An evolutionarily conserved putative insulator element near the 3 ...

An evolutionarily conserved putative insulatorelement near the 30 boundary of the imprintedIgf2/H19 domain

Ko Ishihara and Hiroyuki Sasaki*

Division of Human Genetics, Department of Integrated Genetics, National Institute of Genetics, and Department

of Genetics, Graduate University for Advanced Studies, 1111 Yata, Mishima, Shizuoka 411-8540, Japan

Received February 27, 2002; Revised and Accepted May 8, 2002

Igf2 and H19 are closely linked imprinted genes lying at the centromeric end of a 1 Mb imprinted domain onmouse chromosome 7. L23mrp and other genes located 30 (more centromeric) to H19 are not imprinted anddo not interact with the enhancers shared by Igf2 and H19. It is therefore suggested that the intergenic regionbetween H19 and L23mrp contains a boundary or an insulator element. We have identified a binding site forCTCF, a nuclear factor that mediates insulator activity in vertebrates, in the intergenic region. This site isconserved between human and mouse, associated with a major DNase I-hypersensitive site, and bound byCTCF in vivo. Functional assays using reporter constructs demonstrated that this element functions as aninsulator in transfected cells. The findings suggest that this CTCF site contributes to the 30 boundary of thisimprinted domain. Together with the findings on the differentially methylated CTCF sites 50 to H19, CTCF-dependent insulators may not only regulate but also delimit the imprinted domain.

INTRODUCTION

The eukaryotic genome is partitioned into independentfunctional domains that are separated by DNA sequencescalled boundary elements or insulator elements (1,2). Theseelements ensure the correct expression of genes within thedomain by blocking influences from regulatory elements in theneighboring domains. Thus, insulator elements are defined bytheir ability to block enhancer–promoter interactions whenpositioned between the enhancer and the promoter, or to protecttransgenes from position effects. The best characterizedinsulators include the Su(Hw)-binding sites within the gypsyretrotransposon of Drosophila (3), the scs and scs0 elementsflanking the 87A7 hsp70 locus of Drosophila (4), as well as thechicken b-globin insulators (5,6). Previously, Bell et al. (7)showed that a protein named CCCTC-binding factor (CTCF)binds to the core sequence of the chicken b-globin insulatorand that this factor plays a key role in enhancer-blockingactivity. Moreover, other insulators in vertebrates also containCTCF sites and show CTCF-dependent insulator activity(6–11).

The Igf2 and H19 genes are closely linked imprinted geneswhich are expressed only from the paternal and the maternalallele, respectively (12–14). Interestingly, the reciprocalimprinting of the two genes is dependent upon methylation-sensitive, CTCF-dependent insulators within the differentiallymethylated region (DMR) located 50 to H19 (8,9,15). These

genes are located at the centromeric end of a 1 Mb imprinteddomain, which contains at least 14 imprinted genes, in mousechromosome band 7F4/F5. It is known that L23mrp (Rpl23)and other genes located 30 (more centromeric) to H19 are notimprinted. A previous study by fluorescence in situ hybridiza-tion identified a transition from asynchronous replication atH19 to synchronous replication at L23mrp (16). Moreover, itwas shown that the endoderm-specific enhancers locatedbetween H19 and L23mrp interact with both Igf2 and H19(17), but not with L23mrp (18). These findings suggest that aninsulator element is present between H19 and L23mrp.

In the present study, we have looked for an insulator elementwithin the H19/L23mrp intergenic region based on sequencehomology with the known CTCF-dependent insulators. Ourstudy identified an evolutionarily conserved CTCF-binding sitethat showed enhancer-blocking activity in transfected cells. Theresults suggest that this CTCF-dependent insulator may serveto define the 30 boundaries of this imprinted domain.

RESULTS

Identification of sequences that can bind CTCF in vitro

To identify insulator elements within the H19/L23mrp inter-genic region, we looked for putative binding sites for CTCF.Although the sequences of the CTCF sites reported prior to this

*To whom correspondence should be addressed. Tel: þ81 559 816799; Fax: þ81 559 816800; Email: [email protected]

# 2002 Oxford University Press Human Molecular Genetics, 2002, Vol. 11, No. 14 1627–1636

Downloaded from https://academic.oup.com/hmg/article-abstract/11/14/1627/2355501by gueston 18 March 2018

study were rather divergent, we derived a 14 bp consensussequence for the core region (50-CCGCNNGGNGGCAG-30)by comparing the chicken b-globin FII sequence (7) andmultiple (four in mouse and six in human) CTCF sites withinthe DMR of H19 (8,9). The same consensus sequence wasrecently derived and used by Chao et al. (19). We then scanneda 33 kb region between H19 and L23mrp (GenBank accessionno. AF049091, bases 8137–41 680; GenBank accession no.AP003183, bases 8167–41 712) (Fig. 1A) for this consensussequence with a criterion of 12 matches or more in the 14nucleotides. As a result, we identified six candidate CTCF sites(PCT1–PCT6) on the upper strand and nine candidates (PCT7–PCT15) on the lower strand (Fig. 1A, B).

