Analysis of drug resistance marker genes of Plasmodiumfalciparum after implementation of artemisinin-based

combination therapy in Pune district, India

AARTI OZARKAR1*, ABHISHEK KANYAL

3, SWATI DASS1, PRAKASH DESHPANDE

2,DEEPTI DEOBAGKAR

1 and KRISHANPAL KARMODIYA3*

1Department of Zoology, Centre for Advanced Studies, Savitribai Phule Pune University, Pune, India2National Centre for Cell Science, Pune, India

3Division of Biology, Indian Institute of Science Education and Research (IISER), Pune, India

*Corresponding authors (Emails, ozarkar@gmail.com; krish@iiserpune.ac.in)

MS received 25 April 2021; accepted 4 July 2021

The global emergence and spread of malaria parasites resistant to antimalarial drugs is a major problem inmalaria control and elimination. In this study, samples from Pune district were characterized to determineprevalence of molecular markers of resistance to chloroquine (pfcrt codons C72S, M74I, N75E, K76T andpfmdr-1 N86Y, Y184F), pyrimethamine (pfdhfr C50R, N51I, C59R, S108N), sulfadoxine (pfdhps, S436A,A437G, K540E, A581G), and artemisinin (pfkelch13, C580Y, R539T). The pfcrt K76T mutation was found in78% samples as CVMNT, SVMNT and CVIET haplotype. The pfmdr-1 N86Y and Y184F mutations werefound in 54% of samples. The pfdhfr double mutation C59R ? S108N was present in 67% of samples, whilethe pfdhfr triple mutation (N51I ? C59R ? S108N) was not detected. The pfdhps mutations A437G andK540E were found in 67% of samples. Single mutants of pfdhps were rare, with K540E detected in only 6patient samples. Similarly, pfdhps A581G was found in 13 of the isolates. The molecular markers associatedwith artemisinin resistance (mutations in pfkelch13 C580Y, R539T) were not detected in any of the isolates.These results suggest an emerging problem with multidrug-resistant P. falciparum. Though the genotypeconventionally associated with artemisinin resistance was not observed, chloroquine-resistant genotype hasreached complete fixation in the population. Moreover, the prevalence of mutations in both pfdhfr and pfdhps,with the presence of the quadruple mutant, indicates that continued monitoring is required to assess whethersulfadoxine-pyrimethamine can be used efficiently as a partner drug for artemisinin for the treatment of P.falciparum.

Keywords. Artemisinin; drug resistance; chloroquine; malaria; pyrimethamine; Pune; India; sulfadoxine

Abbreviations: ACT, Artemisinin-based combination therapy; BLAST, Basic Local Alignment Search Tool;DNA, Deoxyribonucleic acid; MSP, Merozoite surface protein; PCR, Polymerase chain reaction; pfcrt,Plasmodium falciparum Chloroquine resistance transporter; pfdhfr, Plasmodium falciparum Dihydrofolatereductase; pfdhps, Plasmodium falciparum Dihydropteroate synthase; pfmdr-1, Plasmodium falciparumMultidrug resistance protein 1; RSA, Ring-stage survival assay; SNP, Single nucleotide polymorphism; SP,Sulfadoxine-pyrimethamine; WHO, World Health Organisation.

1. Introduction

Malaria remains a major problem in many developingcountries, with Plasmodium falciparum causing mostof the mortality (WHO 2019). The biggest challenge tomalaria control is the widespread emergence of resis-tance against most of the conventional drugs like

chloroquine, sulfadoxine-pyrimethamine (SP), meflo-quine and atovaquone (Haldar et al. 2018; Escalanteet al. 2009). Alarming reports of resistance againstartemisinin, a frontline drug against malaria, haverecently been reported from Greater Mekong Subre-gion (GMS), which is the epicentre for emergence ofanti-malarial drug resistance (Zuber and Takala-

http://www.ias.ac.in/jbiosci

J Biosci (2021) 46:77 � Indian Academy of SciencesDOI: 10.1007/s12038-021-00200-3 (0123456789().,-volV)(0123456789().,-volV)

