Animal Care Sector Booklet

16
Animal Care Animal Care

description

ABC Awards (ABC) is an Awarding Organisation in the United Kingdom with an established reputation for quality and customer service. ABC is recognised by the regulatory bodies as an awarding organisation whose qualifications meet the criteria

Transcript of Animal Care Sector Booklet

Page 1: Animal Care Sector Booklet

Animal Care

Anim

al C

are

Page 2: Animal Care Sector Booklet

2 Animal Care

About ABC AwardsEstablished in 1998, ABC Awards (ABC) is the result of combining more than 180 years of regional examination and assessment practices into one national Awarding Organisation. As a registered charity we are continuing the tradition of our founding organisations who were established by the sector to deliver useful and practical qualifications whilst off ering exceptional support and ABC is proud to still be “owned” by the sector and working for the sector.

ABC off ers an outstanding range of vocational qualifications which reflect the skills that employers and centres look for in learners and employees. At ABC, we recognise the importance of continuing to off er not only a wide range and breadth of qualifications, but just as significantly, excellent customer support.

An Experienced and Knowledgeable TeamOur friendly and responsive approach to customers means all our centres have access to a dedicated Qualification Administrator as well as unlimited access to a Business Development Manager who can answer any queries or concerns you might have. Our Moderators are all subject specialists and are chosen by us for their experience, knowledge and ability to support centres to deliver ABC’s qualifications successfully.

A Wide Range of QualificationsOur portfolio or more than 600 Ofqual regulated qualifications cover 14 sec-tors with qualifications to suit all ages and abilities. We have designed all ABC qualifications with the support of relevant stakeholders to make sure that they meet the needs of the current industries across the UK. This means that the qualifications are designed to give learners the skills needed to find employ-ment, progress within education or enhance their skills in their current job role. We have more than 1200 centres with many tens of thousands of certificates being issued each year.

Recognised and Valuable QualificationsABC Awards is a national Awarding Organisation providing qualifications regu-lated by Ofqual.

Page 3: Animal Care Sector Booklet

Contents

1.0 Section heading

1.1 Section heading

1.2 Section heading

1.3 Section heading

2.0 Section heading

2.1 Section heading

2.2 Section heading

3.0 Section heading

CCoonntttteennnnttss

111....0000 SSSSSeeeeeccccttttiiiiioooonnnnn hhhhhheeeeeaaddddddddddddddiiiiiiiiiinnnnnnnnnngggg

11111...11111 SSSSSSSSSeeeeeeeeeecccccccccctttttttttttiiiiiiiiiiiioooooooooooonnnnnnnnnnnnnnnn hhhhhhhhhhhhhhheeeeeeeeeeeeeaaaaaaaaaaaaddddddddiiiiiiiiiinnnnnnnnggggg

1111 2222 SSSS tttttttttiiiiiii hhhh dii

1111.....333333 SSSSSeeeccttiiiooonnnnn hhhhheeeaaaadddddddddddddddddddddiiiiiiiiiiiiinnnnnnnnnnnnnnnnnggggggggggggggg

222222....00000 SSSSSeeeeeccctttiiiooooonnnnnn hhhhheeaaaadinnnnnnnnggggggggggggggggggggggggggggg