To determine which one of the candidate sequences can bindCTCF in vitro, electrophoretic mobility shift assays (EMSAs)were carried out with 84 bp duplex probes containing thesequences (Table 1). When the probes were incubated withnuclear proteins from 12.5 dpc mouse embryo, all probesformed at least one, but usually more, complexes (Fig. 1C).

Among the complexes, a major complex formed with PCT4,PCT12 and PCT6/14 (PCT6 and PCT14 were located closeeach other; Fig. 2A), respectively, showed the same mobility asthe CTCF complex formed with the m1 probe from the H19DMR (8). The three complexes were all super-shifted withpolyclonal anti-CTCF antibodies (Fig. 1C). Also, formation ofthe complexes was greatly diminished by competition withexcess unlabeled FII fragments but not with Sp1 consensusduplexes (Fig. 1D). Binding of CTCF to the three probes, butnot to the others, was confirmed by EMSA with an in vitrotranscribed/translated CTCF protein, although the affinity ofPCT4 to the synthesized protein was significantly lower thanthat of the others (data not shown, but see Fig. 5). Thesefindings show that the PCT4, PCT12 and PCT6/14 sequencescan specifically bind CTCF in vitro. A second complex formedwith the PCT4 probe probably contain Sp1, because formationof this complex was inhibited by addition of unlabeled Sp1consensus duplexes or unlabeled fragments of FII (which hasone Sp1 site) as competitors (Fig. 1D).

Figure 1. Identification of potential CTCF sites within the mouse H19/L23mrp intergenic region. (A) Structure of the H19/L23mrp region. Segments conservedbetween human and mouse (CS1–10) (23) are shown by filled circles (enhancers) and open circles (function unknown). Open boxes show the known CTCF siteswithin the DMR and the open box with an asterisk shows the 30 insulator identified in this study. The positions of the sequences similar to the CTCF consensus areshown below (PCT1–15). Nctc1 is a non-coding muscle-specific transcript, which is not imprinted. (B) Alignment of the sequence resembling CTCF sites. Theconsensus sequence for CTCF is indicated at the top. Nucleotides identical to the CTCF consensus are boxed. (C) EMSA with anti-CTCF antibodies. Nuclearextract from 12.5 dpc mouse embryo was incubated with the indicated probe alone (�) or with anti-CTCF antibodies (þ). Solid and open arrowheads indicatethe CTCF complexes and super-shifted complexes, respectively. (D) EMSA with competitors. Radiolabeled probes were incubated with a nuclear extract from12.5 dpc mouse embryo in the presence or absence of a 50-fold excess of unlabeled competitors as indicated. The competitors were the CTCF site from the chickenb-globin insulator (FII) and Sp1 consensus duplex (Sp1). The gray arrowhead indicates the Sp1 complex.

1628 Human Molecular Genetics, 2002, Vol. 11, No. 14


Cross-species conservation of the putative CTCF sites

To further assess the significance of the four potential CTCFsites (PCT4, PCT6, PCT12 and PCT14), we asked whetherthese sites are conserved through evolution. When we examinedthe human H19 region (GenBank accession no. AF087017,bases 10 988–40 560; GenBank accession no. AC004556, bases15 016–20 800) for these sequences, two sites corresponding toPCT12 and PCT14 were present at orthologous positions(Fig. 2A). The other two potential CTCF sites as well as the 11non-CTCF-binding sites were not conserved.

To examine whether the conserved human sequences canbind CTCF, we carried out EMSA with a nuclear extract from12.5 dpc mouse embryo. The major complexes formed with the

human probes (hPCT12 and hPCT14; Table 1) showed thesame mobility as the CTCF complex formed with the m1 probe(data not shown). These complexes were competed with excessunlabeled FII fragments but not with Sp1 consensus duplexes(Fig. 2B). Furthermore, the complexes were super-shifted withanti-CTCF antibodies (Fig. 2C). Thus, the two conservedsequences (PCT12 and PCT14) from both human and mousewere capable of binding CTCF in vitro.

DNase I hypersensitivity at PCT12

The known CTCF-dependent insulators, such as the chicken b-globin insulator (6,7) and mouse H19 DMR insulator (20,21),

Figure 1 continued.

Human Molecular Genetics, 2002, Vol. 11, No. 14 1629


Figure 2. PCT12 and PCT14 sites are evolutionarily conserved. (A) Alignment of the human and mouse PCT12 and PCT6/14 sequences. Nucleotide positionscorresponding to the CTCF consensus are boxed. Arrows indicate the orientation of the CTCF sites (see Fig. 1A). PCT12 and PCT14, but not PCT6, are conserved.(B) Competition assays. The major complexes formed with the human probes (solid arrowheads) were abolished by excess unlabeled FII fragments but not by Sp1consensus duplexes. (C) Super-shift assays. The complexes were super-shifted (open arrowheads) by anti-CTCF antibodies.



are all associated with DNase I-hypersensitive sites inchromatin. We therefore examined the DNase I sensitivity ofthe mouse PCT4, PCT12 and PCT6/14 regions. We first testeda 7.7 kb region containing both PCT4 and PCT12 (Fig. 3A).Nuclei isolated from 12.5 dpc mouse embryo were treated withincreasing concentrations of DNase I, and the DNA was purifiedand analyzed by Southern blotting. End fragments fromthe 7.7 kb EcoRV region were used as probes (Fig. 3A, top).The study revealed three hypersensitive sites (Fig. 3A, bottom):one located at, or very close to PCT12 and the others locatedin the middle and at the 30 end of the second exon ofthe muscle-specific transcription unit Nctc1 (22). No hyper-sensitive site was detected at or around PCT4 (Fig. 3A,bottom).