Harrison 2018). Although these occurrences are spo-radic and limited to specific geographical regions, theypresent similar trends of evolution as the resistanceagainst previous drugs like chloroquine and sulfadox-ine-pyrimethamine. Therefore, a rigorous molecularsurvey must be implemented to monitor the spread anddiversification of drug-resistant strains across the world(Nsanzabana et al. 2018).In India, significant decrease in malaria-related

deaths have been observed in recent years but it stillranks fourth in malaria incidences worldwide(NVBDPG 2012). Pune is located in Maharashtra,India and it is in the industrial belt near the south-western coastal region of India. The annual parasiteincidence (API) is\ 2 and the average annual bloodexamination rate is 14% in Maharashtra (NVBDPG2012). In Indian clinical cases, drug resistance has beenreported against majority of the conventional drugs bymonitoring the mutations in the candidate genes;Plasmodium falciparum chloroquine resistance trans-porter (pfcrt), Plasmodium falciparum multidrugresistance protein 1 (pfmdr-1) for chloroquine; pfmdr-1for amodiaquine, mefloquine, and dihydropteroatesynthase (pfdhps) and dihydrofolate reductase (pfdhfr)for pyrimethamine and sulfadoxine resistance, respec-tively (Vathsala et al. 2004; Sarmah et al. 2017;Sharma et al. 2015). Widespread emergence of resis-tance against the conventional drugs led to recom-mendation of artemisinin based combination therapy(ACT) for malaria treatment in the subsequent decades.Alarmingly, a recent report suggests declining effec-tiveness of ACT (artesunate plus sulfadoxine-pyr-imethamine) in the northeast of India, which has been ahistorical gateway of introduction of drug resistance inIndia (Das et al. 2018). Another study reports as muchas 14% failure of artemisinin-based combination ther-apy in eastern India with isolates displaying *10%survival in the standard ring-stage survival assay(RSA) used universally to monitor efficacy of artemi-sinin resistance in vitro (Das et al. 2019). The novelG625R mutation and the previously known R539Tmutation in pfkelch13 gene are found to be associatedwith this artemisinin resistance phenotype (Das et al.2019). An in-depth knowledge of these pre-existingmarkers can be valuable to trace the dynamics of par-asite genotype and associated drug sensitivities.Although the genotypes of the parasites, from differentendemic parts of the country have been reported(Mixson-Hayden et al. 2010; Lumb et al. 2012; Ahmedet al. 2004; Biswas et al. 2000) the present study is firstof its kind from Pune, Maharashtra, India. This studyprofiles the pfcrt, pfmdr-1, pfdhfr, pfdhps and pfkelch13

genes, which are crucial biomarkers of the resistanceagainst the antimalarial drugs.

2. Methods

2.1 Study site, sample collection and ethics

In this study, polymorphisms in the key antimalarialdrug resistance marker genes were investigated in P.falciparum samples from government and privatehospitals in Pune district, Maharashtra, India. The P.falciparum sample size (63 patient samples) repre-sent 95 % confidence level and 12% confidenceinterval for a very large population size (calculatedusing the online tool; https://www.surveysystem.com/sscalc.htm). Symptomatic patients of all age groupswere enrolled, and venous blood was drawn fromeach patient. Written consent was obtained frompatients. The study was approved by the institutionalreview board of University of Pune, India and themolecular analyses were approved by the UniversityEthical board (reference number 2011/832-32/2).

2.2 Microscopy and rapid diagnosticidentification

Thick and thin blood films of patients with suspectedmalaria were stained with 10% Giemsa solution andexamined at 1,0009 magnification according to WHOguidelines. Plasmodium species (P. vivax and P. falci-parum) were confirmed by Rapid Diagnostic Test kit(Falcivax, Tulip Diagnostics).

2.3 DNA extraction and speciation

DNA was extracted from the parasite isolates fromblood samples using the phenol chloroform extractionmethod. PCR based genotyping was done for thepfmsp1 gene for the isolates to rule out mixed infection.The pfmsp1 of all Plasmodium falciparum parasiteswas amplified using sequence-specific primersaccording to a protocol previously described (MohdAbd Razak et al. 2016). The specific allelic families ofpfmsp1 (MAD20, K1 and R033) were amplified usingthe primers and PCR conditions as described in table 1.Reactions for each set of primary and nested primerswere performed separately. PCR products wereresolved by 1.5–2% agarose gel electrophoresis andvisualized using the Alpha Doc Imager system.

77 Page 2 of 10 Aarti Ozarkar et al.

2.4 Amplification of drug resistance associatedgenes

PCR amplification conditions for drug resistanceassociated genes and primer sequences are pro-vided in table 1. PCRs were performed using the

Phusion High-Fidelity DNA Polymerase. Theaccession IDs for the genes relevant to this studyare as follows: pfcrt (PF3D7_0709000), pfmdr-1(PF3D7_0523000), pfmsp1 (PF3D7_0930300),pfkelch13 (PF3D7_1343700), pfdhfr(PF3D7_0417200), and pfdhps (PF3D7_0810800).