22222..1111 SSSSSeeccttiiooonnn hheeeeeaadddddiing

22222.....22222 SSSSSeeecccctttttiiiiiooooonnnnn hhhhhheeeeeeeaaaaaadddiinnnnggg

33333....00000 SSSSSSSeeeeecccccttttiiiiooooonnnnn hhhhheeeeeeeaaaaaddiinggg

TTTTTTTThhhhhhhhhhheeeeeeeeeeeeeee aannnniiiimmmmaaaaaaaaaaaaaaaaaalllllllllll ccccaaaaaaaarrrrrrrreeeeeee iinnnnnnddddddduuuuuuuuuussssssssssttttrrrrrryyyyy iiisssss iiiiimmmmmmpppppporrrttttaaannnnnnnnnnntttttttt fffffooooorrr tttthhhhheee lllllaaaaaaaaannnndddddd bbbbbaaaaaaaaaaaaaaaaaaaassssssssssseedd aaaannnnnnnnnnnnnnddddddddd eeeennnnnnvvvvvvvvvvvvviiiiiiiiirrrrrrronnmmmmeeeennttaaaaaaaaaaaaalllllllllllllllll sssssssssssssssssseeeeeecccccccttttttooooooooorrr iiinnnnnn EEEEEEnnnnnnnnnnnnnnggggggggggggggllllaaaaaannnnnddddd,, rrrrreeeeepppppppppppppprrrreeeeeesssssssssssssssssseeeeeeeeeeeeeeeeeeeeeennnnnnnnnnnnnnnnnnnnnttttttttttttttttttttiiiiiiiiiiiiiiiiinnnnnnnnnnnnnnnngggggggggggggggggg 11111111111%%%%%%%%% oooooooooffffffff bbuussiiinnnnneeeeeeeeeeeeeeeessssssssssssssssssssssssssssseeeeeeeeeesssssss aaaaaaaaannnnnnnnnnnnddddddddddd 2222111%%%%%%%%%%%%%% ooooooooooooofff eeeeeeemmmmmmmmppppppllllooooyymmeeeeeeeeeeennnnnnnnnnnnnnnnnttttttttt wwwwwiiittthhhhhhhhhhhhhhhhhhhhhhhhiiiiiiiiiiiiiinnnnnn theeeeeeeee sssssssssssssssssssseeeeeeeeeeeeeeeeeeeeeeccccccccccccccccccccctttttttttttttttttttttooooooooooooooooooooorrrrrrrrrrrrrrrrrrrr.. AAAAABC’s AAAAAAnnnnnnnnnnnnnnnnniiiiimmmmmmmmmmmmmmmmmaaaaaaalllllll CCCCCCCCCCCCaarree qqqqqqqqqqqqqqqqqqquuuuuuuuaaaaaaaallllliiiiiiiiffffffffffiiiiiiicccccccccaaaaaaaaaaaaattttttttttttttiiiiiiiiiooooooooonnnnnnssssssspprrrroooooovvvvvviiiiiiddddddddeeeeeeeeeeeeeee ppppppprrrrrrraaaaaaaaccccticcccaaaall eeennttryyyyyyyyy aaaaaaaaaaannd progressionnn rrrrrooooouuuuuttees ttttttttttthhhhhhhhhhhhhhhhaaaaaaaaaaaaaaaattttttttttttttttt eeeeeeeeeeeeeeeeennnnnnnnnnnnnnncccccccccccccccoooooooooooooouuuuuuuuurrrrrraaaaaaaaagggggggggeeeeeeeee lllllllllleeeeeeeeeeeeeeaaaaaaaaaarrrrrrrnnnnneeeerrrrssss ttttttttoooooo dddddddeeeeeeeevvvvvvveeeeeeeeeeeeeellllllllloooooooooopppppppp ttttttthhhhheeeeeiiiiirrrr skkkkiiiillllllllsssss aandd kknnowledgggee iinnnnn aarrreaas of intttttteeeeerrrrreeeeeeeesssssssssssttttt ttttttooooooo tttttttthhhhhhhhhhhhheeeeeeeeeeeeemmmmmmmmmm....