We next analyzed the DNase I sensitivity of the PCT6/14region. Two probes (PPm1 and BlP1) derived from the ends ofa 4 kb PstI fragment containing PCT6/14 were used (Fig. 3B,top). Two hypersensitive sites were detected and mapped atboth ends of CS9 (Fig. 3B, bottom), which is a mesoderm-specific enhancer (23). However, we did not observe anyDNase I-hypersensitive site associated with PCT6/14 (Fig. 3B,bottom). These results suggested that PCT12 may be the onlyCTCF-dependent insulator that works in vivo.

In vivo binding of CTCF to PCT12

To know whether PCT12 and other potential CTCF sites arebound by CTCF in vivo, we carried out chromatin immuno-precipitation (ChIP) assays with nuclei isolated from 12.5 dpcmouse embryo. We treated the nuclei with formaldehyde tocrosslink protein with DNA, fragmented the chromatin bysonication, and carried out immunoprecipitation with anti-CTCF antibodies. By PCR using specific primers, we examinedwhether PCT12 and the other two potential CTCF sites areco-immunoprecipitated with CTCF. As shown in Fig. 4, thePCT12 region, as well as the positive control (m3) from theH19 DMR, was greatly enriched in the anti-CTCF immuno-precipitates. In contrast, PCT4, PCT6/14 and a negative controlregion (H19 exon 5) showed no or little enrichment, if any. The

results clearly demonstrated that PCT12 is bound by CTCF inthe chromatin of mouse embryo.

Methylation prevents CTCF from binding to PCT6/14

It is known that, if CpG dinucleotides within the recognitionsequence for CTCF are methylated, the factor cannot bind tothe target. While PCT12 contained no CpG, PCT4, PCT6 andPCT14 each contained one CpG. We therefore examined themethylation status of the three sites in 14.5 dpc mouse embryoby bisulfite genomic sequencing. The results showed that allsites were highly methylated: methylation was observed in 17out of 19 sequenced clones for PCT6 (89%), 16 out of 19for PCT14 (84%) and 10 out of 11 for PCT4 (91%). This raisedthe possibility that the lack of CTCF binding to PCT4 andPCT6/14 could be due to methylation of the target sequences.To see whether methylation of these sequences inhibits CTCFbinding, we carried out EMSA with in vitro methylated PCT4and PCT6/14 probes. Complex formation with in vitrotranscribed/translated CTCF protein was greatly diminishedby methylation of the PCT6/14 probe, while it was minimallyaffected by methylation of the PCT4 probe (Fig. 5). The reasonfor the lack of in vivo binding of CTCF to PCT4 is yet to bedetermined.

PCT12 has an insulator activity

Among the candidates that we identified in our initialbioinformatic screen, the best candidate left for a CTCF-dependent insulator was PCT12. We therefore examined itsenhancer-blocking activity by a colony assay. Various con-structs shown in Fig. 6 were respectively transfected intoHep3B cells, and their enhancer-blocking activity was assayedby counting the number of G418-resistant colonies. When theH19 DMR insulator (a control fragment), which has four CTCFsites, was inserted between the promoter and the enhancer(pHNIE), the colony number decreased to approximately 10%.We then tested a 1.5 kb XhoI–PmaCI fragment containingPCT12 (pHNPXE) and observed that the colony numberdecreased to approximately 40%. This suggested that PCT12