Table 1. List of primers used for PCR amplification

GenesPrimer sequence (50–30)Forward and Reverse Product size (bp) PCR conditions

pfmsp1 CTAGAAGCTTTAGAAGATGCAGTATTG Variable 95�C 5 min 1xCTTAAATAGTATTCTAATTCAAGTGGATCA 95�C 1 min

61�C 45 s 28x72�C 1.5 min72�C 5 min 1x

pfmsp1 -MAD20 AAATGAAGGAACAAGTGGAACAGCTGTTAC Variable 95�C 5 min 1xATCTGAAGGATTTGTACGTCTTGAATTACC 95�C 1 min

61�C 45 s 30x72�C 1.5 min72�C 5 min 1x

pfmsp1 - K1 AAATGAAGAAGAAATTACTACAAAAGGTGC Variable 95�C 5 min 1xGCTTGCATCAGCTGGAGGGCTTGCACCAGA 95�C 1 min

61�C 45 s 30x72�C 1.5 min72�C 5 min 1x

pfmsp1 - R033 TAAAGGATGGAGCAAATACTCAAGTTGTTG Variable 95�C 5 min 1xCATCTGAAGGATTTGCAGCACCTGGAGATC 95�C 1 min

63�C 45 s 30x72�C 1.5 min72�C 5 min 1x

pfcrt GGCTCACGTTTAGGTGGA 264 98�C 30 s 1xTGAATTTCCCTTTTTATTTCCAAA 98�C 10 sec

52�C 30 s 30x72�C 1 min72�C 5 min 1x

pfmdr-1 ATGGGTAAAGAGCAGAAAGA 590 98�C 30 s 1xAACGCAAGTAATACATAAAGTCA 98�C 10 sec

59�C 30 s 30x72�C 1 min72�C 5 min 1x

pfdhfr ATGATGGAACAAGTCTGCGAC 699 95�C 3 min 1xACATTTTATTATTCGTTTTCT 95�C 30 sec

52�C 30 s 30x72�C 1 min72�C 5 min 1x

Pfdhps GGGGTATTAAATGTTAATTATGATTCT 946 95�C 3 min 1xGGGGACCTGAAAAGAAATACATAA 95�C 30 sec

52�C 30 s 30x72�C 1 min72�C 5 min 1x

pfkelch13 GCCTTGTTGAAAGAAGCAGA 850 95�C 3 min 1xGCCAAGCTGCCATTCATTTG 95�C 30 sec

60�C 30 s 30x72�C 1.5 min72�C 5 min 1x

Drug resistance marker genes of P. falciparum Page 3 of 10 77

2.5 Sequence analysis

The PCR amplified gene products were extracted usingPCR Purification kit (Roche) and the extracted DNAwas quantified by NanoDrop 1000 (Thermo Scientific,USA). Sequencing of genes from each isolate wasperformed on an ABI Prism 377 DNA Sequencerequipped with semi adaptive version 3.0. Nucleotidesequences were analyzed using BLAST and Bio Edit

Sequence Alignment Editor and compared with refer-ence sequences.

2.6 Structural modelling and SNP mapping

The crystal structures of the relevant proteins wereobtained from the Protein Data Bank (RSCB PDB).The PDB codes for the protein chains are as follows,

Figure 1. Genotype distributions for pfcrt, pfmdr-1, pfdhps, and pfdhfr. (A) The distributions of the drug resistance-associated genotypes were represented as percentages. The number of samples (n) associated with each haplotype was alsopresented. (B) Drug-resistant status of each sample was presented based on genotyping. The blue box indicates severe/cerebral malaria samples.

77 Page 4 of 10 Aarti Ozarkar et al.

PfCRT (6UKJ_A), PfDHPS (6JWS_A) and PfDHFR(3QGT_A). The crystal structure for PfMDR1 was notavailable. The structures were generated from theprotein sequence using Phyre2 intensive homologymodelling engine (Kelley et al. 2015). The structuralchanges caused by the substitutions were predicted byMissense3D webserver (Ittisoponpisan et al. 2019).PyMol was used for visualization purpose and imagegeneration. The substitutions in the crystal structurewere implemented using the mutagenesis wizard ofPymol and the most stable rotamers were used(Schrodinger 2010)

3. Results

A total of 189 microscopy and rapid diagnostic tests -positive samples were collected from government andprivate hospitals from Pune district, Maharashtra,India. Of these isolates, 68 samples were identified aspositive for single P. falciparum infection and theremaining isolates were positive for P. vivax infection.Unfortunately, five P. falciparum samples did not showPCR amplification may be due to degradation of DNAwhile processing. A majority of the samples (93%)were from patients with uncomplicated malaria caseswhereas 3% and 4% samples were isolated frompatients with cerebral and severe malaria, respectively.The patients diagnosed with complicated malariashowed individual or a combination of the followingsymptoms: severe anemia, respiratory distress andmultiple organ (renal or hepatic) dysfunction/ failure.

