ENEE244-02xx Digital Logic Design Lecture 10. Announcements HW4 assigned, due 10/9.
Announcements All groups have been assigned Homework: By this evening email everyone in your group...
-
Upload
charlotte-brooks -
Category
Documents
-
view
214 -
download
0
Transcript of Announcements All groups have been assigned Homework: By this evening email everyone in your group...
![Page 1: Announcements All groups have been assigned Homework: By this evening email everyone in your group and set up a meeting time to discuss project 4 Project.](https://reader037.fdocuments.net/reader037/viewer/2022110213/56649e7a5503460f94b7b591/html5/thumbnails/1.jpg)
AnnouncementsAll groups have been assigned
Homework:By this evening email everyone in your group and
set up a meeting time to discuss project 4
Project 4 will be released tomorrowYou will have roughly 3 weeks to work on it
![Page 2: Announcements All groups have been assigned Homework: By this evening email everyone in your group and set up a meeting time to discuss project 4 Project.](https://reader037.fdocuments.net/reader037/viewer/2022110213/56649e7a5503460f94b7b591/html5/thumbnails/2.jpg)
How do I work in a team?Communication
Teams that do not communicate well do poorly on the project
Understanding the assignmentTeams that sit down and go over the assignment
together do well
Battle planOutline the project in your own English text
Code togetherDifficult parts of the project are best done together
![Page 3: Announcements All groups have been assigned Homework: By this evening email everyone in your group and set up a meeting time to discuss project 4 Project.](https://reader037.fdocuments.net/reader037/viewer/2022110213/56649e7a5503460f94b7b591/html5/thumbnails/3.jpg)
Parsing TextThe vast majority of the information present on
the internet is in text formData, webpages, etc
We want to transform the data into a more usable form Examples we have seen thus far:
Encoding of a matrixEncoding of a treeProject 3, changing text (encrypting and decrypting)
![Page 4: Announcements All groups have been assigned Homework: By this evening email everyone in your group and set up a meeting time to discuss project 4 Project.](https://reader037.fdocuments.net/reader037/viewer/2022110213/56649e7a5503460f94b7b591/html5/thumbnails/4.jpg)
Example: Finding a nucleotide sequence
We can find DNA sequences of parasites on the internet (typically in databases)
Problem: we want to know if a sequence of nucleotides is in a particular parasiteWe not only want to know “yes” or “no” but which
parasite
![Page 5: Announcements All groups have been assigned Homework: By this evening email everyone in your group and set up a meeting time to discuss project 4 Project.](https://reader037.fdocuments.net/reader037/viewer/2022110213/56649e7a5503460f94b7b591/html5/thumbnails/5.jpg)
What the data looks like>Schisto unique AA825099
gcttagatgtcagattgagcacgatgatcgattgaccgtgagatcgacga
gatgcgcagatcgagatctgcatacagatgatgaccatagtgtacg
>Schisto unique mancons0736
ttctcgctcacactagaagcaagacaatttacactattattattattatt
accattattattattattattactattattattattattactattattta
ctacgtcgctttttcactccctttattctcaaattgtgtatccttccttt
![Page 6: Announcements All groups have been assigned Homework: By this evening email everyone in your group and set up a meeting time to discuss project 4 Project.](https://reader037.fdocuments.net/reader037/viewer/2022110213/56649e7a5503460f94b7b591/html5/thumbnails/6.jpg)
How are we going to do it?First, we get the sequences in a big string.
Next, we find where the small subsequence is in the big string.
From there, we need to work backwards until we find “>” which is the beginning of the line with the sequence name.
From there, we need to work forwards to the end of the line. From “>” to the end of the line is the name of the sequence Yes, this is hard to get right.