CCAAAAABBBBBBBBBBBBCCCCCCCCC’’’sssssssssssss qqqqqquuuuuuuuuaaaaaaaalliiiifffffffiiiiiiiccccccccccccccaaaaaaaaatttttttttiiiiiiioooooooonnnnnnnnnnnnsss ccaaaannn llleeeeeaaaaaddd ttttoo eemmpppppllooooyyymmmmmeeeennnnnttttt wwwwiiiittthhin tttttttttttttthhhhhhhhhhhhhheeeeeeeeeeeeeeee aaaaaaaaaaaaaaaannnnnnnnnnnnnniiimmmmmmaaaaaaaaaallllllllll sssssssssssssssssssssseeeeeeeeeeeeeeccccccttttttttoooooooooooorr oooooooooooooooooorrrrrr 1111 0000 SSSSeeeeeccccctttttiiiiooooonnnnn hhhhheeaaaadddddddddddiiiiiiinnnnnnnnnnnnnggggggggggggggggggg1111 0000 SSSSeeeeccccctttt ooooonnn heaaadddddddddiiiiiinnnnnnnngggggggggggffffffuuuuuuurrrrrrtttttthhhhhhheeeeerrrr ssssssstttttttttuuuuuuudddddddddyyyyyyyyyyyy.. TTTTTTTTTTTTTTTTTTThhhhhhhhhhhhhhheeeeeeeeeeeeeeeesssssseeeeee qqqquuuuaaaaallllliiiiffffiiiccccccaaaaaaattttiiioonnss aaarrrrreeeeee dddddeeeeessssiiiiggggggnnnnnnneeeeeeeeeeeedddddddddddddddddd fffffffffffffffffffoooooooooooooooooooooorrrrrrrrrrr yyyyyyyyyyyyyyyyyyyoooooooooooooooooouuuuuuuuuuuuuuuuuuuuunnnnnnnnngggggggggg pppppppppppppppppeeeeeeeeeeoooooooopppppplllllllleeeeeeeeeeeeeeeee aaaaaaaaaaaaaaaggggggggeeeeeeeeedddddddd

111 11111 SSSS iiiiii hhhhhhhhhhh ddiid1111111114444444444+++++++ aaaaaaaannnnnnddddddd aaaaaaaaadddddddduuuuuuuuuulllllllttttttttttttsssssssss wwwwwwwwwwwhhhhhhhhhhhhhhhhhhhoooooooooooooo hhhhhhhhhhhhhhhhhaaaaaaaaaaaaavvvvvvvvvvvvvvvveeeeeeeeeeeeee aaaaaannnnnn iinnnttteeerreeeeeesssssstttt iiiiiinnnnn ttttthhhhhhhhheeeeeeeeee lllllllllllaaaaaaaaaaaannnnnnnnnnnnnddddddd bbbbbbbbbbbaaaaaaaaaaaaaasssssssssssssssseeeeeeeeeedddddddd innnnnnnddddddddddddddduuuuuuuuuusstttttttrrrrrrrryyyyyyy aaaasss aaaaaannnnnnnnnnnnnnnn 1111...11111 SSSeeeeeeeecccccctttttttiiiiiioooooooonnnn hheeeeeeeaaaaaadddddddiiiinnnnnnngggggggggggg.111 eeeeee oonnn ddddd nnnggggggg

aaaaaarrrrrreeeeeeeeeeaaaaaaaaaaaaaa ooofff eeeeeeeeeeemmmmmmmmmppppplloooooooyyyyyymmmmmmmmmmmmmeeeeeennnnnnnnnnnnntttttttt aaaannnnnnnnddd wwwwwaaaaaannnnnnttt ttoo ddeeevvvvvvveeeeeeeeeelloooooppppp pppppprrraaaaaccctttiiiicccccccaaaalll ssssssskkkkiiiiillllllsssss iiiiiinnn tttthhhhiiiisss aaarrreeeaaaa11111.....22222 SSSSSeeeeccccccctttttttttttiiiiiiiiiiiioooooooooonnnnnnnnn hhhhhhhhhhheeeeeeaaaaaaaaaadddddddiiiiiiiinnnnnnnnnnnnnnnggggg1111.....22222 SSSSSeeeecccccctttttttiiiiioooooooonnnnnnn hhhhhhhheeeeaaaaaaaaaddddddiiiiiiinnnnnnnnnnnnnnngggg

