RESEARCH ARTICLE

Ammonia excretion and acid–base regulation in the Americanhorseshoe crab, Limulus polyphemusStephanie Hans1, Alex R. Quijada-Rodriguez1, Garett J. P. Allen1, Horst Onken2, Jason R. Treberg1,3 andDirk Weihrauch1,*

ABSTRACTMany studies have investigated ammonia excretion and acid–baseregulation in aquatic arthropods, yet current knowledge of marinechelicerates is non-existent. In American horseshoe crabs (Limuluspolyphemus), book gills bear physiologically distinct regions: dorsaland ventral half-lamellae, a central mitochondria-rich area (CMRA)and peripheral mitochondria-poor areas (PMPAs). In the presentstudy, the CMRA and ventral half-lamella exhibited characteristicsimportant for ammonia excretion and/or acid–base regulation, assupported by high expression levels of Rhesus-protein 1 (LpRh-1),cytoplasmic carbonic anhydrase (CA-2) and hyperpolarization-activated cyclic nucleotide-gated K+ channel (HCN) compared withthe PMPA and dorsal half-lamella. The half-lamellae displayedremarkable differences; the ventral epithelium was ion-leakywhereas the dorsal counterpart possessed an exceptionally tightepithelium. LpRh-1 was more abundant than Rhesus-protein 2(LpRh-2) in all investigated tissues, but LpRh-2 was more prevalentin the PMPA than in the CMRA. Ammonia influx associated with highambient ammonia (HAA) treatment was counteracted by intactanimals and complemented by upregulation of branchial CA-2, V-type H+-ATPase (HAT), HCN and LpRh-1 mRNA expression. Thedorsal epithelium demonstrated characteristics of active ammoniaexcretion. However, an influx was observed across the ventralepithelium as a result of the tissue’s high ion conductance, althoughthe influx rate was not proportionately high considering the ∼3-foldinwardly directed ammonia gradient. These novel findings suggest arole for the coxal gland in excretion and in the maintenance ofhemolymph ammonia regulation under HAA. Hypercapnic exposureinduced compensatory respiratory acidosis and partial metabolicdepression. Functional differences between the two halves of abranchial lamella may be physiologically beneficial in reducing thebackflow of waste products into adjacent lamellae, especially influctuating environments where ammonia levels can increase.

KEY WORDS: Ussing chamber, Gills, Rh-proteins,Carbonic anhydrase

INTRODUCTIONAmino acid-catabolizing organisms produce toxic nitrogenouswaste products that must be eliminated via excretion strategies

such as ammonotelism, where ammonia is the dominant excretoryproduct (Wright, 1995). Compared with other nitrogenous wasteproducts, ammonia is energetically beneficial as it can be released asis and does not require additional energy for conversion into its lesstoxic counterparts, such as urea or uric acid. Aquatic animals(excluding mammals and elasmobranchs) commonly exhibitammonotelism because of abundant water availability forcontinuous excretion, preventing toxic build-ups (Larsen et al.,2014).

Ammonia exists in both gaseous (NH3) and ionic (NH4+;

ammonium) forms, and the relationship between the two isdepicted in Eqn 1:

NH3 þ H2O $ NH4þ þ OH�: ð1Þ

Aquatic animals may experience excess extracellular ammonia(in this study, ammonia refers to the sum of NH3 and NH4

+) whilstburying or upon emersion, when excretion is impaired (Weihrauchet al., 1999). Increased concentration of circulating ammonia cancause numerous deleterious effects, such as acid–base imbalance(Goldsmith and Hilton, 1992; Wilson and Taylor, 1992),ionoregulatory disruption (Young-Lai et al., 1991) andneurotoxicity (Butterworth, 2002; Marcaida et al., 1992). Severalkey proteins have been suggested to influence ammonia excretion ofinvertebrate species, including Na+/K+-ATPase (NKA), V-type H+-ATPase (HAT) and glycosylated Rhesus proteins (Rh-proteins)(Chasiotis et al., 2016; Larsen et al., 2014; Masui et al., 2002; Pittset al., 2014; Quijada-Rodriguez et al., 2015; Weihrauch et al., 1998,2012).