![Page 7: Announcements All groups have been assigned Homework: By this evening email everyone in your group and set up a meeting time to discuss project 4 Project.](https://reader037.fdocuments.net/reader037/viewer/2022110213/56649e7a5503460f94b7b591/html5/thumbnails/7.jpg)
Lets Review Some Pythonstring.find(sub) – returns the lowest index where
the substring sub is found or -1
string.find(sub, start) – same as above, except using the slice string[start:]
string.find(sub, start, end) – same as above, except using the slice string[start:end]
![Page 8: Announcements All groups have been assigned Homework: By this evening email everyone in your group and set up a meeting time to discuss project 4 Project.](https://reader037.fdocuments.net/reader037/viewer/2022110213/56649e7a5503460f94b7b591/html5/thumbnails/8.jpg)
Lets Review Some Pythonstring.rfind(sub) – returns the highest index
where the substring sub is found or -1
string.rfind(sub, start) – same as above, except using the slice string[start:]
string.rfind(sub, start, end) – same as above, except using the slice string[start:end]
![Page 9: Announcements All groups have been assigned Homework: By this evening email everyone in your group and set up a meeting time to discuss project 4 Project.](https://reader037.fdocuments.net/reader037/viewer/2022110213/56649e7a5503460f94b7b591/html5/thumbnails/9.jpg)
Clicker Question: are these programs
equivalent?
String.find(“two”) String.rfind(“two”)
21
A: yes
B: no
String = “two plus two is four”
![Page 10: Announcements All groups have been assigned Homework: By this evening email everyone in your group and set up a meeting time to discuss project 4 Project.](https://reader037.fdocuments.net/reader037/viewer/2022110213/56649e7a5503460f94b7b591/html5/thumbnails/10.jpg)
Lets solve the problem!
![Page 11: Announcements All groups have been assigned Homework: By this evening email everyone in your group and set up a meeting time to discuss project 4 Project.](https://reader037.fdocuments.net/reader037/viewer/2022110213/56649e7a5503460f94b7b591/html5/thumbnails/11.jpg)
def findSequence(seq):
sequencesFile = "parasites.txt”
file = open(sequencesFile,”r")
sequences = file.read()
file.close()
seqloc = sequences.find(seq)
if seqloc != -1:
# Now, find the ">" with the name of the sequence
nameloc = sequences.rfind(">",0,seqloc) # using rfind() here!!
endline = sequences.find("\n",nameloc)
print ("Found in ",sequences[nameloc:endline])
else:
print ("Not found”)
![Page 12: Announcements All groups have been assigned Homework: By this evening email everyone in your group and set up a meeting time to discuss project 4 Project.](https://reader037.fdocuments.net/reader037/viewer/2022110213/56649e7a5503460f94b7b591/html5/thumbnails/12.jpg)
Why -1?If .find or .rfind don’t find something, they
return -1If they return 0 or more, then it’s the index of
where the search string is found.
Note: last week we saw the urlib moduleIt contains a method that lets you download a file
from the internetHow might you modify your program to first
download the file from the internet prior to opening it?
![Page 13: Announcements All groups have been assigned Homework: By this evening email everyone in your group and set up a meeting time to discuss project 4 Project.](https://reader037.fdocuments.net/reader037/viewer/2022110213/56649e7a5503460f94b7b591/html5/thumbnails/13.jpg)
Running the program
>>> findSequence("tagatgtcagattgagcacgatgatcgattgacc")
Found in >Schisto unique AA825099
>>> findSequence("agtcactgtctggttgaaagtgaatgcttccaccgatt")
Found in >Schisto unique mancons0736
![Page 14: Announcements All groups have been assigned Homework: By this evening email everyone in your group and set up a meeting time to discuss project 4 Project.](https://reader037.fdocuments.net/reader037/viewer/2022110213/56649e7a5503460f94b7b591/html5/thumbnails/14.jpg)
One More Note on ParsingWe saw how to read a file as a string or list of
strings
We saw how to leverage how data was structured to find specific information we were interested in
What if there are many pieces we want to extract?
