wang LF, Baker ML. 2011. Type III IFNs in pteropid bats: differentialexpression patterns provide evidence for distinct roles in antiviral immunity.J. Immunol. 186:3138–3147. http://dx.doi.org/10.4049/jimmunol.1003115.

24. Omatsu T, Bak EJ, Ishii Y, Kyuwa S, Tohya Y, Akashi H, Yoshikawa Y.2008. Induction and sequencing of Rousette bat interferon alpha and betagenes. Vet. Immunol. Immunopathol. 124:169 –176. http://dx.doi.org/10.1016/j.vetimm.2008.03.004.

25. Amengual B, Whitby JE, King A, Cobo JS, Bourhy H. 1997. Evolutionof European bat lyssaviruses. J. Gen. Virol. 78(Pt 9):2319 –2328.

26. Kuzmin IV, Hughes GJ, Botvinkin AD, Orciari LA, Rupprecht CE.2005. Phylogenetic relationships of Irkut and West Caucasian bat viruseswithin the Lyssavirus genus and suggested quantitative criteria based onthe N gene sequence for lyssavirus genotype definition. Virus Res. 111:28 –43. http://dx.doi.org/10.1016/j.virusres.2005.03.008.

27. Freuling CM, Beer M, Conraths FJ, Finke S, Hoffmann B, Keller B,Kliemt J, Mettenleiter TC, Muhlbach E, Teifke JP, Wohlsein P, MullerT. 2011. Novel lyssavirus in Natterer’s bat, Germany. Emerg. Infect. Dis.17:1519 –1522. http://dx.doi.org/10.3201/eid1708.110201.

28. Arechiga Ceballos N, Vazquez Moron S, Berciano JM, Nicolas O, AznarLopez C, Juste J, Rodriguez Nevado C, Aguilar Setien A, Echevarria JE.2013. Novel lyssavirus in bat, Spain. Emerg. Infect. Dis. 19:793–795. http://dx.doi.org/10.3201/eid1905.121071.

29. Schatz J, Fooks AR, McElhinney L, Horton D, Echevarria J, Vazquez-Moron S, Kooi EA, Rasmussen TB, Müller T, Freuling CM. 2013. Batrabies surveillance in Europe. Zoonoses Public Health 60:22–34. http://dx.doi.org/10.1111/zph.12002.

30. De Angioletti M, Lacerra G, Sabato V, Carestia C. 2004. Beta�45 G¡C: a novel

silentbeta-thalassaemiamutation,thefirstintheKozaksequence.Br.J.Haematol.124:224–231. http://dx.doi.org/10.1046/j.1365-2141.2003.04754.x.

31. He X, Zhang Y, Yu Z. 2011. An Mpeg (macrophage expressed gene) fromthe Pacific oyster Crassostrea gigas: molecular characterization and geneexpression. Fish Shellfish Immunol. 30:870 – 876. http://dx.doi.org/10.1016/j.fsi.2011.01.009.

32. Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression datausing real-time quantitative PCR and the 2���CT method. Methods 25:402– 408. http://dx.doi.org/10.1006/meth.2001.1262.

33. Freuling C, Vos A, Johnson N, Fooks AR, Muller T. 2009. Bat rabies: aGordian knot? Berl. Munch. Tierarztl. Wochenschr. 122:425– 433.

34. Wynne JW, Wang LF. 2013. Bats and viruses: friend or foe? PLoS Pathog.9:e1003651. http://dx.doi.org/10.1371/journal.ppat.1003651.

35. Hughes AL. 1995. The evolution of the type I interferon gene family inmammals. J. Mol. Evol. 41:539 –548.

36. Hardy MP, Owczarek CM, Jermiin LS, Ejdeback M, Hertzog PJ. 2004.Characterization of the type I interferon locus and identification of novelgenes. Genomics 84:331–345. http://dx.doi.org/10.1016/j.ygeno.2004.03.003.

37. Pettigrew JD, Jamieson BG, Robson SK, Hall LS, McAnally KI, CooperHM. 1989. Phylogenetic relations between microbats, megabats, and pri-mates (Mammalia: Chiroptera and Primates). Philos. Trans. R. Soc. Lond.B Biol. Sci. 325:489 –559. http://dx.doi.org/10.1098/rstb.1989.0102.

38. Mindell DP, Dick CW, Baker RJ. 1991. Phylogenetic relationshipsamong megabats, microbats, and primates. Proc. Natl. Acad. Sci. U. S. A.88:10322–10326. http://dx.doi.org/10.1073/pnas.88.22.10322.

39. Ruedi M, Stadelmann B, Gager Y, Douzery EJ, Francis CM, Lin LK,Guillen-Servent A, Cibois A. 2013. Molecular phylogenetic reconstruc-tions identify East Asia as the cradle for the evolution of the cosmopolitangenus Myotis (Mammalia, Chiroptera). Mol. Phylogenet. Evol. 69:437–449. http://dx.doi.org/10.1016/j.ympev.2013.08.011.

40. Wiltzer L, Larrous F, Oksayan S, Ito N, Marsh GA, Wang L, Blondel D,Bourhy H, Jans DA, Moseley GW. 2012. Conservation of a uniquemechanism of immune evasion across the Lyssavirus genus. J. Virol. 86:10194 –10199. http://dx.doi.org/10.1128/JVI.01249-12.

41. Lieu KG, Brice A, Wiltzer L, Hirst B, Jans DA, Blondel D, Moseley GW.2013. The rabies virus interferon antagonist P protein interacts with acti-vated STAT3 and inhibits Gp130 receptor signaling. J. Virol. 87:8261–8265. http://dx.doi.org/10.1128/JVI.00989-13.

He et al.

5454 jvi.asm.org Journal of Virology

on February 7, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from