Mounting evidence suggests that ammonia excretion and acid–base regulation of several invertebrate species are intricately linked,possibly because of the acidic and basic forms of ammonia (NH4

+

and NH3, respectively) and the sharing of key transporters such asNKA, HAT and Rh-proteins (Fehsenfeld and Weihrauch, 2016a).This notion has been encouraged by investigations concluding thatanterior and posterior gills of Carcinus maenas, the green shorecrab, have similar capacities for ammonia and H+-equivalentexcretion (e.g. Fehsenfeld and Weihrauch, 2013). Althoughextensive studies have focused on ammonia excretorymechanisms of crustaceans and teleost fishes, there has yet to bean equivalent study on chelicerates. This is likely because the vastmajority of this subphylum are terrestrial arachnids, which excreteguanine as their dominant nitrogenous waste product because ofenvironmental water constraints (Larsen et al., 2014). Xiphosura,which includes the American horseshoe crab, Limulus polyphemus(Linnaeus 1758), is an exception to the terrestrial chelicerates interms of lifestyle.

Limulus polyphemus has remained morphologically unchangedfor over 200 million years (Avise et al., 1994) and is currentlywidespread along the east coast of the USA, and Mexico (Shuster,Received 19 October 2016; Accepted 10 January 2018

1Department of Biological Sciences, University of Manitoba, Winnipeg, MB,R3T2N2, Canada. 2Department of Biological Sciences, Wagner College, StatenIsland, NY 10309, USA. 3Department of Human Nutritional Sciences, University ofManitoba, Winnipeg, MB, R3T2N2, Canada.

*Author for correspondence (Dirk.Weihrauch@umanitoba.ca)

D.W., 0000-0002-3218-9093

1

© 2018. Published by The Company of Biologists Ltd | Journal of Experimental Biology (2018) 221, jeb151894. doi:10.1242/jeb.151894

Journal

ofEx

perim

entalB

iology

1979). The horseshoe crab is of economic importance to thebiomedical industry as an extract collected from its hemolymph isused for testing bacterial endotoxin contamination in medicalproducts (Novitsky, 1984). Limulus polyphemus occupy theconstantly fluctuating estuarine and coastal areas, inhabitingdeeper waters as they age into adulthood and returning to sandybeaches to mate, where they remain emersed (Rudloe, 1981;Shuster, 1982). When not mating, much of this benthic animal’stime is spent buried in search of prey, such as polychaete worms andbivalve mollusks (Botton, 1984), which are rich in protein. Basedon these observed behaviors, L. polyphemus likely experiencesnatural exposure to both hypercapnia (elevated ambient PCO2

) andhigh ambient ammonia (HAA). Emersion during mating exposesanimals to elevated PCO2

. Buried animals experience minimal watercirculation, which could lead to the accumulation of wastes such asCO2 and ammonia, particularly for those that feed whilst buried(McGaw, 2005; Taylor et al., 1985). Thus, it is expected that L.polyphemus is equipped with effective mechanisms to avoidaccumulation of toxic ammonia and compensate for any acid–base disturbances caused by HAA and hypercapnia.Gills and gill-like structures act as the predominant excretory

organs of several aquatic ammonotelic species (Weihrauch et al.,2009; Wright and Wood, 2009), suggesting that the book gills of L.polyphemus play a major role in ammonia excretion. Five pairs ofbook gills can be found on the ventral side of the horseshoe crab(Fig. 1A) and each book gill comprises over 100 lamellae (Shuster,1982). An individual lamella consists of two single cell layered half-lamellae or epithelia (ventral and dorsal) separated by hemolymphspace and stabilized by pillar cells (Henry et al., 1996).Ultrastructural differences exist within a single lamella, where athick central mitochondria-rich area (CMRA) exists within the

ventral epithelium and is surrounded by thin peripheralmitochondria-poor areas (PMPAs; Henry et al., 1996; Fig. 1C).The CMRA has also been shown to possess extensive membraneinfoldings and higher NKA activity compared with the PMPA of theventral epithelium and the uniformly thin dorsal epithelium (Henryet al., 1996). Initially, such branchial traits may indicate the presenceof active ion transport, although its role in ammonia regulation is sofar unknown.