![Page 15: Announcements All groups have been assigned Homework: By this evening email everyone in your group and set up a meeting time to discuss project 4 Project.](https://reader037.fdocuments.net/reader037/viewer/2022110213/56649e7a5503460f94b7b591/html5/thumbnails/15.jpg)
Revisiting SplitString.split(delimiter) break the string String into
parts, separated by the delimiterprint (“a b c d”.split(“ “))
Would print: [‘a’, ‘b’, ‘c’, ‘d’]
• Some quirky cases for string.split()• Explained in pre lab 10
![Page 16: Announcements All groups have been assigned Homework: By this evening email everyone in your group and set up a meeting time to discuss project 4 Project.](https://reader037.fdocuments.net/reader037/viewer/2022110213/56649e7a5503460f94b7b591/html5/thumbnails/16.jpg)
Why is this useful?When reading in a file, we may have many
interesting data items on a given line (or in the file)
Example: Lab 10
![Page 17: Announcements All groups have been assigned Homework: By this evening email everyone in your group and set up a meeting time to discuss project 4 Project.](https://reader037.fdocuments.net/reader037/viewer/2022110213/56649e7a5503460f94b7b591/html5/thumbnails/17.jpg)
How to glue everything together
Step 1) get some interesting data
Step 2) open the file
Step 3) read the data from the file, either as one large string or a list of strings
Step 4) break this string (or list of strings) into the data we want (rfind, find, split)
![Page 18: Announcements All groups have been assigned Homework: By this evening email everyone in your group and set up a meeting time to discuss project 4 Project.](https://reader037.fdocuments.net/reader037/viewer/2022110213/56649e7a5503460f94b7b591/html5/thumbnails/18.jpg)
Abstract ExampleGetting values from a text file
str = file.read()
Lines = str.split(‘\n’) list of strings
for element in Lines: items = element.split(‘ ‘) list of strings
![Page 19: Announcements All groups have been assigned Homework: By this evening email everyone in your group and set up a meeting time to discuss project 4 Project.](https://reader037.fdocuments.net/reader037/viewer/2022110213/56649e7a5503460f94b7b591/html5/thumbnails/19.jpg)
Concrete Examplefoo = "bab cad eag”
elem = foo.split(" ”)
for i in elem:
print(i.split("a"))
['b', 'b']
['c', 'd']
['e', 'g']
![Page 20: Announcements All groups have been assigned Homework: By this evening email everyone in your group and set up a meeting time to discuss project 4 Project.](https://reader037.fdocuments.net/reader037/viewer/2022110213/56649e7a5503460f94b7b591/html5/thumbnails/20.jpg)
CQ:How can I parse all the words in a file?
Assume we have read the file in as one big string (we used file.read()) and the file contains no punctuation
A) first split on “\n” and for each element in the result, we split on “ “
B) only split on “ “
![Page 21: Announcements All groups have been assigned Homework: By this evening email everyone in your group and set up a meeting time to discuss project 4 Project.](https://reader037.fdocuments.net/reader037/viewer/2022110213/56649e7a5503460f94b7b591/html5/thumbnails/21.jpg)
Concrete Clicker Examplefile = open(“text.txt”, “r”)
content = file.read()
line = content.split(“\n”)
for i in line:
print(i.split(“ "))
[‘This', ‘is']
[’a’, ‘file’]
This isa file
text.txt
![Page 22: Announcements All groups have been assigned Homework: By this evening email everyone in your group and set up a meeting time to discuss project 4 Project.](https://reader037.fdocuments.net/reader037/viewer/2022110213/56649e7a5503460f94b7b591/html5/thumbnails/22.jpg)
Example: Get the temperature
The weather is always available on the Internet.
Can we write a function that takes the current temperature out of a source like
http://www.ajc.com/weather or
http://www.weather.com?
![Page 23: Announcements All groups have been assigned Homework: By this evening email everyone in your group and set up a meeting time to discuss project 4 Project.](https://reader037.fdocuments.net/reader037/viewer/2022110213/56649e7a5503460f94b7b591/html5/thumbnails/23.jpg)
The Internet is mostly textWeb pages are actually text in the format called
HTML (HyperText Markup Language)HTML isn’t a programming language,
it’s an encoding language. It defines a set of meanings for certain characters,
but one can’t program in it.