Table 1. EMSA probes

PCT1 50-TAGCCAAGGGACTGCCAACCTATACAAGATCA GGGCAGGGGGGCAG TGCTAGAGATATGTGGGCCAAAACTTGACAGGCATAGA-30

2 50-ACAAACAGCTGTCTCGACTCCCAGGCCCCGTGAAGACC CTGGTTGGGGGCAG GGGCTATGGGATACCTCCTGGGGATACACCAG-30

3 50-GACCAGGCTCTCCGTCCCCTTCTGTGCAGCCACAGGAAT CTGCAAGGTGGCTG CCTGAGGGAAGGCAGGCAATGGGTAGGGCAG-30

4 50-CCTTCTATCAGAATGTCACCCTCCCCTAAAGCTA CCGCTGGGGTCCAG GGGTGGCACCACACTCTTCAATCTACTTCTTTCCC-30

5 50-GTGGAGGAAGGCGCCATGTGGAACCAACTGGCC TGGCTTGGGGGCAG GAGGCCCCCCAAGCAGTGAGCCCAGCTGGGCATGCT-30

6/14 50-GAGGTACCCATGCCTGGCCACATT CTGCCACACCGTGGCCGCTGGGAGGAAG GGACAGGGACCAGGCCAGGCAGGGAGGCATTA-30

7 50-TCCCGAGGCATAATGTAGACTGCACAGTAAAT CTGACTCCTTGCAG TAAGGCTCGTAATGGGTAGGCAGCTACACATGAGGCTG-30

8 50-GCTTAGAGAGGGCTGCTAGACAGGCTCCAAGC CTGCCACCCAAAGG CACTTTCAACCTCCCCCCTCCTTGTGCGGAGAAGCTAA-30

9 50-GGAAGCCACCTTTGTGTACCCATTGTGAGTACC CTGCTCCCCGGCAG CTCTCAGCACTGCTGAGGTACAGAGGGAGCGCCTCTG-30

10 50-AGGAGTGGGCAACAGAAGAATGGAGAGGCTGCTTCT CTGCCCCCAAGCCC CCCAGCTTCCTGCCTCACAGCCCACAAAGCACTA-30

11 50-CCAATACTTGGGGACACCATGCTCCCACTGCCCC CTACCACCACACGG CCCTGGGTACACACAGCCCTCAAACCCACTAAGGCT-30

12 50-AAGCAGTGAGCCCAGCTGGGCATGCTTGCTCCTCTA CTGCCCCCTTTAGG TAGCCCAAGGCTCAGAACCAGCTCCCCCAGAGAC-30

13 50-TTAGGAGGCCCCTTCCAGAATTTAGA CTGCCTCATCGCAG GGACACAGGGAAAACTAAAAATGTTCACACACTAAGGTACCCCA-30

15 50-TGGCCTTCAGCCTCAGCCAGCATACCCCCCTT CTCCCGCCCACCGG CCTGCTCGCCCGCCCGCCCGTGCACTCCAGTGGGGGTG-30

hPCT12 50-AGAGGGAGGCGTCCGACCGACCGCACTGCTCTG CTGCCCCCACCAGG CAGGCCGAGGCCGGCATCCCCGGAGACCGGGACCTGG-30

14 50-TCCGGTGCCCTTGCCTGGCATGCT CTGCCACACCGTGG CCGCGTGAGGGACAGACAGCGCGGGACAGAATCCCACCTGGCAGGG-30

Only the upper strand sequence of the duplex probe is shown. Sequences simlar to the CTCF consensus (Fig. 1B) are indicated in bold.



Figure 3. DNase I-hypersensitive site assay of the potential CTCF sites. Nuclei isolated from 12.5 dpc mouse embryo were digested with increasing amounts ofDNase I. DNA was analyzed by Southern blotting. (A) DNase I hypersensitivity of the PCT12 region. A map of the mouse region containing PCT4 and PCT12 isshown at the top. The solid box indicates the second exon of Nctc1 and the oval indicates a mesoderm enhancer (CS9) (23). Solid arrowheads show the positions ofhypersensitive sites. The position of PCT4 is shown by an open arrowhead. Gray bars show the probes used: VBg0.6, a 0.6 kb EcoRV–BglII fragment, and SV1, a1 kb SacI–EcoRV fragment. (B) DNase I-hypersensitive sites of the PCT6/14 region. Two hypersensitive sites were detected (solid arrowheads) at both ends of CS9using PPm1 (a 1 kb PstI–PmaCI fragment) and BlP1 (a 1 kb BlnI–PstI fragment) probes. The open arrowhead indicates the position of PCT6/14. Sizes are in kb.



indeed has an enhancer-blocking activity. A similar reductionin colony number was observed in pHNXPE, which wasidentical to pHNPXE except that the fragment was inserted inthe opposite direction. Thus, the enhancer-blocking activitywas independent of the orientation of the fragment. To excludethe possibility that the reduced colony number was due to asilencer activity, we relocated the fragment to a position 30 tothe enhancer (pHNEPX). This construct affected the colonynumber only minimally indicating that the fragment possesseslittle silencer activity. Lastly, to determine whether the insulatoractivity was dependent on the CTCF site, base substitutionswere introduced at all 14 nucleotides of the PCT12 sequence(pHNME), which abolished CTCF binding. The resultsuggested that the insulator activity of the PCT12 fragment islargely (>60%) dependent upon the CTCF site, but some othersequences within the fragment could also contribute to theinsulator activity.

DISCUSSION

We have identified a putative CTCF-dependent insulator in theH19/L23mrp intergenic region based on sequence homologywith known CTCF-binding sites. This sequence element(PCT12) is conserved between human and mouse, associatedwith a DNase I-hypersensitive site, bound by CTCF in vivo,and exhibited an insulator activity in transfected cells. Theseresults demonstrate that a sequence-based approach is effectivein identifying CTCF-dependent insulators, despite the view thatthe factor binds to a diverse range of sequences bycombinatorial use of the 11 zinc fingers (24). The existenceof this element in the region is consistent with the transitionfrom asynchronous replication at H19 to synchronous replica-tion at L23mrp (16) and with the lack of interaction of theendoderm-specific H19 enhancers with the L23mrp promoter(18). Although elucidation of the exact function of this elementawaits germline deletion in mice, our data suggests that it is animportant component of the 30 (centromeric) boundary of theimprinted Igf2/H19 domain.