In this study, we aimed to gain basic knowledge of ammoniaand acid–base regulatory patterns in the marine chelicerateL. polyphemus and further explore differences in branchialregions (ventral versus dorsal half-lamellae; CMRA versusPMPA) at the tissue and molecular levels to predict the roles ofeach region in ammonia and acid–base regulation. HAA andhypercapnia are examples of environmental conditions that canaffect the animals’ nitrogen metabolism and ability to maintainacid–base homeostasis via changes in ammonia excretion,hemolymph carbonate system parameters and mRNA expressionlevels of genes putatively involved in regulating such physiologicalfactors. Therefore, we applied these treatments to investigate howL. polyphemus responds to such changes in seawater parameters incomparison with previously studied marine arthropods. Based onultrastructural differences between the various branchial regions, wepredict that the CMRA of the ventral epithelium is an important sitefor ammonia excretion and acid–base regulation, and that thisspecies can tolerate elevated ambient ammonia and CO2 becauseof its lifestyle as a burying species that likely encounters suchstressors in the wild.

MATERIALS AND METHODSAnimalsJuvenile American horseshoe crabs, Limulus polyphemus (carapacewidth=6–8 cm; mass=14–43 g), were acquired from an aquariumstore (Reefs2Go, Clearwater, FL, USA); male adults (carapacewidth=14–15 cm; mass=322–441 g) were captured by the WhitneyLaboratory for Marine Bioscience (St Augustine, FL, USA) fromthe Indian River Lagoon (FL, USA). Animals were maintained at22°C with a 12 h:12 h light:dark cycle in Animal Holding Facility(University of Manitoba, Winnipeg, MB, Canada), where amaximum of 10 animals were held in 1200 l tanks filled withartificial seawater (32 ppt; SeaChem Marine Salt, Madison, WI,USA) and equipped with external filters and a UV-sterilizationsystem. Horseshoe crabs were fed ad libitum daily with raw shelledshrimp, and a fine sand bed with crushed oyster shells was providedas substrate.

Experimental setup and analysis of seawater parametersDuring treatments under various seawater conditions, all animalswere maintained at 22°C and 32 ppt salinity. Six juveniles wereheld in a 70 l aquarium with a filter and air stone and threeadults were held in a 120 l aquarium at a time. The control treatmentaquarium was equipped with a custom-made degassing chamber(Terry Smith, University of Manitoba) to maximize aeration andsubsequently reduce seawater PCO2

. A full water change with freshseawater was conducted every 1–2 days. Water salinity andtemperature were analyzed daily; the former was measured with arefractometer. Ammonia concentration of aquarium water wasmeasured using an Orion 9512 ammonia gas sensing ISE electrode(Fisher Scientific, Ottawa, ON, Canada) with a pH/mV/temperature/ISE meter (Accumet Excel XL25, Fisher Scientific),following the protocol described by Weihrauch et al. (1998).The NH3-specific electrode can account for ±1 µmol l−1 in

A B

C

Fig. 1. Photographs ofLimulus polyphemus book gills. (A) The ventral sideof an adult male L. polyphemus (book gills are circled). (B) One book gillcomposed of over 100 lamellae (arrow). (C) A single intact gill lamella showingthe distinct central mitochondria-rich area (CMRA; white arrow) surrounded bythin peripheral mitochondria-poor areas (PMPAs; black arrows). Scale bardepicts 0.5 cm. ©Stephanie Hans.

2

RESEARCH ARTICLE Journal of Experimental Biology (2018) 221, jeb151894. doi:10.1242/jeb.151894

Journal

ofEx

perim

entalB

iology

the 4–50 µmol l−1 ammonia range and ±1.5 µmol l−1 in the50–200 µmol l−1 range (Quijada-Rodriguez et al., 2015; Weihrauchet al., 1998). To mathematically obtain the PCO2

, HCO3−

concentration ([HCO3−]) and total alkalinity of seawater, direct

measurements of the temperature and pH were taken using anAccumet pH/ATC electrode (Fisher Scientific) connected to a pH-ISE meter model 225 (Denver Instrument, Bohemia, NY, USA).Total carbon concentration (CT) was analyzed using a Corning 965TCO2

Analyzer (Corning Limited, Halstead, Essex, UK). The pH,salinity, CT and temperature of the sample were entered into theCO2SYS Excel add-in (Lewis and Wallace, 1998) to calculate thePCO2