3.1 The pfcrt and pfmdr-1 genes

Polymorphisms in the transporter genes pfcrt andpfmdr-1 contribute to multidrug resistance in P. falci-parum including reduced sensitivity to chloroquine andmefloquine. The pfcrt gene was PCR amplified andSanger sequenced from 63 isolates positive for P. fal-ciparum. A 264 base pair amplicon was observed asthe product of this PCR, which was sequenced forgenotyping application. Out of the isolates genotyped,78% displayed mutations in four loci across the pfcrtamplicon when compared with the reference chloro-quine sensitive strain of P. falciparum (figure 1A, topleft). The SNPs accounting for these mutant genotypeswere observed at the 72th, 74th, and 75th codonpositions of the pfcrt gene. The remaining 22% isolatesshowed a genotype that was reminiscent of thechloroquine sensitive CVMNK haplotype. The relative

prevalence of the mutant genotypes were found to be asfollows: CVMNT (15.9%), SVMNT (50.7%) andCVIET (11.1%). The prevalence of the K76T mutation(at the 76th codon position) was at a dominant 77.8%.Highly resistant isolates (with the CVIET triple-mutantgenotype) were found in 11.1% samples (figure 1A, topleft). A 600bp amplicon of pfmdr-1 gene was PCRamplified from 63 isolates and was Sanger sequenced.Among these, the N86Y and Y184F mutations(prominently associated with chloroquine resistancephenotype) were observed in thirty-four isolates (54%of the tested samples) (figure 1A, top right). Thesesamples were found to be double mutants for both theloci of interest. Twenty-nine isolates (46% of overall)were wild-type for the pfmdr-1 genotype tested.

3.2 The pfdhps and pfdhfr genes

Polymorphisms in the folate biosynthesis pathwaygenes pfdhps and pfdhfr contribute to sulfadoxineand pyrimethamine drug resistance respectively in P.falciparum. PCR amplification with the selected pri-mer sets yielded 700bp pfdhps and 950bp pfdhfrgene amplicons, which were then outsourced forSanger sequencing. Three loci were screened for theSNPs in the pfdhfr gene amplicon. Among them, one(at the 51st position) did not show mutation in anyof the isolates tested. Two other sites (at the 59thand 108th position) were polymorphic with theindividual C59R and S108N SNPs at a prevalence of41.2% and 25.3%, respectively (figure 1A, bottomleft). Polymorphisms were detected in the pfdhpsgene amplicon at the 437, 540, and 581 positions inoverall 54% of the samples. Isolates harboring thedouble mutation A437G and K540E were observedwhile no mutation was detected for the 436th posi-tion. Among the mutant genotypes identified acrossthe pfdhps amplicon the SGKAA (23.8%), SAKGA(11.1%), SGKGA (9.5%) and SGEAA (9.5%) wereobserved with their respective abundance percentage(figure 1A, bottom right).

3.3 The pfkelch13 gene

For the artemisinin resistance, mutations in pfkelch13(codon C580Y, R539T) were screened. On amplifica-tion with pfkelch13, 850 bp PCR product wassequenced. None of the samples showed mutations(C580Y and R539T) in the pfkelch13 gene.

Drug resistance marker genes of P. falciparum Page 5 of 10 77

77 Page 6 of 10 Aarti Ozarkar et al.

3.4 Modelling of the single nucleotidepolymorphisms on the resistance marker proteincrystal structures

We modelled the mutations onto the crystal structuresof PfCRT and PfDHPS generated using the Phyre2intensive homology modelling engine. The K76Tsubstitution in the PfCRT leads to the contraction of thecavity by 1469.232 A3 due to the size differencebetween lysine and threonine. The N75E substitutionon the other hand disrupts a native hydrogen bondformed between N75 and D329 between the twohelixes (figure 2A). The A437G substitution inPfDHPS crystal structure replaces a glycine in a bendregion which might affect the curvature of stretch. BothA437G and K540E substitutions are close to the activesite and the A437G single mutant is shown to increasethe catalytic activity of the enzyme by 6-fold whilereducing the binding efficacy of sulpha drugs (Chit-numsub et al. 2020) (figure 2B). The side chain ofAsparagine in S108N mutant has steric clash withpyrimethamine and NADPH (figure 2C). This stericconflict is likely the cause of pyrimethamine resistance(Vanichtanankul et al. 2011).