We can ignore the HTML meanings for now, and just look at patterns in the text.
![Page 24: Announcements All groups have been assigned Homework: By this evening email everyone in your group and set up a meeting time to discuss project 4 Project.](https://reader037.fdocuments.net/reader037/viewer/2022110213/56649e7a5503460f94b7b591/html5/thumbnails/24.jpg)
Where’s the temperature?The word
“temperature” doesn’t really show up.
But the temperature always follows the word “Currently”, and always comes before the “<b>°</b>”
<td ><img
src="/shared-local/weather/images/ps.gif" width="48" height="48" border="0"><font size=-2><br></font><font
size="-1" face="Arial, Helvetica, sans-serif"><b>Currently</b><br>
Partly sunny<br>
<font size="+2">54<b>°</b></font><font face="Arial, Helvetica, sans-serif" size="+1">F</font></font></td>
</tr>
![Page 25: Announcements All groups have been assigned Homework: By this evening email everyone in your group and set up a meeting time to discuss project 4 Project.](https://reader037.fdocuments.net/reader037/viewer/2022110213/56649e7a5503460f94b7b591/html5/thumbnails/25.jpg)
We can use the same algorithm we’ve seen previously
Grab the content out of a file in a big string.We’ve saved the HTML page previously.We‘ve seen how to grab it directly.
Find the starting indicator (“Currently”)
Find the ending indicator (“<b>°”)
Read the previous characters
![Page 26: Announcements All groups have been assigned Homework: By this evening email everyone in your group and set up a meeting time to discuss project 4 Project.](https://reader037.fdocuments.net/reader037/viewer/2022110213/56649e7a5503460f94b7b591/html5/thumbnails/26.jpg)
def findTemperature():
weatherFile = "ajc-weather.html”
file = open(weatherFile,”r")
weather = file.read()
file.close()
# Find the Temperature
curloc = weather.find("Currently")
if curloc <> -1:
# Now, find the "<b>°" following the temp
temploc = weather.find("<b>°",curloc)
tempstart = weather.rfind(">",0,temploc)
print ("Current temperature:”,weather[tempstart+1:temploc])
if curloc == -1:
print (”Can't find the temp”)
![Page 27: Announcements All groups have been assigned Homework: By this evening email everyone in your group and set up a meeting time to discuss project 4 Project.](https://reader037.fdocuments.net/reader037/viewer/2022110213/56649e7a5503460f94b7b591/html5/thumbnails/27.jpg)
HomeworkEmail your group members
Read through the project 4 description when it becomes available
![Page 28: Announcements All groups have been assigned Homework: By this evening email everyone in your group and set up a meeting time to discuss project 4 Project.](https://reader037.fdocuments.net/reader037/viewer/2022110213/56649e7a5503460f94b7b591/html5/thumbnails/28.jpg)
Announcements
![Page 29: Announcements All groups have been assigned Homework: By this evening email everyone in your group and set up a meeting time to discuss project 4 Project.](https://reader037.fdocuments.net/reader037/viewer/2022110213/56649e7a5503460f94b7b591/html5/thumbnails/29.jpg)
Dictionaries in PythonUseful Analogy: an actual Dictionary!