, [HCO3−] and total alkalinity using the appropriate constants:

K1, K2 (Mehrbach et al., 1973) refitted by Dickson and Millero(1987), KHSO4 dissociation constant after Dickson (1990) andNBS scale (mol kg−1 H2O). Equations used by CO2SYS tocalculate total alkalinity incorporate several acid and base speciesfound in seawater and their respective dissociation products, such asH3PO4, H4SiO4, H3BO3, H2S, NH3, HF and HSO4

−, as describedby Eqn 2 (Dickson, 1981):

TA = ½HCO3�� þ 2½CO3

2�� þ ½B(OHÞ4��þ ½OH�� þ ½HPO4

2�� þ 2½PO43��

þ ½SiO(OHÞ3�� þ ½HS�� þ 2½S�þ ½NH3��½Hþ��½HSO4

���½HF��½H3PO4�;

ð2Þ

contributions of HS, S and NH3 are not included, as indicated byLewis andWallace (1998). Fugacity of CO2 (fCO2

; µatm) is related toCT and pH by the following equation (Eqn 3; Lewis and Wallace,1998):

fCO2¼ ½CO�

2�K0

¼CT

K0� ½H+� � ½H+�½H+� � ½H+�þK1�½H+�þK1�K2

; ð3Þ

where [CO2*] is the concentration of dissolved CO2, K0 is the

solubility coefficient of CO2 in seawater and K1 and K2 are the firstand second dissociation constants for carbonic acid in seawater. Theprogram assumes a pressure of approximately 1 atm and uses thisassumption to perform the conversion between partial pressure andfugacity (Lewis and Wallace, 1998).Seawater parameters of control conditions were as follows: pH of

8.07±0.02, PCO2of 64±3 Pa, [HCO3

−] of 2.3±0.1 mmol l−1, totalalkalinity of 2.7±0.1 mmol kg−1 seawater (SW) and ammoniaconcentration of 6.0±0.5 µmol l−1. Treatment of HAAwas achievedby enriching aquaria with NH4Cl to reach an average concentrationof 996.7±25.5 µmol l−1. A full water change was carried out every1–2 days with pre-equilibrated HAA seawater to minimizefluctuations in ammonia concentration. For the hypercapniatreatment, the IKS Aquastar (IKS ComputerSysteme GmbH,Karlsbad, Baden–Württemberg, Germany) provided continuouscontrol of CO2 injection to reach an average PCO2

of 311±9 Pa,which resulted in a pH of 7.44±0.01, an [HCO3

−] of 2.5±0.1 mmol l−1 and a total alkalinity of 2.7±0.1 mmol kg−1 SW. Afull water change was conducted every 1–2 days with pre-equilibrated high PCO2

seawater. Animals were starved for 2 daysprior to all experiments and hemolymph collection. All animalswere exposed to their respective conditions (control, HAA or highPCO2

) for 7–9 days.

Hemolymph parametersHemolymph was collected from the cardiac sinus of adults using a1 ml syringe and 21 gauge needle. Samples were immediately

centrifuged at 5000 g, and the supernatant was analyzed forpH, temperature and CT using the same methods employed forseawater samples (see above). Hemolymph PCO2

(Torr) and [HCO3−]

(mmol l−1) were then calculated using appropriate equations (Eqns 4,5) as well as αCO2

and pK1 values obtained from Truchot (1976):

PCO2¼ CT

10pH�pK1�aCO2

� �þaCO2

; ð4Þ

HCO3�½ �¼ 10pH�pK1�aCO2

�PCO2: ð5Þ

αCO2is the solubility coefficient for CO2 (mmol l−1 Torr−1) and pK1

is the first dissociation constant of carbonic acid. The remaininghemolymph sample was frozen at −20°C until analyzed forammonia concentration using the same method as previouslydescribed for tank water samples.