4. Discussion

The Indian strains of Plasmodium falciparum havereported resistance to many of the recently introduceddrugs in the field (Das et al. 2017). There is predom-inance of chloroquine resistance in India which has ledto introduction of artemisinin-based combination ther-apies as the first-line antimalarial policy (Anvikar et al.2012). Unfortunately, many of the artemisinin partnerdrugs like sulfadoxine-pyrimethamine and mefloquinehave reported decline in efficacy in some parts of thecountry (Wedam et al. 2018). There is substantial lackof genotypic data on the drug resistant P. falciparum

strains that pervade India (Kumar et al. 2019). This isfurther complicated by the possibility that there mightbe multiple regional strains of P. falciparum in thecountry which may differ subtly and contribute todifferential drug sensitivities observed across thecountry. India is geographically and ethnically diverse,which offers significant pressure on the parasites toadapt and evolve uniquely. Therefore, a comprehensiveassessment of the genetic make-up of Indian P. falci-parum strains is very important for understanding oftheir biology.Genotyping of P. falciparum strains have been

performed at several hotspots of drug resistanceacross the country including North-Eastern states,Chhattisgarh, Karnataka and Orissa for pfcrt, pfmdr-1,pfdhps and pfdhfr (Patgiri et al. 2019; Rao et al.2016; Patel et al. 2017; Sharma et al. 2015). Ourstudy is the first investigation into the genetic makeupof P. falciparum in the malaria endemic region ofPune district, Maharashtra, India. Our study indicateshigh prevalence of the pfcrt mutations associated withchloroquine resistance (78% isolates with K76Tmutation). The relative proportion of the single doubleand triple mutants in our study may be indicative of agradual progression of mutational genotype in thepfcrt gene towards a highly chloroquine resistant tri-ple mutant. Comparatively, data from studies carriedout in the north-eastern reaches of the country (stateof Tripura) in 2015, indicates a very strong mutationalbackground in the pfcrt gene with 87% of the isolateswere triple mutant with the CVIET haplotype (Patgiriet al. 2019). This represents a significantly higherprevalence of the highly resistant triple mutantgenotype at pfcrt. This is expected since north-easternstates of India report rampant chloroquine resistance.Observations made in eastern India (Rourkela, Orissa)show 7 out of 16 Isolates (43%) collected in2014–2015 to be triple mutants (CVIET) for the pfcrtgene while the rest were sensitive (CVMNK) (Raoet al. 2016). Studies from the central Indian state ofChhattisgarh during the timeline of 2013–2015 foundthe pfcrt gene to be mutant in 78% of the 143 isolates(Patel et al. 2017). The K76T mutation was com-pletely fixed in all the mutants. Around 24% isolateswere reported to be triple mutants with the CVIEThaplotype, 53% double mutant SVMNT and 1% iso-lates were single mutant CVMNT. The pfcrt genotypefor isolates in this region was similar to isolates fromPune district in our study. Overall, there is highabundance of the mutated pfcrt genotype across thedifferent regions of the country which explains highlevels of chloroquine resistance.

bFigure 2. Amino acid substitutions due to mutationsmapped on the structure of the proteins. Wild type aminoacids are coloured cyan, and the substitutions are colouredred. (A1 and A2) PfCRT CVMNK stretch and C72S, K76Tsubstitutions. (B1) PfDHPS structure highlighting the sub-stitutions (red), ligands (grey), and bivalent cations(green).(B2) A437G, K540E and Pteroic Acid (Ligand binding theactive site). (C1) PfDHFR highlighting the substitutions(red) and ligands. (C2) C56R, S108N and Pyrimethamine(antifolate). (D1–D3) Predicted crystal structure of PfMDR1highlighting substitutions, N86Y and Y184F respectively.