OOOOOOOOOOOOOOOOOOOOOuuuuuuuuuuuuuuuuuuurrrrr AAAAAAAAAAAAnnnnnnnnnnniiiimmmmmmmmmmmmmaaaaaaaall CCCCCCCCCCaaaaaaaaaaarrrrreeeeeeeeeeeeeeee sssssssssssssssseeeeeeeeeeeeeeeeeecccccccccccttoorr cccccooooovvvvvveeeeerrss ttthhhhheeeeeee ffffffffooooooolllllllllloooooooowwwwwwiiiiinnnnnggg aaarrrreeaass::1111..33333 SSSSSeeeeccttiioonnnnnn hheee11 SS

PPPPPPPPPPPPPrrrrrrrrrrrraaaaaaaaaaaaaaaacccccccccccctttttttttiiiiiiiiiicccccccccccccccaaaaaaaaaaaallllllllllllll FFFFFFFaaaaaaaaarrrrrrmmmmmm AAAAAAAAAAAAAAAnnnimmaaaaalll CCCCCaaaaarrreeeeeeee SSSSSSSkkkkkiiiillllllllllsssss•••PPPPPPPPPPPPPrrrrrrrrraaaaaaaaaaaaccccccccccccccccttttttttttttiiiiiiiiccccccccccccccaaaaaaaaaaaaaaaaallllllll SSSSmmmmmmaaaallllllll AAAAAAAAAAAAAAnnnniiimmmmaaaaalllll CCCCCaaaaarreeee SSSSSSkkkkiiiillllllllllsssssss22222....1111 SSSSSSee22222 111 SSSSSS•••PPPPPPPPPPPPPrrrrrrrraaaaaaccccccccccttttttttttiiiiiccccccccaaaaaaallllll AAAAAAnnnniiiimmmmmmmaaaaaaalllll CCCCCCaaaaarrrrrrrrreeeeeeee SSSSSSSSSSSkkkkkkkkkkkkkiiiiiiiilllllllllllllllllllsssss•••••••AAAAAAAAAAAAAnnnnnniiiiimmmmmmmmmmmmmmmmmmaaaaaaaaalllllll NNNNNNNNNuuuuuuurrrrrssssiiinnnnngggggg AAAAAAAAAAAAAssssssssssssssssssssiiiiiiiiiiiiissssssssssssssssttttttttttttttttttaaaaaaaaaaaannnnnnnnntttttttttssssssssssssssssss•••••••HHHHHHHHHyyyyyyyyddddddddddddrrrrrooootttttthhhhhhhheeeeeeeerrrrrrrrrraaaaaaapppppyyyyyy ffffoooooooorrrrrrrrrrrrrr SSSSSmmmmmmaaaaaaaaaallllllllllllllllllll AAAAAAAAAAAAAAAAAnnnnnnnnnnnnniiiiiiiiiiimmmmmmmaaaaaallllllssssss••WWWWWWooooooooooooooorrrrrrrrrkkkkkkkkkkkkkk---BBBBBBBBBBBaaaaaasssssseeeeedddddddd AAAAAnnnnniiiiiiimmmmmmmmmmmmmmmmmaaaaaaaaaaaaaaalllll CCCCCCCCCCCCCaaaaaaaaaaaaarrrrrrrrreeeeeeeeeeee••••••

Page 4: Animal Care Sector Booklet

4 Animal Care

Practical Farm Animal Care Skills

The ABC Awards’ qualifications in Prac-tical Farm Animal Care Skills provide practical experience and knowledge of the land based sector to support engagement, participation, achieve-ment and progression. They aim to help learners decide whether to undertake further training or employment within this occupational area.

As well as caring for farm animals our Practical Farm Animal Care Skills qualifications aim to provide a broad insight into all aspects of Farm Animal Care. ABC’s qualifications focus on the principles of caring for animals, delivering basic treatments to animals, through to principles of the preparation and the monitoring of livestock outdoors and assisting with the basic preparation and use of tractors.