Whole-animal ammonia excretionAll whole-animal ammonia excretion experiments wereconducted at 22°C in 32 ppt salinity seawater with an air stone,and animals within containers were covered to reduce stress.Juveniles were placed in individual containers with 300 ml ofseawater (SeaChem Marine Salt) and an air stone. Water sampleswere taken hourly for 2 h. In order to rid the container of residualammonia from the previous period, seawater was gently siphonedout after each trial and the container was rinsed with freshseawater. The process was repeated once more prior to startingthe next time period. The ammonia excretion rate of control crabswas measured while they were in control (ammonia-free)seawater, then measured again after placing the animals inHAA seawater. Afterwards, the same animals were exposed toHAA for 7–9 days, after which the ammonia excretion rate wasdetermined in both control and HAA seawater. A different set ofanimals was exposed to hypercapnia for 7–9 days and theammonia excretion rate was only determined while animals werein high PCO2

seawater. All samples were frozen at −20°C andlater analyzed for ammonia concentration.

Na+/K+ (NH4+)-ATPase activity

Each individual sample consisted of pooled whole lamellaecollected from the anterior-most gill pair of three juveniles, for atotal of nine sampled animals. Determination of NKA activity andtotal protein concentration of the samples followed methodsdescribed for aquatic frogs (Cruz et al., 2013), with the exceptionof a higher ouabain concentration (5 mmol l−1) becauseinvertebrates have been shown to exhibit lower ouabain sensitivitythan vertebrates (Postel et al., 1998), and a doubling of pyruvatekinase and lactate dehydrogenase concentrations to ensure adequateenzyme availability. The NKA assay protocol was modified afterGibbs and Somero (1989) and McCormick (1993) using a UV-Visspectrophotometer (Agilent Technologies, Santa Clara, CA, USA)at 20°C. Gill samples (∼90 mg) were homogenized at 9000 rpm in14 volumes of cold SEID homogenization buffer (pH 7.0)composed of 150 mmol l−1 sucrose, 10 mmol l−1 EDTA,50 mmol l−1 imidazole and 0.1% (w/v) deoxycholate.Homogenates were centrifuged at 4°C for 1 min at 5000 g and thesupernatant of each sample was collected for subsequent enzymeassay and protein assay.

The enzyme reaction buffer (pH 7.5) included 10 mmol l−1 NaCl,5 mmol l−1 MgSO4, 50 mmol l−1 imidazole, 3 mmol l−1 ATPdisodium salt, 2 mmol l−1 phosphoenolpyruvate and 0.2 mmol l−1

NADH sodium salt. Pyruvate kinase was also added at 10 IU ml−1

as well as 8 IU ml−1 of lactate dehydrogenase. Either 10 mmol l−1

3

RESEARCH ARTICLE Journal of Experimental Biology (2018) 221, jeb151894. doi:10.1242/jeb.151894

Journal

ofEx

perim

entalB

iology

KCl or 10 mmol l−1 NH4Cl was provided as substrate, and NKAactivity was calculated as the difference in the rate of change inabsorbance at 340 nm in the absence (total ATPase activity) andpresence of 5 mmol l−1 ouabain. Each sample was measured intriplicate and NKA activity was calculated using the NADHextinction coefficient of 6.2 mmol l−1 cm−1. The protein concentrationof each sample was determined using the Pierce BCA proteinassay kit (Fisher Scientific) with bovine serum albumin used asstandard.

Experiments on split gill lamellaUssing chambers (EM-CSYS-6, Physiologic Instruments, SanDiego, CA, USA) were used to measure ammonia movementacross split gill lamellae of adult L. polyphemus when an ammoniagradient of ∼300 µmol l−1 (basolateral) to 0 µmol l−1 (apical),which is similar to what was observed in intact animals used in thisstudy, was applied (see Fig. 5A,C). For HAA-treated juvenileanimals, an inwardly directed ammonia gradient of ∼1000 µmol l−1