Drug resistance marker genes of P. falciparum Page 7 of 10 77

Profiling for the pfmdr-1 marker in the Pune district iso-lates in our study, we found 54% isolates to be doublemutantswith theN86YandY184Fmutationswhichareveryhigh among datasets compared from other regions of India.Comparatively, only 12.5% isolates analyzed in Tripura(2015)were found to bemutated at thepfmdr-1 locus (singleN86Y mutant) (Patgiri et al. 2019). Studies from Orissareport 18.75%isolates tobeN86Ymutants and25%isolatesas Y184F mutants (Rao et al. 2016). Assessment of thepfmdr-1 locus in 162 samples collected from Chhattisgarhrevealed presence of the N86Y single mutation in 59% ofisolates and the rest were wild type (Patel et al. 2017).Assessment of pfmdr-1 locus from isolates in Mangaluru(south India) revealed 98.2% isolates were singlemutant forY184F and the rest were double mutant with D1246F andY184F (Wedam et al. 2018). This collective assessmentbears testament to the diversity of prevalence of pfmdr-1mutations across different regions of India.For the pfdhfr marker in Pune district isolates, 67%

abundance was reported for the C59R and S108N

double mutants. Comparatively, only 5/16 (31%) iso-lates from Orissa were reported to be double mutantswith C59R and S108N genotype (Sharma et al. 2015).Isolates from Chhattisgarh reported a 76% prevalence ofthe double mutation (C59R and S108N), while only 2%isolates each were single mutants for either loci (Wedamet al. 2018). Mangaluru in southern India reported 66%isolates to be double mutants while the rest were wildtype (Wedam et al. 2018). Studies from Uttar Pradesh innorthern India showed a complete fixation of the S108Nmutation, with 23/31 (74%) isolates tested reporting thedouble mutant (C59R and S108N) genotype (Sharmaet al. 2015). This hints at an alarming trend of the rise indouble mutant pfdhfr genotype across the country, whichcould pose a challenge to ACT regime and choice ofpartner drugs (pyrimethamine) in India.The pfdhps locus was also compared for abundance

of mutations across samples from different regions ofthe country in various other studies. The mutantsidentified for the pfdhps locus in Pune district were as

Table 2. List of single nucleotide polymorphisms detected for various drug resistance marker genes in Pune (India) vs SouthEast Asia and Africa

Region/gene Pune, India SE Asia Africa

Pfcrt C72S C72S C72SM74I M74I M74IN75E N75E N75EK76T K76T K76T

A220S

Pfmdr1 N86Y N86Y N86YY184F Y184F Y184F

F1226YA784L

Pfdhfr C59R C50R C50RS108N N51I N51I

C59R C59RS108N S108NI164L

Pfdhps A437G S436A S436AK540E A437G A437GA581G K540E K540E

A581G A581G

PfKelch13 None K189T M476INone F446I P553L

A481V R561HR539T P574LC580Y C580YR561H A675VN672SA675VA676DH719N

77 Page 8 of 10 Aarti Ozarkar et al.

follows: single mutant SGKAA at 23.8%, SAKGA at11%, SGEAA at 9.5%, and double mutant SGKGA at9.5% prevalence. Comparison with previous datasetsfrom studies conducted in Orissa reveal a 100% WTSAKAA haplotype in the region (Rao et al. 2016).Samples assessed in central India (Chhattisgarh)revealed a low prevalence of the double mutant S436A,K540E and single mutant A437G at 3% each (Patelet al. 2017). In Mangaluru (south India), comparativelyhigher presence of pfdhps mutants was found, 45%isolates reported A437G single mutation, and 25%isolates were double mutants with A437G and A540Egenotype (Wedam et al. 2018). Assessment of isolatesfrom Andhra Pradesh and Uttar Pradesh howeverrevealed a completely wild type haplotype among theisolates tested (Sharma et al. 2015). Many of themutations recorded in the marker genes from isolates inour study match up with those detected in isolates fromSoutheast Asia and Africa (table 2). Concordance withpfcrt, pfmdr-1, pfdhfr and pfdhps is notable in the tallybut pfkelch13 gene stands out for lack of any mutationsin Pune, India. This highlights that while multidrugresistance genotype does exist in the region, the markerfor artemisinin resistance is yet to establish.

5. Conclusions

Though, this study is first of its kind from Pune dis-trict, Maharashtra, it has a few important limitations.First, the sample size (63 patient samples, 95% confi-dence level and 12% confidence interval) to effectivelyrepresent the large population prevalent in this region.The limitation is compounded with a combination ofbiomarkers, where the number of samples per pheno-type dropped further. However, our study shows thatmost of the parasites exhibit markers of multi-drugresistance and among these 10% of isolates wereassociated with progression to cerebral/severe malaria(figure 1B). Thus, this provides important clues forassociating the observed genotype with the recordedphenotype. Our study should act as a catalyst toanalyse a large population from this area using modernDNA sequencing methods such as next-generationsequencing to draw conclusions on drug-resistancestatus of the malarial parasites.