Previous studies showed that the reciprocal imprinting of Igf2and H19 is regulated by a cluster of methylation-sensitiveCTCF-dependent insulators in the DMR located 50 to H19(8,9,15) and the multiple tissue-specific enhancers located 30 toH19 (17,23,25). It is proposed that the methylation status of theDMR determines the activity of the insulators and decideswhich gene is to be activated by the 30 enhancers on eachparental chromosome. The present study suggests that H19 alsohas a CTCF-dependent, but methylation-insensitive, insulatorin the 30 flanking region. This domain structure (Fig. 1A) isreminiscent of the chicken b-globin domain, which is flankedby a CTCF-dependent insulator on each side (6,7). Thus,CTCF-dependent insulators may be a common component ofthe domain boundaries in the vertebrate genome.

The imprinted domain defined by the putative insulatorincludes a non-imprinted transcription unit, Nctc1 (22)(Fig. 1A). This transcription unit is active only in adult skeletalmuscle. Some of the genes located in this 1 Mb imprinteddomain escape imprinting, with a common feature of not beingassociated with CpG islands (e.g. Tssc6 and Th). The lack of aCpG island associated with Nctc1 may be the reason why thistranscription unit escapes imprinting even though it is locatedon the imprinted side of the element.

We previously identified multiple tissue-specific enhancers inthe H19/L23mrp intergenic region (23). Among these, CS9,

Figure 4. PCT12 is bound by CTCF in vivo. Nuclei isolated from 12.5 dpc mouse embryo were treated with formaldehyde. Then sonicated chromatin was subjectedto immunoprecipitation with or without anti-CTCF antibodies. Immunoprecipitated DNA was PCR-amplified with specific primers. DNA isolated from the super-natant without antibodies was used as ‘input’ DNA. The m3 and H19 exon 5 regions were used as positive and negative controls, respectively.

Figure 5. Methylation of PCT6/14 sequence inhibits CTCF binding. Unmethy-lated (U) and methylated (M) probes were incubated with in vitro synthesizedCTCF protein. The arrowhead indicates the CTCF complex.



which is a mesoderm-specific enhancer, is located more 30 to theputative insulator (Fig. 1A). Other studies involving BAC andYAC transgenes showed that additional enhancers for expressionin the heart, kidney and lung should be present further 30 (26,27).These findings pose a potential problem that the far 30 enhancersmust act on Igf2 and H19 over this element. We consider thefollowing possibilities. Firstly, despite our transfection data, theputative insulator could act in an orientation-dependent mannerin the genomic context and/or in specific tissues. There areexamples of such an orientation-dependent insulator (28,29).Secondly, there is evidence that enhancer-blocking activity of aninsulator is dependent upon enhancer–promoter combination(30,31), and thus certain enhancer–promoter pairs may not beblocked by CTCF-dependent insulators. Thirdly, a promotertargeting sequence (PTS) (32), which can override the activity ofan insulator to mediate interactions between genes andenhancers, could be present in a region 30 to the CTCF site.Then the more 30 enhancers should be able to activate Igf2 andH19 through this element.

In addition to PCT12, this region could contain otherinsulator elements as well. For example, one putative CTCFsite that we identified in this study was conserved betweenhuman and mouse (PCT14). Although this site was heavilymethylated and lacked in vivo evidence for CTCF binding inwhole 14.5 dpc embryo, it could display insulator activity in arestricted tissue or at a specific developmental time. Also, theremay be sites that show little homology with the consensus

sequence but can in fact bind CTCF. Finally, insulators thatinteract with unknown factors may be present.

The putative insulator may have relevance to the phenotypeof the mouse mutant called minute (Mnt), which exhibitsdwarfism only upon paternal transmission. A molecularanalysis of this mutation revealed that it involved an inversionof a region from immediately 50 of the 30 insulator to severalmegabases 30 (33). It is tempting to speculate that the removalof not only the tissue-specific enhancers but also this elementleads to deterioration of the expression of nearby genes,including Igf2 (33), resulting in the phenotype. Another recentstudy showed that a targeted deletion of a region between theendoderm-specific enhancers (CS3 and CS4) and L23mrp,including mesoderm-specific enhancers and the element, didnot affect the expression of L23mrp (25). This again suggeststhat other insulator elements, which are not deleted in thesemice, may be present in the region. Further studies are neededto reveal all the sequence elements that contribute to theboundary function of this intergenic region.

MATERIALS AND METHODS

EMSA

Preparation of nuclear extracts and EMSA was carried out asdescribed previously (23). CTCF protein was synthesized by a

Figure 6. Enhancer-blocking activity of PCT12. The human hepatoma cell line Hep3B was stably transfected with the indicated construct and grown in mediumcontaining G418. The number of neomycin-resistant colonies obtained with pHNE was set as 1. A 1.5 kb XhoI–PmaCI fragment containing PCT12 is shownby arrows, indicating the orientation of transcription. A fragment with mutations at PCT12 is indicated as ‘mut’. Neo, neomycin-resistance gene; P, mouseH19 promoter; Enh, H19 endoderm enhancers; Ins, H19 DMR insulator.



coupled in vitro transcription/translation reaction using a TNTT7 Quick system (Promega) according to the manufacturer’sprotocol. For super-shift assays, the reaction mix was combinedwith 2 ml of anti-CTCF antibody (Upstate biotechnology) andincubated for 1.5 h at 4�C before the addition of radiolabeledprobes. The sequences of the probes are shown in Table 1.Methylation of the probes was carried out using SssI methylase(New England Biolabs) according to the supplier’s instructions.The methylation reaction was monitored by digestion of theprobes with a methylation-sensitive restriction enzyme AciI(CCGC). Oligonucleotide duplexes used as competitors were asfollows: FII, 50-TGT AAT TAC GTC CCT CCC CCG CTAGGG GGC AGC AGC GAG CCG C-30; Sp1, 50-ATT CGATCG GGG CGG GGC GAG C-30.