(apical) to ∼300 µmol l−1 (basolateral; as measured in hemolymphammonia of control animals) was used (see Fig. 5B,D). Lamellaewere collected from the left anterior-most gill and immediatelyplaced in chilled seawater. The thick chitinous edge of an individuallamella was held with fine forceps under a dissecting microscope,while a 21 gauge needle was inserted between the ventral and dorsalepithelia to separate the two half-lamellae. Another pair of fineforceps was inserted into the partially split area of the lamella andthen used to tease apart the two lamellar halves. The thick chitinousedge along each lamella was trimmed to ensure a tight seal withinthe tissue holders. In an intact animal, the dorsal half-lamella facesthe body and the ventral half-lamella faces away from the body (seedetailed diagram in Henry et al., 1996). A total of six dorsal and sixventral half-lamellae were collected from control animals, and ninedorsal and eight ventral half-lamellae were collected from HAA-treated animals.Each half-lamella was individually mounted on a custom-made

tissue holder (aperture: 0.25 cm2 for control animals, 0.16 cm2 forHAA animals), ensuring approximately equal surface area of thecentral and peripheral regions for all epithelia. All chambers weretemperature controlled to 22°C and half-chambers were filled witheither 4 ml (control tissues) or 3 ml (HAA-treated tissues) of theirrespective solution: artificial seawater for the apical side andphysiological saline for the basolateral side. The apical solution(pH 8.1) consisted of 430 mmol l−1 NaCl, 10 mmol l−1 CaCl2,37 mmol l−1 MgCl2, 10 mmol l−1 KCl and 2 mmol l−1 NaHCO3.For HAA-treated tissues, 1 mmol l−1 NH4Cl was also added to theapical solution. The composition of the physiological salinefollowed that of earlier studies (Robertson, 1970; Smith et al.,2002) and the measured [HCO3

−] of two non-acclimated animalsprior to any experiment. Physiological saline (pH 7.6) consisted of450 mmol l−1 NaCl, 11.8 mmol l−1 KCl, 9.9 mmol l−1 CaCl2,31.9 mmol l−1 MgCl2, 14.1 mmol l−1 MgSO4, 4.4 mmol l−1

NaHCO3, 3.2 mmol l−1 glucose and 0.3 mmol l−1 NH4Cl. Tissueswere allowed to equilibrate in the artificial solutions for 20 min;during this time, no parameters were measured. After incubation,chamber solutions were replaced with fresh solutions and allowed toincubate for either 2 h (control tissues) or 3 h (HAA-treated tissues),then a sample from each solution was collected. Each sample wasweighed to estimate its volume and frozen at −20°C until ammoniaanalysis.The proportions of [NH3] and [NH4

+] were determined using thesame equations as in Cameron and Heisler (1983); the pH and totalammonia (Tamm) of the baths were obtained at the beginning and end

of the experiment, and were used with the appropriate pKa value(9.45) according to salinity, temperature and pH (Bower andBidwell, 1978) to calculate [NH4

+] and [NH3] with the followingequations (Eqns 6, 7):

½NH4þ� ¼ Tamm

1 + antilog( pH� pKaÞ ; ð6Þ

½NH3� ¼ Tamm�½NH4þ�: ð7Þ

[NH3] was then used with the appropriate αNH3value

(0.3276 µmol mPa−1) to calculate the partial pressure of NH3 inmPa (Cameron and Heisler, 1983) using the following equation(Eqn 8):

PNH3¼ ½NH3�

aNH3

: ð8Þ

The transepithelial ammonia flux rate (Jamm,TE; nmol cm−2 h−1) foreach epithelium was calculated using the following equation(Eqn 9):

Jamm;TE ¼ ðC2 � C1Þ � V

SA� t; ð9Þ

where C2 and C1 are the final and initial ammonia concentrations(µmol l−1) of the bathing solution with an observed ammonia loss(apical or basolateral), V is the volume of sample collected from theUssing chamber (l), SA is the surface area of the gill epithelium(cm2) and t is the sampling period (h).

Using a rearrangement of Fick’s laws of diffusion, the expectedrate of ammonia flux can be calculated for the ion-leaky ventralepithelium, under the assumption that tissue permeability remainsunchanged, by determining the diffusion coefficient (D; ml h−1) forcontrol ventral epithelium using Eqn 10:

D ¼ Jamm;TE � SA

DC; ð10Þ

where Jamm,TE is the transepithelial ammonia efflux rate of controltissues (220.28±63.89 nmol cm−2 h−1), SA is the epithelial surfacearea (0.25 cm2) and ΔC is the ammonia concentration gradientbetween the initial apical and basolateral solutions of control tissues(305.94 µmol l−1 higher in the basolateral side). Once determined,the diffusion coefficient was used in conjunction with SA(0.16 cm2) and ΔC for HAA tissues (728.40 µmol l−1 higher inthe apical side) to obtain the predicted influx rate of819.45 nmol cm−2 h−1 across the ion-leaky ventral epithelium.