Acknowledgements

This work is supported by the DST WOS A Grant(SR/WOS-A/LS-146/2011) to AO. KK is supported

by the Genome Engineering Technologies program(BT/PR25858/GET/119/169/2017) of the Departmentof Biotechnology (DBT) from the Government ofIndia. The funders had no role in study design, datacollection, and analysis, decision to publish, orpreparation of the manuscript. We would like tothank Dr Tushar Patil, Dr Ashwin Khandare and MrMangesh Deval for helping AO with sample collec-tion. We thank Sarthak Joshi for the structuralmodelling and SNP mapping.

Ethics approval and consent to participate The ethicsCommittee and the Institutional Review Board of PuneUniversity, Pune, Maharashtra, India, has approved this study.Informed written consent was obtained from all the studyparticipants.

References

Ahmed A, Bararia D, Vinayak S, Yameen M, Biswas S, DevV, Kumar A, Ansari MA and Sharma YD 2004Plasmodium falciparum isolates in India exhibit aprogressive increase in mutations associated with sulfa-doxine-pyrimethamine resistance. Antimicrob AgentsChemother. 48 879–889

Anvikar AR, Sharma B, Shahi BH, Tyagi PK, Bose TK,Sharma SK, Srivastava P, Srivastava B, Kiechel JR,Dash AP and Valecha N 2012 Artesunate-amodi-aquine fixed dose combination for the treatment ofPlasmodium falciparum malaria in India. Malar J. 1197

Biswas S, Escalante A, Chaiyaroj S, Angkasekwinai P andLal AA 2000 Prevalence of point mutations in thedihydrofolate reductase and dihydropteroate synthetasegenes of Plasmodium falciparum isolates from India andThailand: a molecular epidemiologic study. Trop Med IntHealth 5 737–743

Chitnumsub P, Jaruwat A, Talawanich Y, Noytanom K,Liwnaree B, Poen S and Yuthavong Y 2020 The structureof Plasmodium falciparum hydroxymethyldihydropterinpyrophosphokinase-dihydropteroate synthase reveals thebasis of sulfa resistance. FEBS J. 287 3273–3297

Das S, Manna S, Saha B, Hati AK and Roy S 2019 Novelpfkelch13 Gene polymorphism associates with Artemisi-nin Resistance in eastern India. Clin. Infect. Dis. 691144–1152

Das S, Saha B, Hati AK and Roy S 2018 Evidence ofArtemisinin-resistant Plasmodium falciparum malaria ineastern India. N Engl. J. Med. 379 1962–1964

Das S, Tripathy S, Chattopadhayay S, Das B, Mahapatra SK,Hati AK and Roy S 2017 Progressive increase in pointmutations associates chloroquine resistance: even afterwithdrawal of chloroquine use in India. Int. J. Parasitol.Drugs Drug Resis. 7 251–261

Drug resistance marker genes of P. falciparum Page 9 of 10 77

Escalante AA, Smith DL and Kim Y 2009 The dynamics ofmutations associated with anti-malarial drug resistance inPlasmodium falciparum. Trends Parasitol. 25 557–563

Haldar K, Bhattacharjee S and Safeukui I 2018 Drugresistance in Plasmodium. Nat. Rev. Microbiol. 16156–170

Ittisoponpisan S, Islam SA, Khanna T, Alhuzimi E, David Aand Sternberg MJ 2019 Can predicted protein 3Dstructures provide reliable insights into whether missensevariants are disease associated? J. Mol. Biol. 4312197–2212

Kelley LA, Mezulis S, Yates CM, Wass MN and SternbergMJ 2015 The Phyre2 web portal for protein modeling,prediction and analysis. Nat. Protocols 10 845–858

Kumar A, Singh SP, Bhatt R and Singh V 2019 Geneticprofiling of the Plasmodium falciparum parasite popula-tion in uncomplicated malaria from India.Malar J. 18 385

Lumb V, Madan R, Das MK, Rawat V, Dev V, Khan W,Khan H and Sharma YD 2012 Differential genetichitchhiking around mutant PfCRT alleles in the IndianPlasmodium falciparum population. J. Antimicrob. Che-mother. 67 600–608