DNase I-hypersensitive site assay

Isolation of cell nuclei from 12.5 dpc mouse embryos andmapping of DNase I-hypersensitive sites were performed asdescribed in (34).

ChIP assay

Nuclei from 12.5 dpc mouse embryos were isolated asdescribed in (34). ChIP assay was performed according to theprotocol supplied by Upstate Biotechnology with somemodifications. To crosslink proteins to DNA, formaldehydewas added to the nuclear suspension (3� 106 nuclei) to a finalconcentration of 1%, and incubated at 25�C for 10 min. Twomicroliters of anti-CTCF antibody (Upstate Biotechnology)was added and the mixture was incubated at room temperaturefor 1 h. The antibody-binding reaction was followed by anaddition of 60 ml of salmon sperm DNA/protein A agaroseslurry (Upstate Biotechnology) and a further incubation atroom temperature for 1 h. PCR was carried out for 25 cycleswith [a-32P]dCTP. The PCR products were separated by PAGEand visualized by autoradiography. The primers used were asfollows: ChIP4-1 (PCT4, up), 50-AAA AGG TGC CCA TCTTGA TGG CTG-30; ChIP4-2 (PCT4, down), 50-TTT CTG ACTCTC CTG ATA CCA TGT-30; ChIP12-1 (PCT12, up), 50-GGTGGA GGA AGG CGC CAT GTG G-30; ChIP12-2 (PCT12,down), 50-CTG ACT TCA GGA GGG TCT GGG ACT-30;ChIP6/14-1 (PCT6/14, up), 50-TAG AAT CAC TCC AACTGG CAT GTC-30; ChIP6/14-2 (PCT6/14, down), 50-TAATAC CAG CTA CAT GAG ATC CTG-30; m3-s (H19 DMRm3, up), 50-CTG TTA TGT GCA ACA AGG GAA-30; m3-a(H19 DMR m3, down), 50-GGT CTT ACC AGC CAC TGA-30;OLG-1 (H19 exon 5, up), 50-GTG AAG CTG AAA GAA CAGATG GTG-30; OLG-5 (H19 exon 5, down), 50-AAG CAC ACGGCC ACA CCC AGT-30.

Bisulfite methylation assay

Genomic DNA (2 mg) from 14.5 dpc mouse embryos wasdigested overnight with StuI restriction enzyme. Bisulfitetreatment was carried out as described by Paulin et al. (35).The bisulfite-treated DNA was amplified by PCR. The PCRproducts were subcloned into pBluescript plasmids andsequenced by the Big Dye Terminator Cycle Sequencing Kitand ABI PRISM 377 Sequencer (Perkin Elmer). The primersused were as follows: bisP1 (PCT6/14, upper strand, up), 50-

TTG GTA TGT TAG TTG GTT TTG GTG ATG GG-30; bisP2(PCT6/14, upper strand, down), 50-ACC TAA CTC CTA TCCTCA ATC CCA ATA AAT-30; bisP3 (PCT6/14, lower strand,up), 50-ATA ACT CTT CCA AAA CCC TAA CCA TCC TAA-30; bisP4 (PCT6/14, lower strand, down), 50-GAG ATT TTGGTT GGT AGA AGA ATA ATA GTA G-30; bisP5 (PCT4,upper strand, up), 50-ATT TTG ATG GTT GGT TTT GTTAGG GGT AAA-30; bisP6 (PCT4, upper strand, down),50-TCC TTT CTA ACT CTC CTA ATA CCA TAT AAA-30.

Colony assay

The reporter plasmid pHN consisted of a neomycin-resistance(neo) gene driven by the H19 promoter (�818 bp to þ6 bp)and a 1.8 kb AatII–HindIII fragment containing the H19 DMRinsulator. This insulator should prevent influence from theadjacent regions. The plasmid pHNE was made by linking the2.5 kb NsiI–BglII fragment containing the endoderm-specificenhancers (the CS3/4 region) to pHN. Test fragments wereexcised from the cosmid cDH2 (22) by appropriate restrictionenzymes, treated with T4 DNA polymerase and subcloned intothe pBluescript plasmids at the EcoRV site. The fragments wereliberated by double digestion with XhoI and SpeI and insertedinto the XhoI/SpeI sites of pHNE between the neo gene and theenhancers. A test fragment for pHNME was generated byintroducing base substitutions into the CTCF consensussequence at PCT12 (from 50-CTG CCC CCT TTA GG-30 to50-AGT AAA AAG GGC TT-30) of a plasmid clone carryingthe 1.5 kb XhoI–PmaCI fragment by a PCR-mediated muta-genesis method described by Imai et al. (36). The primers usedwere as follows: 12mut-1 (up), 50-TTT TAC TTA GAG GAGCAA GCA TGC CCA-30; 12mut-2 (down), 50-AGG GCT TTAGCC CAA GGC TCA GAA CCA-30. To make pHNEPX, the1.5 kb XhoI–PmaCI fragment was ligated to the 30 end of theenhancer fragment and brought into pHN. The reporterconstructs were linearized with MluI, and 0.2 pmol of eachconstruct was transfected into 1.2� 106 Hep3B cells usingLipofectamine Plus (Gibco BRL), together with 0.2 pmol of aplasmid encoding a hygromycin-resistance gene linearized withXhoI. After 48 h, cells were replated into two separate platesand selected by G418 (800 mg/ml) and hygromycin-B(250 mg/ml), respectively. Colonies were counted after 2 weeksof selection. The number of G418-resistant colonies was correctedfor transfection efficiency based on the number of hygromycin-resistant colonies and normalized to that obtained with pHNE.