Page 5: Animal Care Sector Booklet

OOOOOOOOOuuuuuuuurrrrr qqqqqqquuuuuuuuaaaaaaaaallliiiiiffffffiiiiccccccaaaaaaaaaatttttiiiiiiiiooooooooonnnnnnnnnsssssssss iiiiiinnnnnnnnnnnn PPPPPPPPrrrrrrrraaaaaaaaaaaccccccccccttttttttttiiiiiiiiccccccccccaaaaaaaaaallllllll FFFFFFFFFFaaaaaaaaaarrrrrrrrmmmmmmmmmmmm AAAAAAAAAAAAAnnnnnnnnnnniiiiiimmmmmmmmaaaallll CCCCCCaaaaaaaaaaaarrrrrrrrrrrreeeeeeeeee SSSSSSSkkkkkkkiiiiiilllllllllssssssssssss aaaaaaaaaaiiiiiimmmmmmmmmmm tttttttttttoooooooooo eeeeeeeennnnnaaaaaaaabbbbbbbllllleeeee lllleeeeeeeeeeeaaaaaaaaaarrrrnnnnnnnnnneeeeerrrrrrrrsssssssss tttttttttoooooooooo::::::

gggggggaaaaaaaaaiiiiiiiiinnnnnnnnnn wwwwwwwwwwwwwooooooooooorrrrrrrrkkkkkkkk--------rrrrrrreeeeeeeeeeellllaaaaatttttteeeeedddddddd ssssssssssskkkkkkkkkkiiiiilllllllllllsssssss iiiiiinnnnnn ttttttttttthhhheeeeeeeee aaaarrrreeeeeeaaaaaaaaaaaa oooooooooofffffffffff ffffffffffaaaaaaaaaaarrrrrrrrmmmmmmmmmmmmmm aaaaaaaaaaannnnnnnnnnnniiiiiiiimmmmmmmmmmmaaaaaaaaaaaalllllllll ccccccccccaaaaaaaaaaaaarrrrrreeeeee•••• dddddddddeeeeeeeevvvvvveeeeeellllooooooooooppppppppppp gggggggggggeeeeeeeeeeennnnnnnnneeeeeeeeerrrrrrriiiiiiiccccccccccc eeeeemmmmmmpppppppppllllllllloooooooooyyyyyyyyyyyaaaaaabbbbbbbbiiiiiilllliiiiiittttyyyyyyyyyyyy sssssskkkkkkkkiiiiiillllllllllllssssssss•••••• ppppppppppprrrrrreeeeeeeepppppppppppaaaaaaaaaarrrrrrrreeeee fffffffffffffoooooooooooorrrrrrrr ffffffffffffuuuuuuuuuurrrrrrtttttttthhhhhhhhhheeerrrrrr ttttttrrrrraaaaaiiiiiiiiiiinnnnnnnnnniiiinnnnnnnnnggggggggggg wwwwwwwwwwwwiiiiiiiitttttttttthhhhhhhhhhiiiiinnnnnnnn tttttttttthhhhhhhhhhiiiissssss oooooooooooocccccccccccccccccccccuuuuuuuuuuuupppppppppppppaaaaaaaaaaaaatttttttiiiiiiiioooooooooonnnnnnnnnnnnaaaaaaaaaaallllllllll aaaaaaaaaaarrrrrrrrreeeeeeeeeeeeeaaaaaaaaaaaa•••••• ggggggggaaaaaiiiiiinnnnn aaaaaaaaaannnnnnnnnnn iiiinnnnnnssssssssssiiiiiiggggghhhhhhht iinntttttttttoooooooo ccccccoooooooorrrrrrrreeeeee aaaaaaaaaacccccctttiviiitttiiiiiieeeeeeeeessss wwwwwwwwiiitttthhhhiiiinnnn ttthhhiiiissss oooooocccccccccccccccccccccccuuuuuuupppppppaaaaaaaaaaaaatttttttttiiiiiiooooooonnaaaaaaaaaallllllllllll aaaaaaarrrrrreeeeeeeeeeeeeaaaaaaaaaaaa iiiiiiinnnnnnnnnnnnn••••••••• ooooorrrrrrrrddddddddeeeerr tttooo aaaaaaaaalllloowwwwwwwwwwwww tthheeeemmmmmm too mmmaaake iiiinnnnnnfffffooooooooorrrrrrrrmmmmmmmmmeeeedddd cccccaaaareeeerrrr decisiioooonnnnnsssss