Mixson-Hayden T, Jain V, McCollum AM, Poe A, NagpalAC, Dash AP, Stiles JK, Udhayakumar V and Singh N2010 Evidence of selective sweeps in genes conferringresistance to chloroquine and pyrimethamine in Plasmod-ium falciparum isolates in India. Antimicrob. AgentsChemother. 54 997–1006

Mohd Abd Razak MR, Sastu UR, Norahmad NA, Abdul-Karim A, Muhammad A, Muniandy PK, Jelip J, Rundi C,Imwong M, Mudin RN and Abdullah NR 2016 GeneticDiversity of Plasmodium falciparum populations inmalaria declining areas of Sabah, East Malaysia. PLoSONE. 11 e0152415

Nsanzabana C, Djalle D, Guerin PJ, Menard D and GonzalezIJ 2018 Tools for surveillance of anti-malarial drugresistance: an assessment of the current landscape. MalarJ. 17 75

Patel P, Bharti PK, Bansal D, Ali NA, Raman RK,Mohapatra PK, Sehgal R, Mahanta J, Sultan AA andSingh N 2017 Prevalence of mutations linked to anti-malarial resistance in Plasmodium falciparum fromChhattisgarh, Central India: A malaria elimination pointof view. Sci. Reports. 7 1–8

Patgiri SJ, Sarma K, Sarmah N, Bhattacharyya N, SarmaDK, Nirmolia T, Bhattacharyya DR, Mohapatra PK,Bansal D, Bharti PK and Sehgal R 2019 Characterization

of drug resistance and genetic diversity of Plasmodiumfalciparum parasites from Tripura, Northeast India. Sci.Rep. 9 13704

Rao PN, Uplekar S, Kayal S, Mallick PK, BandyopadhyayN, Kale S, Singh OP, Mohanty A, Mohanty S, WassmerSC and Carlton JM 2016 A method for amplicon deepsequencing of drug resistance genes in Plasmodiumfalciparum clinical isolates from India. J. Clin. Microbiol.54 1500–1511

Sarmah NP, Sarma K, Bhattacharyya DR, Sultan AA, BansalD, Singh N, Bharti PK, Sehgal R, Mohapatra PK, ParidaP and Mahanta J 2017 Antifolate drug resistance: Novelmutations and haplotype distribution in dhps and dhfrfrom Northeast India. J Biosci. 42 531–535

Sharma D, Lather M, Mallick PK, Adak T, Dang AS,Valecha N and Singh OP 2015 Polymorphism in drugresistance genes dihydrofolate reductase and dihy-dropteroate synthase in Plasmodium falciparum in somestates of India. Parasites & Vectors 8 471

Strategic Plan for Malaria Control in India 2012-2017,Directorate of National Vector Borne Disease ControlProgramme, Government of India.

Schrodinger LLC 2010. The PyMOL molecular graphicssystem. Version, 1(5), p.0.

Vathsala PG, Pramanik A, Dhanasekaran S, Usha Devi C,Pillai CR, Subbarao SK, Ghosh SK, Tiwari SN, Sathya-narayan TS, Deshpande PR, Mishra GC, Ranjit MR, DashAP, Rangarajan PN and Padmanaban G 2004 Widespreadoccurrence of the Plasmodium falciparum chloroquineresistance transporter (Pfcrt) gene haplotype SVMNT inP. falciparum malaria in India. Am. J. Trop. Med. Hyg. 70256–259

Vanichtanankul J, Taweechai S, Yuvaniyama J, Vilaivan T,Chitnumsub P, Kamchonwongpaisan S and Yuthavong Y2011Trypanosomal dihydrofolate reductase reveals naturalantifolate resistance. ACS Chem. Biol. 6 905–911

Wedam J, Tacoli C, Gai PP, Siegert K, Kulkarni SS, RasalkarR, Boloor A, Jain A, Mahabala C, Baliga S and Shenoy D2018 Molecular evidence for Plasmodium falciparumresistance to sulfadoxine-pyrimethamine but absence ofK13 mutations in Mangaluru, southwestern India. Am.J. Trop. Med. Hygiene 99 1508–1510

World Health Organization (2019) World Malaria Report2019

Zuber JA and Takala-Harrison S 2018 Multidrug-resistantmalaria and the impact of mass drug administration. InfectDrug Resist. 11 299–306

Corresponding editor: BJ RAO

77 Page 10 of 10 Aarti Ozarkar et al.