ACKNOWLEDGEMENTS

We are grateful to Hisao Shirohzu and Takashi Sado for theiradvice and discussion. K.I. was supported by Research Fellow-ships of the Japan Society for the Promotion of Science forYoung Scientists. This work was supported by grants from theMinistry of Health, Labour and Welfare, and the Ministry ofEducation, Culture, Sports, Science and Technology of Japan.

REFERENCES

1. Udvardy, A. (1999) Dividing the empire: boundary chromatin elementsdelimit the territory of enhancers. EMBO J., 18, 1–8.



2. Bell, A.C., West, A.G. and Felsenfeld, G. (2001) Insulators and boundaries:versatile regulatory elements in the eukaryotic genome. Science, 291,447–450.

3. Geyer, P.K. and Corces, V.G. (1992) DNA position-specific repression oftranscription by a Drosophila zinc finger protein. Genes Dev., 6, 1865–1873.

4. Udvardy, A., Maine, E. and Schedl, P. (1985) The 87A7 chromomere.Identification of novel chromatin structures flanking the heat shock locusthat may define the boundaries of higher order domains. J. Mol. Biol., 185,341–358.

5. Chung, J.H., Whiteley, M. and Felsenfeld, G. (1993) A 50 element of thechicken b-globin domain serves as an insulator in human erythroid cells andprotects against position effect in Drosophila. Cell, 74, 505–514.

6. Saitoh, N., Bell, A.C., Recillas-Targa, F., West, A.G., Simpson, M.,Pikaart, M. and Felsenfeld, G. (2000) Structural and functional conser-vation at the boundaries of the chicken b-globin domain. EMBO J., 19,2315–2322.

7. Bell, A.C., West, A.G. and Felsenfeld, G. (1999) The protein CTCF isrequired for the enhancer-blocking activity of vertebrate insulators. Cell,98, 378–396.

8. Bell, A.C. and Felsenfeld, G. (2000) Methylation of a CTCF-dependentboundary controls imprinted expression of the Igf2 gene. Nature, 405, 482–485.

9. Hark, A.T., Schoenherr, C.J., Katz, D.J., Ingram, R.S., Levorse, J.M. andTilghman, S.M. (2000) CTCF mediates methylation-sensitive enhancer-blocking activity at the H19/Igf2 locus. Nature, 405, 486–489.

10. Antes, T.J., Namciu, S.J., Fournier, R.E. and Levy-Wilson, B. (2001) The 50

boundary of the human apolipoprotein B chromatin domain in intestinalcells. Biochemistry, 40, 6731–6742.

11. Filippova, G.N., Thienes, C.P., Penn, B.H., Cho, D.H., Hu, Y.J.,Moore, J.M., Klesert, T.R., Lobanenkov, V.V. and Tapscott, S.J. (2001)CTCF-binding sites flank CTG/CAG repeats and form a methylation-sensitive insulator at the DM1 locus. Nat. Genet., 28, 335–343.

12. DeChiara, T.M., Robertson, E.J. and Efstratiadis, A. (1991) Parentalimprinting of the mouse insulin-like growth factor II gene. Cell, 64, 849–859.

13. Bartolomei, M.S., Zemel, S. and Tilghman, S.M. (1991) Parentalimprinting of the mouse H19 gene. Nature, 351, 153–155.

14. Sasaki, H., Ishihara, K. and Kato, R. (2000) Mechanisms of Igf2/H19imprinting: DNA methylation, chromatin and long-distance gene regula-tion. J. Biochem., 127, 711–715.

15. Kanduri, C., Pant, V., Loukinov, D., Pugacheva, E., Qi, C.F., Wolffe, A.,Ohlsson, R. and Lobanenkov, V.V. (2000) Functional association of CTCFwith the insulator upstream of the H19 gene is parent of origin-specific andmethylation-sensitive. Curr. Biol., 10, 853–856.

16. Greally, J.M., Starr, D.J., Hwang, S., Song, L., Jaarola, M. and Zemel, S.(1998) The mouse H19 locus mediates a transition between imprinted andnon-imprinted DNA replication patterns. Hum. Mol. Genet., 7, 91–95.

