Annet Damhuis, Vikki Moye and Sian Ellard Department of Molecular Genetics.

Annet Damhuis, Vikki Moye and Sian EllardDepartment of Molecular Genetics

Clinical features◦ Diabetes◦ Renal developmental abnormalities◦ Female genital tract malformations

Genetics◦ Heterozygous HNF1B mutations◦ Whole gene deletions account for 50% of

mutations

KT: Double uterus Unilateral renal agenesis

RT: Dysplastic kidneys Diabetes at 30 months

KT

RT

3 affected family members over 3 generations

quantitative multiplex PCR amplification of short fluorescent fragments

Duplication of HNF1B exon 5

Normal dosage3 4 5 6

Normal dosage

Inverted tandem duplication (tail to tail)

3 4 5 5 4 6

3 4 5 6

3 4 5 54 6

Normal dosage


Direct tandem duplication (tail to head)

3 4 5 5 4 6

3 4 5 6


3 4 5 5 4 6

max. 13484 bp



3 4 5 5 4 6

max. 13484 bp

3 4 5 54 6

max. 6620 bp



3 4 5 5 4 6

max. 13484 bp

3 4 5 54 6

max. 6620 bp

Control primerset: HNF1B fragment 1000 bp

LongRange PCR buffer 2.5 ul dNTP mix 1.25ul Primer (10pmol/ul) 2.0 ul H2O 9.05 ul Enzyme mix 0.2 ul

15ul PCR mix + 10 ul DNA (40ng/ul)

Primers designed with annealing temp 62°C Elongation time: 1 min/kb

PCR program◦ 3 min 93°C◦ 15 sec 93°C◦ 30 sec 62°C◦ 10 min 68°C◦ ∞ 4°C

1.Proband RT 12.Proband RT 23.Mother KT4.Normal control 15.Normal control 26.Normal control 37.Negative control

3 4 5 5 4 6

1 2 3 4 5 6 7

1. Normal control 1

2. Normal control 2

3. Normal control 3

4. Negative control

1 2 3 4

1.Proband RT (1)2.Proband RT (2)3.Mother KT4.Normal control 15.Normal control 26.Normal control 37.Negative control

3 4 5 5 4 6

1 2 3 4 5 6 7

1. Proband RT2. Mother KT 13. Mother KT 24. Normal control 15. Normal control 26. Normal control 37. Negative control

3 4 5 54 6

1 2 3 4 5 6 7

1. Proband RT2. Mother KT 13. Mother KT 24. Normal control 15. Normal control 26. Normal control 37. Negative control

Fragment size approximately 3500 bp

3 4 5 54 6

1 2 3 4 5 6 7

1. Proband RT 12. Proband RT 2 3. Mother KT 14. Normal control 15. Normal control 26. Normal control 37. Negative control8. empty

3 4 5 54 6

1 2 3 4 5 6 7 8

3 4 5 54 6

5 4

3500bp

GCTGTGGCGGTAGATAGCCTGCTTTCAACCCCAATTCTACCACTTGGGCACACTTCTTAACTTCTCTAAATTTCAGTATCCTTCTCTATGAAATAGGGATAATAATACCAACCTTATAGATTATAGGTATATAAAGAACCTAGCATAGTGAAGAGACCATAAATGACAGCATTAATGTAATTCAGGCTCTCCAAATTATCATGTAAGGATCACCACTGATACCCTTGGCAGTGGGAAGAATGGCTAAATAAGGAAGCCCCATCTGGACCTTCCCCTGGACTGCCTGTCCCCGGCTTGCTCTCTTCTCCTCGAGAGCCACACCAGAGCCTAAGCCCCTGACTCCCAGGGCGGCATAGCCTGCTCTGTCCCTGCGTTCAGGCCCACTTCAGCCATCTTCATCAGATCACTCCATGGATTGGCCTTTTCTCTGCATAGGCCTCTCCTCCCCAGCCTTCCATTCTGCCCACGGCCCCTTCATACTCCCAACCAAGACTGCTGTGATTGTGTGTTTTTGGCCAAGCACCAACAAGTCCCCCCGCCCCCCCTCACTCACCATCTCCCCTCCATCCATTCCCAGGGCAGAATGTTTGCAGCGAGGGGTTCCCCCCCCAAAGCCCCACCCGCCT

5 4

3500bp

626 bp


Intron 5

5 4

3500bp

626 bp


Intron 5 Intron 3

5 4

3500bp

626 bp


Intron 5 Intron 3 Exon 4

5 4

3500bp

626 bp


Intron 5 Intron 3 Exon 4 Primer

5 4

3500bp

626 bp


5 4

3500bp

626 bp

Fragment size approximately 293 bp

1. Proband RT2. Proband RT3. Mother KT4. Mother KT5. Normal control 16. Normal control 27. Normal control 38. Negative control

1 2 3 4 5 6 7 8

CGGGCCTTCCTTACTTTCTCTAAATTTCAGTATCCTTCTCTATGAAATAGGGATAATAATACCAACCTTATAGATTATAGGTATATAAAGAACCTAGCATAGTGAAGAGACCATAAATGACAGCATTAATGTAATTCAGGCTCTCCAAATTATCATGTAAGGATCACCACTGATACCCTTGGCAGTGGGAAGAATGGCTAAATAAGGAAGCCCCATCTGGACCTTCCCCTGGACTGCCTGTCCCCGGCTTGCTCTCTTCTCCTCGAGAGCCACACCAGAGCCTAA

Intron 5 Intron 3 primers

5 4

3500bp

626 bp

293 bp

KT: Double uterus Unilateral renal agenesis

RT: Dysplastic kidneys Diabetes at 30 months

Low level mosaic duplication

RT

Heterozygous duplication


Junction fragment assay (293bp) identified duplication in mother KT

LongRange PCR is a useful tool to determine junctions in duplications found by MLPA◦ Easy to use◦ Not always necessary to redesign primers

Michael Day Kevin Colclough

All staff at the Molecular Genetics Laboratory in Exeter

Annet Damhuis, Vikki Moye and Sian Ellard Department of Molecular Genetics.

Documents

Transcript of Annet Damhuis, Vikki Moye and Sian Ellard Department of Molecular Genetics.