English dictionaries provide an association between a Word and a DefinitionWe us the Word to look up the DefinitionGiven a definition it would be very hard to look up
the word
![Page 30: Announcements All groups have been assigned Homework: By this evening email everyone in your group and set up a meeting time to discuss project 4 Project.](https://reader037.fdocuments.net/reader037/viewer/2022110213/56649e7a5503460f94b7b591/html5/thumbnails/30.jpg)
Dictionaries PythonMuch like a dictionary for the English language,
python dictionaries create an association between a key and a valueKey corresponds to a Word in our analogyValue corresponds to a Definition
![Page 31: Announcements All groups have been assigned Homework: By this evening email everyone in your group and set up a meeting time to discuss project 4 Project.](https://reader037.fdocuments.net/reader037/viewer/2022110213/56649e7a5503460f94b7b591/html5/thumbnails/31.jpg)
Dictionary SyntaxA dictionary is a collection of elements
Each element is a key/value
key : value
Just like a list is defined by [ ] a dictionary is defined by { }{‘key1’:value1, ‘key2’:value2, ‘key3’:value3}
![Page 32: Announcements All groups have been assigned Homework: By this evening email everyone in your group and set up a meeting time to discuss project 4 Project.](https://reader037.fdocuments.net/reader037/viewer/2022110213/56649e7a5503460f94b7b591/html5/thumbnails/32.jpg)
KeysA key can be any immutable type (we will
consider two types)Strings and Integers
Much like the [index] is used to select out an element from a list, for a dictionary we use [key]A = {‘key1’:value1, ‘key2’:value2, ‘key3’:value3}
print(A[‘key2’])
![Page 33: Announcements All groups have been assigned Homework: By this evening email everyone in your group and set up a meeting time to discuss project 4 Project.](https://reader037.fdocuments.net/reader037/viewer/2022110213/56649e7a5503460f94b7b591/html5/thumbnails/33.jpg)
Example: Simple Phone Book
phoneBook = {‘Luke’ : ’123 4567’,
‘Dr. Martino’ : ‘456 7890’}
names are keys, phone numbers are values
def lookup(key):
return phoneBook[key]
lookup(‘Dr. Martino’)
![Page 34: Announcements All groups have been assigned Homework: By this evening email everyone in your group and set up a meeting time to discuss project 4 Project.](https://reader037.fdocuments.net/reader037/viewer/2022110213/56649e7a5503460f94b7b591/html5/thumbnails/34.jpg)
Clicker Question: are these programs
equivalent?
A = [‘mike’, ‘mary’, ‘marty’]print A[1]
A = {0:’mike’, 1:’mary’, 2:’marty’}print A[1]
21
A: yes
B: no
![Page 35: Announcements All groups have been assigned Homework: By this evening email everyone in your group and set up a meeting time to discuss project 4 Project.](https://reader037.fdocuments.net/reader037/viewer/2022110213/56649e7a5503460f94b7b591/html5/thumbnails/35.jpg)
Clicker Question: are these programs
equivalent?
A = [‘mike’, ‘mary’, ‘marty’]print A[1]
A = {1:’mary’, 2:’marty’, 0:’mike’}print A[1]
21
A: yes
B: no
![Page 36: Announcements All groups have been assigned Homework: By this evening email everyone in your group and set up a meeting time to discuss project 4 Project.](https://reader037.fdocuments.net/reader037/viewer/2022110213/56649e7a5503460f94b7b591/html5/thumbnails/36.jpg)
Key Differences from ListsLists are ordered
Index is implicit based on the list ordering
Dictionaries are unorderedKeys are specified and do not depend on order
Lists are useful for storing ordered data, dictionaries are useful for storing relational dataMotivating example from book: databases!
![Page 37: Announcements All groups have been assigned Homework: By this evening email everyone in your group and set up a meeting time to discuss project 4 Project.](https://reader037.fdocuments.net/reader037/viewer/2022110213/56649e7a5503460f94b7b591/html5/thumbnails/37.jpg)
Updating a DictionaryMuch like a list we can assign to a dictionary
Abstract:
dictionary[key] = newValue
Concrete Example:
A = {0:’mike’, 1:’mary’, 2:’marty’}print A[1]A[1] = ‘alex’print A[1]
![Page 38: Announcements All groups have been assigned Homework: By this evening email everyone in your group and set up a meeting time to discuss project 4 Project.](https://reader037.fdocuments.net/reader037/viewer/2022110213/56649e7a5503460f94b7b591/html5/thumbnails/38.jpg)
Adding to a DictionaryMuch like a list we can append to a dictionary
Abstract:
dictionary[newKey] = newValue
Concrete Example:
A = {0:’mike’, 1:’mary’, 2:’marty’}print A[1]A[3] = ‘alex’print A {0:’mike’, 1:’mary’, 2:’marty’, 3:’alex’}
![Page 39: Announcements All groups have been assigned Homework: By this evening email everyone in your group and set up a meeting time to discuss project 4 Project.](https://reader037.fdocuments.net/reader037/viewer/2022110213/56649e7a5503460f94b7b591/html5/thumbnails/39.jpg)
Clicker Question: What is the output of this code?