17. Leighton, P.A., Saam, J.R., Ingram, R.S., Stewart, C.L. and Tilghman, S.M.(1995) An enhancer deletion affects both H19 and Igf2 expression. GenesDev., 9, 2079–2089.

18. Zubair, M., Hilton, K., Saam, J.R., Surani, M.A., Tilghman, S.M. andSasaki, H. (1997) Structure and expression of the mouse L23mrp genedownstream of the imprinted H19 gene: biallelic expression and lack ofinteraction with the H19 enhancers. Genomics, 45, 290–296.

19. Chao, W., Huynh, K.D., Spencer, R.J., Davidow, L.S. and Lee, J.T. (2002)CTCF, a candidate trans-acting factor for X-inactivation choice. Science,295, 345–347.

20. Hark, A.T. and Tilghman, S.M. (1998) Chromatin conformation of the H19epigenetic mark. Hum. Mol. Genet., 7, 1979–1985.

21. Khosla, S., Aitchison, A., Gregory, R., Allen, N.D. and Feil, R. (1999)Parental allele-specific chromatin configuration in a boundary-imprinting-control element upstream of the mouse H19 gene. Mol. Cell. Biol., 19,2556–2566.

22. Ishihara, K., Kato, R., Furuumi, H., Zubair, M. and Sasaki, H. (1998)Sequence of a 42-kb mouse region containing the imprinted H19 locus:identification of a novel muscle-specific transcription unit showing biallelicexpression. Mamm. Genome, 9, 775–777.

23. Ishihara, K., Hatano, N., Furuumi, H., Kato, R., Iwaki, T., Miura, K.,Jinno, Y. and Sasaki, H. (2000) Comparative genomic sequencing identifiesnovel tissue-specific enhancers and sequence elements for methylation-sensitive factors implicated in Igf2/H19 imprinting. Genome Res., 10,664–671.

24. Ohlsson, R., Renkawitz, R. and Lobanenkov, V. (2001) CTCF is a uniquelyversatile transcription regulator linked to epigenetics and disease. TrendsGenet., 17, 520–527.

25. Kaffer, C.R., Grinberg, A. and Pfeifer, K. (2001) Regulatory mechanisms atthe mouse Igf2/H19 locus. Mol. Cell. Biol., 21, 8189–8196.

26. Ainscough, J.F.-X., Dandolo, L. and Surani, M.A. (2000) Appropriateexpression of the mouse H19 gene utilises three or more distinct enhancerregions spread over more than 130 kb. Mech. Dev., 91, 365–368.

27. Kaffer, C.R., Srivastava, M., Park, K.Y., Ives, E., Hsieh, S., Batlle, J.,Grinberg, A., Huang, S.P. and Pfeifer, K. (2000) A transcriptional insulatorat the imprinted H19/Igf2 locus. Genes Dev., 14, 1908–1919.

28. Robinett, C.C., O’Connor, A. and Dunaway, M. (1997) The repeatorganizer, a specialized insulator element within the intergenic spacer of theXenopus rRNA genes. Mol. Cell. Biol., 17, 2866–2875.

29. Kanduri, C., Holmgren, C., Pilartz, M., Franklin, G., Kanduri, M., Liu, L.,Ginjala, V., Ulleras, E., Mattsson, R. and Ohlsson, R. (2000) The 50 flank ofmouse H19 in an unusual chromatin conformation unidirectionally blocksenhancer–promoter communication. Curr. Biol., 10, 449–457.

30. Hagstrom, K., Muller, M. and Schedl, P. (1996) Fab-7 functions as achromatin domain boundary to ensure proper segment specification by theDrosophila bithorax complex. Genes Dev., 10, 3202–3215.

31. Scott, K.C., Taubman, A.D., and Geyer, P.K. (1999) Enhancer blocking bythe Drosophila gypsy insulator depends upon insulator anatomy andenhancer strength. Genetics, 153, 787–798.

32. Zhou, J. and Levine, M. (1999) A novel cis-regulatory element, thePTS, mediates an anti-insulator activity in the Drosophila embryo. Cell, 99,567–575.

33. Davies, K., Bowden, L., Smith, P., Dean, W., Hill, D., Furuumi, H.,Sasaki, H., Cattanach, B. and Reik, W. (2002) Disruption of mesodermalenhancers for Igf2 in the minute mutant. Development, 129, 1657–1668.

34. Sasaki, H., Jones, P.A., Chaillet, J.R., Ferguson-Smith, A.C., Barton, S.C.,Reik, W. and Surani, M.A. (1992) Parental imprinting: potentially activechromatin of the repressed maternal allele of the mouse insulin-like growthfactor II (Igf2) gene. Genes Dev., 6, 1843–1856.

35. Paulin, R., Grigg, G.W., Davey, M.W. and Piper, A.A. (1998) Ureaimproves efficiency of bisulphite-mediated sequencing of 50-methylcytosinein genomic DNA. Nucleic Acids Res., 26, 5009–5010.

36. Imai, Y., Matsushima, Y., Sugimura, T. and Terada, M. (1991) A simpleand rapid method for generating a deletion by PCR. Nucleic Acids Res.,19, 2785.



An evolutionarily conserved putative insulator element near the 3 ...

Documents

Transcript of An evolutionarily conserved putative insulator element near the 3 ...