An Introduction to DesigningProbe-Based Real-Time

qPCR Assays

Gregory L. Shipley, Ph.D.

Probe Based Assay Types - #1

FRET-based Hydrolysis Probes1) Taqman® probe (Applied

Biosystems)Standard dNTPs;5’-reporter dye; 3’-quencher

2) Minor Groove Binding (MGB)Probes - ABI like Taqman +MGB moiety - short, same Tm

3) Locked NA Probe Library(Exiqon/Roche) - shorter (8-10bases), same Tm

Probe Based Assay Types - #21) FRET-based

Hybridization Probes• Molecular Beacon - 4-6 base

self-complementary region onboth ends + reporter &quencher = very efficient FRETquenching

2) MGB probes fromNanogen• Same working principle as the

hydrolysis version but thereporter dye = 3’-end and MGBmoiety + quencher = 5’-end,blocking hydrolysis

Probe Based Assay Types - #3

1) Hybridization dualoligo FRET-basedprobes (Roche)• Standard dNTPs,

1 oligo 3’-endfluorescein;second oligo 5’-end rhodamine

Probe- vs Dye- & Primer-Based AssaysSummary

Pros1. Probe-based assays have enhanced template

specificity over primer- or dye-based assays2. This higher specificity is required when there is

high sequence homology among transcript isoforms3. Shorter amplicon size for hydrolysis probe-based assays

means less sensitivity to sample degradation (formalin fixed & embedded tissue)

Cons1. Probe-based assay design can be more challenging2. Added cost of fluorescent probe over soluble dye

Main Steps in Assay Design

1) Confirm template sequence2) Be aware of sequence-related family members

& splice variants (sequence alignments)3) Determine where the assay should lie within

the sequence (e.g.,siRNA or microarray)4) Design assay using software - follow the rules5) Order multiple primers around the probe (2 & 2)6) Perform proper assay quality control7) Be patient, make the best assay you can

Primer - Assay Design Rules1- Primer concentrations for SYBR Green I assays are lower (50 -100 nM) than for probe-based assays (300 - 400 nM)- will affect the primer Tm, set the software accordingly

2- The primer Tm values should be kept the same or at most +/- 1˚C

3- Primers work best when there are 2-3 G/Cs in the last 5 bases on the 3’ end, 4-5 G/Cs on the end will give poor PCR efficiency

4- PCR amplicons for probe-based assays are made as short as possible; those for SYBR Green I assays are between 200-250 bases so that primer dimers can be seen easily on a melt curve

5- Choose assays that have more than two possible primers that can be used in combinations for assay optimization

Probe - Assay Design Rules1- Fluorescein based reporter dyes (FAM, JOE, Cal Gold,

Vic, etc.) should not be conjugated to a G residue2- Maximum Taqman probe length is 30 bases for optimal

quenching, other probe-based assays can use longeroligos

3- To keep probes and amplicons short, lower the primerTm to 55˚C or 50˚C for low G/C organisms- MGB probesoften not necessary

4- More Cs than Gs if there is an large imbalance in number-make the complementary probe

5- No more than 3-Gs in a row6- Probe Tm should be 8-10˚C higher than the primers

Assay Design QC - hS100POne forward primer and two reverse primers tested

AAATTGCTCAAGGACCTGGAC - 187(+)AAATTGCTCAAGGACCTGGACGCCAATGGAGATGCCCAGGTGGACTTCAGTGAGTTCATCGTGTTCGTGGCTTTAACGAGTTCCTGGACCTGCGGTTACCTCTACGGGTCCACCTGAAGTCACTCAAGTAGCACAAGCACCG 256(-) -CACTCAAGTAGCACAAGCACC 257(-) -CTCAAGTAGCACAAGCACCG

Ct values

187(+)/256(-)=24.2187(+)/257(-)=24.0

Assay Design QC - hS100PhS100P Assay - Primer pair #1 AAATTGCTCAAGGACCTGGAC- 187(+)

CCACGAACACGATGAACTCAC - 256(-)

Assay Design QC - hS100PhS100P Assay - Primer pair #2 AAATTGCTCAAGGACCTGGAC- 187(+)

GCCACGAACACGATGAACTC - 257(-)

Assay Design QC - hS100PFinal Taqman assay- 187(+), 257(-), 209(+)FAM/BHQ1Amplicon length = 71 basesEfficiency = 97%Lowest quantifiable value = 20 molecules

AAATTGCTCAAGGACCTGGAC- 187(+)AAATTGCTCAAGGACCTGGACGCCAATGGAGATGCCCAGGTGGACTTCAGTGAGTTCATCGTGTTCGTGGCTTTAACGAGTTCCTGGACCTGCGGTTACCTCTACGGGTCCACCTGAAGTCACTCAAGTAGCACAAGCACCG 257(-) -CTCAAGTAGCACAAGCACCG

Real-Time qPCR Assay QC Summary

Purchase 3 or 4 primers around the probe fortesting. You don’t know what’s optimal untilyou perform the test

Have fixed rules for the sensitivity, efficiencyand specificity for acceptance of new assays

All assays, homemade or commercial, shouldbe tested in your lab, under your assayconditions to determine their sensitivity andefficiency

The sensitivity and efficiency data should beincluded for all assays at the time ofpublication