A = {0:’mike’, 1:’mary’, 2:’marty’, ‘marty’:2, ‘mike’:0, ‘mary’:1}A[3] = ‘mary’A[‘mary’] = 5A[2] = A[0] + A[1]
A: {'mike': 0, 'marty': 2, 3: 'mary', 'mary': 5, 2: 'mikemary', 1: 'mary', 0: 'mike'}
B: {'mike': 0, 'marty': 2, 'mary’:3, 'mary': 5, 2: 'mikemary', 1: 'mary', 0: 'mike'}
C: {'mike': 0, 'marty': 2, 'mary’:3, 'mary': 5, 2:1, 1: 'mary', 0: 'mike'}
![Page 40: Announcements All groups have been assigned Homework: By this evening email everyone in your group and set up a meeting time to discuss project 4 Project.](https://reader037.fdocuments.net/reader037/viewer/2022110213/56649e7a5503460f94b7b591/html5/thumbnails/40.jpg)
Printing a Dictionary
A = {0:'mike', 1:'mary', 2:'marty’}for k,v in A.iteritems(): print k, ":", vPrints: 2 : marty 1 : mary 0 : mike
A = {0:'mike', 1:'mary', 2:'marty’}for k in A: print kPrints: 2 1 0
![Page 41: Announcements All groups have been assigned Homework: By this evening email everyone in your group and set up a meeting time to discuss project 4 Project.](https://reader037.fdocuments.net/reader037/viewer/2022110213/56649e7a5503460f94b7b591/html5/thumbnails/41.jpg)
Project 4: Frequency Analysis
IntuitionWe can leverage a dictionary to calculate the
number of times a particular letter occurs in a message
We can use characters as the keys
The number of times that character occurs is the value
Increment the value each time we see a character Initially the value starts at 0
![Page 42: Announcements All groups have been assigned Homework: By this evening email everyone in your group and set up a meeting time to discuss project 4 Project.](https://reader037.fdocuments.net/reader037/viewer/2022110213/56649e7a5503460f94b7b591/html5/thumbnails/42.jpg)
Some Additional Notation:Pairs in Python
We can create pairs in pythonExample: tuple = (‘name’, 3)Such pairs are called tuples (see page 291)
Tuples support the [] for selecting their elements
Tuples are immutable (like strings)
Further reading (section 5.3):http://docs.python.org/tutorial/
datastructures.html#tuples-and-sequences
![Page 43: Announcements All groups have been assigned Homework: By this evening email everyone in your group and set up a meeting time to discuss project 4 Project.](https://reader037.fdocuments.net/reader037/viewer/2022110213/56649e7a5503460f94b7b591/html5/thumbnails/43.jpg)
TuplesWe can think of tuples as an immutable list
They do not support assignment
Example:A = (‘me’, 5, 32, ‘joe’)
print A[0]
print A[3]
A[2] = 4 <--- this throws an error
![Page 44: Announcements All groups have been assigned Homework: By this evening email everyone in your group and set up a meeting time to discuss project 4 Project.](https://reader037.fdocuments.net/reader037/viewer/2022110213/56649e7a5503460f94b7b591/html5/thumbnails/44.jpg)
Creating a dictionary from a list
Python provides the dict function to create a dictionary out of a list of pairsExample: dict([(0, ‘mike’),(1, ‘mary’),(2, ‘marty’)])
Why do I care?We can leverage list creation short cuts to
populate dictionaries!
Example: dict([(x, x**2) for x in range(10)])