Analysis of Xbp-mRNA

RT-PCR

Polymerase Chain Reaction (PCR)

Reverse Transcription of Target RNA

• Uses “downstream or “right primer”

• Extends from target right end (3’) to left end (5’)

• Uses DNA nucleotides

• Creates a “First Strand” of cDNA

• First strand is copied from left primer to give double stranded DNA

Annealing of Downstream Primer to RNA

Reverse Transcription With AMV Reverse Transcriptase

RNA Copied From 3’ to 5’ into cDNA

Amplification of cDNA by PCR

Promega Access RT-PCR Cycles

Designing Primers for RT-PCR for Xbp-1 mRNA Analysis

• Criteria– Must bracket target sequence in mRNA– Must be at least 17 NT long– Must have a G+C content of ≈ 50-60%– Should have 5’ “GC clamp”– Should not dimerize– Should not form hairpin structures

• WormBase Sumary for xbp-1 gene

– Brief ID: xbp-1 encodes a bZIP transcription factor orthologous to yeast Hac1 and mammalian X box-binding protein 1 (XBP-1, OMIM:194355); XBP-1 is required for the unfolded protein response (UPR) that counteracts cellular stress induced by accumulation of unfolded proteins in the endoplasmic reticulum (ER); XBP-1 mRNA is spliced by the IRE-1 endoribonuclease to promote translation of transcriptionally active XBP-1 that positively regulates UPR gene expression to maintain ER homeostasis and promote normal development. [details]

– Species: Caenorhabditis elegansCommon name: xbp-1 (CGC approved)

– Gene model(s): Gene ModelStatusRemarkNucleotides (coding/transcript)ProteinSwissProtAmino AcidsR74.3confirmed by cDNA(s)C. elegans XBP-1 protein; contains similarity to Interpro domains IPR004827 (Basic-leucine zipper (bZIP) transcription factor), IPR008917 ()795/1747 bpWP:CE01056Q22027264 aa

Structure of xbp-1 Gene

Analysis of PrimersLeft Primer #1 5’ GCAAAGAGAACGAACGACTGAATCAT

GC%= 39.13 TM = 58.2 Forms 1 low stability dimer

Left Primer #2 5’ GAACCAGAGAACGAGTCCG

GC% =60 TM =60.39 No dimers

Right Primer 5’ TGTTCGAGGGTCTCCATCTTCTT 3’ (Reverse compliment of sense strand)

GC% = 45.45 TM = 58.09 Forms one low stability dimer