AAAAABBBBBBBBBBBBCCCCC ooooffffffffffffffffff eeeeeeeeeeerrrrsssss ttthhhee ffffooollllllllllllllloooooooowwwinnnngggg range of qualiifffiiiiicccccations designed specifically for llllllleeeearners wishinggggggg tto sttttuuuuddddyyy wwitthin the Practical Farm Animal Care Skillspath-way:

Entryy Leeevvveeeellll 2222 AAwwwaard in PPPPrraacttiiccaall Farm Animmal CCare Skilllss•• EEnnttrryy LLeevveell 33 AAwwaarrdd iinn PPrraaccttiiccaall FFaarrmm AAnniimmaall CCaarree SSSkkkkiiiilllllss•• EEnntryy LLLeevveell 2 CCeerrttiiffiiccaattee iinn PPrraaccttiiccaaalll FFFaaarrmm AAnniimmaall CCaarree SSSkkkiillllss•EEnnttrryyy LLLeeevveell 33333 CCertiiffiiccaattee iinnn PPPrraaaccctttiicccaaaalll FFaarrrmm AAAAnnniimmmaaalll CCCCaaarree SSSkkkiillllsss••LLLeeevvveeell 11 AAAwaarrdd iin Prrraaacctticaalll AAAnniimmmaaalll CCCCCCCCCCaaaaaaaaarrrrrrrrrreeeeeeeeee SSSSkkiillllllss••LLLeevel 11 Certificaattttttee inn PPrrraacctttiicccaalll AAAnnniimmaaall CCCCCaaarrreee SSSkkiiillllllsss••

Page 6: Animal Care Sector Booklet

6 Animal Care

The ABC qualifications in Practical Small Animal Care Skills provide practical experience and knowledge of the animal care sector to support engagement, participation and achievement and progression for learners. The aim is to help learners decide whether to undertake further training or employment within this occupational area.

Practical Small Animal Care Skills

Our Practical Small Animal Care Skills qualifications cover sections on recognising parts and there functions on a small animal, checking the health of animals, grooming small animals, through to communicating with others and handling stock in a retail environment.

Page 7: Animal Care Sector Booklet

The ABC qualifications in Practical Small Animal Care Skills aim to enable learners to:

gain work-related skills in the area of animal care• develop generic employability skills• prepare for further training within this occupational area•

ABC off ers the following range of qualifications designed

specifically for learners wishing to study within the Practical small Animal Care Skills pathways:

Entry Level 2 Award in Practical Small • Animal Care SkillsEntry Level 3 Award in Practical Small • Animal Care SkillsEntry Level 3 Certificate in Practical • Small Animal Care SkillsLevel 1 Award in Practical Small • Animal Care SkillsLevel 1 Certificate in • Practical Small Animal Care Skills

groomingexotic animal anatomy & physiology

zoonosiswild animal population

handling and restraining

feeding regimes

hip dysplasia

canine cruciate

Page 8: Animal Care Sector Booklet

8 Animal Care

Practical Animal Care Skills

This range of qualifications are designed to cover all aspects of Practical Animal Care Skills including controlling and restraining animals, preparing and grooming animals right through to knowing how to maintain the health and welfare of animals and contrib-uting to the evaluation and implementation of basic animal training programmes.The ABC Awards qualifications in Practical Animal Care Skills aim to enable learners to:

• develop practical skills that will support those seeking a career in the animal care industry

• provide knowledge and understanding that could support further study withinthe animal care sector

• promote and encourage good working practices in relation to safety and theenvironment

Page 9: Animal Care Sector Booklet

ABC off er the following range of qualifications designed specifically for learners wishing to study within the Practical Animal Care Skills pathway:

Level 2 Award in Practical Animal Care Skills• Level 3 Award in Practical Animal Care Skills• Level 2 Certificate in Practical Animal Care Skills (Animal Care and Welfare)• Level 2 Certificate in Practical Animal Care Skills (Zoos / Wildlife Establishments)• Level 2 Certificate in Practical Animal Care Skills (Dog Grooming)• Level 2 Certificate in Practical Animal Care Skills (Pet Care and Retail)• Level 2 Certificate in Practical Animal Care Skills (Animal Training)• Level 3 Certificate in Practical Animal Care Skills (Animal Care and Welfare)• Level 3 Certificate in Practical Animal Care Skills (Zoos / Wildlife Establishments)• Level 3 Certificate in Practical Animal Care Skills (Dog Grooming)• Level 3 Certificate in Practical Animal Care Skills (Pet Care and Retail)• Level 3 Certificate in Practical Animal Care Skills (Animal Training)• Level 3 Certificate in Practical Animal Care Skills (Dog / Animal Wardens)• Level 3 Certificate in Practical Animal Care Skills (Animals in Education and • Entertainment)

Page 10: Animal Care Sector Booklet

10 Animal Care

Animal Nursing Assistants

The ABC Animal Nursing Assistants qualification has been developed for learnersseeking a specialised qualification in animal nursing, with the overall aim being toprepare learners for a career in animal care or Veterinary Nursing, based within aVeterinary Practice. The course covers a number of units including Anatomy and Physiol-ogy, Principles of Infection Control and Parasitology and Zoonosis. It provides learners with the information required to play a valuable support role to qualified veterinary staff and to assist owners in the correct management of their companion animals. Further to this,learners have the opportunity to learn basic practice reception skills and retailing of products.

ABC off er the following range of qualifications designed specifically for learners wishing to study within the Animal Nursing Assistants pathway:

Level 2 Award for Animal Nursing Assistants• Level 2 Certificate for Animal Nursing Assistants• Level 2 Diploma for Work-Based Nursing Assistants•

Image: Greyfriars Rehabilitaion and Hydrotherapy Referral Centre/greyfriarsrehab.co.uk

Page 11: Animal Care Sector Booklet

Hydrotherapy for Small Animals

ABC off er the following range of qualifications designed specifically for learners wish-ing to study within Hydrotherapy for Small Animals pathway:

Level 2 Award in Hydrotherapy for Small Animals• Level 3 Award in Hydrotherapy for Small Animals• Level 3 Certificate in Hydrotherapy for Small Animals•

It is important that those who administer these new treatments such as Hydrotherapy are properly trained and understand the theory which supports the treatment. Our Hy-drotherapy for Small Animal qualifications aim to assist the existing workforce involved with animal care to gain the skills and knowledge required through flexible unit based qualifications. The ABC qualifications in Hydrotherapy for Small Animals introduce learners to the practice and benefits of Hydrotherapy for small animals,in particular dogs and cats develop their awareness and skills in this area oftreatment. Our Hydrotherapy for Small Animals qualifications cover aspects including first aid for small animals, anatomy and physiology for hydrotherspy, through to the principles and practice of small animal hydrotherapy.

Image: Greyfriars Rehabilitation and Hydrotherapy Referral Centre/ greyfriarsrehab.co.uk

Page 12: Animal Care Sector Booklet

12 Animal Care

Work-Based Animal Care

Our ABC Diplomas in Work-Based Animal Care aim to enable learners to:• provide knowledge and understanding that will support eff ective and effi cient

working practices that are fully in accordance with Animal Welfarerequirements and the five freedoms

• promote and encourage good working practices in relation to safety, biosecurity, transport, handling and restraint of animals and to customertransactions, stock rotation and retail activities

• encourage a pragmatic and structured approach to achieving the requiredstandard of work in a way that, where possible, is enjoyed by the animal andthe animal care operative

• foster good habits of observation and awareness of the characteristics,behavior, overall state and health of the animal throughout care operation

• develop competent practical skills in handling, grooming, care and training ofanimals to achieve the desired condition, visual appearance, appropriatebehaviour and working or recreational eff ectiveness of the animal

• cultivate team-working practices and eff ective communication skills with theanimal, its owner and colleagues to underpin the consistent achievement ofcustomer satisfaction

The ABC Awards’ Diplomas in Work-Based Animal Care provide practical experience and knowledge for learners wanting to work within an animal based environment. Our Work-Based Animal Care Diplomas pathways include Zoo/Wildlife Establishments, Animal Train-ing, Pet Care & Retail and Dog Grooming

Page 13: Animal Care Sector Booklet

ABC off er the following range of qualifications designed specifically for learners wishing to study within the Work-Based Animal Care pathway:

Level 2 Diploma in Work-Based Animal Care (Animal Care and Welfare)• Level 2 Diploma in Work-Based Animal Care (Zoo / Wildlife Establishments)• Level 2 Diploma in Work-Based Animal Care (Dog Grooming)• Level 2 Diploma in Work-Based Animal Care (Pet Care and Retail)• Level 2 Diploma in Work-Based Animal Care (Animal Training)• Level 3 Diploma in Work-Based Animal Care (Animal Care and Welfare)• Level 3 Diploma in Work-Based Animal Care (Zoo / Wildlife Establishments)• Level 3 Diploma in Work-Based Animal Care (Dog Grooming)• Level 3 Diploma in Work-Based Animal Care (Pet Care & Retail)• Level 3 Diploma in Work-Based Animal Care (Animal Training)• Level 3 Diploma in Work-Based Animal Care (Dog / Animal Wardens)• Level 3 Diploma in Work-Based Animal Care (Animals in Education and Entertain-• ment)

Page 14: Animal Care Sector Booklet

14 Animal Care

What Next? - Progression RoutesFurther study on another ABC Awards’ Land Based qualification• Progess into an apprenticeship within a sector• Gain promotion to a more senior position within existing employment• Improve employment prospects• Higher level study•

Page 15: Animal Care Sector Booklet

ApprenticeshipsAnimal Care Apprenticeships are avail-able to learners who have a vested inter-est in the land based industry and who want to gain the skills needed for a suc-cessful career in this field. Apprentices get to develop land based specific skills and knowledge whilst learning key/core skills. ABC has a number of qualifications in the Animal Care sector that contribute towards apprenticeships.

Animal Care Level 2 Intermediate Appreniceship, England and (Wales) non statutoryCombined QualificationPathway 1 - Animal Care: ABC Level 2 Diploma in Work-Based Animal Care (500/6740/0)

Animal Care Level 3 Advanced Apprenticeship, England and (Wales) non statutoryCombined QualificationPathway 1 - Animal Care: ABC Level 3 Diploma in Work-Based Animal Care (500/6738/2)

Page 16: Animal Care Sector Booklet

How do I get more [email protected]

www.abcawards.co.uk/landbased-and-environmental/animal-care/

FeesABC has no hidden fees or charges so the prices you see on our web site are the prices you actually pay. Our costs are inclusive of enrolment, certification and moderation fees.

FundingABC Awards has endeavoured to provide signposting to funding eligibility but centres are advised that these are guides only and clarification from funding providers should be sought.

ResourcesAdditional guidance and resources to support our qualifications is freely available to approved ABC centres.

Publ

ishe

d 10

Sep

tem

ber 2

012