Rate of metabolic ammonia production by branchial tissue(Jamm,met; nmol cm−2 h−1) was determined as the rate of appearanceof excess ammonia in the bathing solution, which caused anincrease in total ammonia of the experimental system (Jamm,tot;nmol cm−2 h−1) that was not accounted for by transepithelialammonia flux (Jamm,TE) (Eqn 9):

Jamm;met ¼ Jamm;tot � Jamm;TE: ð11ÞElectrophysiological parameters (transepithelial potential

difference, PDTE; transepithelial conductance, GTE) of the ventraland dorsal half-lamellae were obtained by mounting half-lamellaein a custom-made Ussing chamber. Here, 0.18 cm2 of gillsurface was superfused from each side (apical and basolateral)with physiological saline by gravitational flow at a rate of12.5 ml min−1. In this series of experiments, only the centralregion of either the ventral (N=5) or dorsal epithelia (N=6) was used.Gill lamellae were collected from the right anterior-most gills and

4

RESEARCH ARTICLE Journal of Experimental Biology (2018) 221, jeb151894. doi:10.1242/jeb.151894

Journal

ofEx

perim

entalB

iology

split by the same methods as those used in ammonia transportmeasurements. Electrodes (Ag/AgCl) to measure voltage wereconnected via agar bridges (3% agarose in 3 mol l−1 KCl) to eachbath. Another set of Ag/AgCl electrodes were directly inserted intoeach half-chamber to pass current across the tissue for voltageclamping. All electrodes were connected to a VCC-600 voltage/current clamp (Physiologic Instruments, San Diego, CA, USA) anddata were collected with a Lab Trax 4/16 (World PrecisionInstruments, Sarasota, FL, USA). To measure PDTE, the tissuewas observed in open circuit, and to obtain GTE, the voltage wasclamped to 0 mV (short-circuit). Every 30 s, a current was passedacross the tissue that clamped the voltage to +1 mV and then to−1 mV for 2 s. The positive and negative currents to reach ±1 mVwere identical, indicating that the tissue had no rectifying properties.The conductance of the half-lamella was then calculated accordingto Ohm’s law from the measured currents and the voltage pulsesof 1 mV.

Quantitative real-time PCR (qPCR)Tissue samples used in qPCR consisted of two main groups:(1) branchial CMRA and PMPA, coxal gland and brain tissuesamples; and (2) the ventral and dorsal branchial epithelia fromcontrol, HAA-treated and hypercapnia-treated animals. Tissuesamples were collected from adult male horseshoe crabs. Animalswere anesthetized by placing them on ice for 30 min, then a∼15×4 cm hole was drilled along the dorsal carapace, stretchingfrom the lateral compound eyes to the midpoint of the opisthosoma,using a Dremel rotary tool with a cutting wheel attachment (RobertBosch Tool Corporation, Mt Prospect, IL, USA). Animals werekilled by removing the brain and dorsal nerve cord.All tissue samples were collected in Ambion RNAlater

Stabilization Solution (Fisher Scientific). Total RNA was isolatedin TRIzol (Fisher Scientific), homogenized and treated with DNase(Invitrogen DNase I Amplification Grade, Fisher Scientific). RNAsamples were tested for DNA contamination by PCR employing theL. polyphemus specific primers EF-1α F/R (Table 1). DNA-freeRNA samples were reverse transcribed into cDNA by qScriptcDNA synthesis kit (Quanta BioSciences, VWR, Radnor, PA,USA).Primers were designed based on published sequences of the

respective gene and the L. polyphemus genome (GenBank accessionno.: AZTN00000000.1), and tested for the presence of a singleamplicon of the correct product size using EconoTaq DNAPolymerase (VWR). PCR products were imaged with gelelectrophoresis, purified with E.Z.N.A. Gel Extraction Kit(Omega Bio-Tek, VWR) and sequenced at Robarts Research

Institute (London, ON, Canada). Products were confirmed to codefor target genes by searching the sequence on GenBank using theBLAST algorithm and ensuring a similar match to previouslypublished sequences as well as an exact match to the genome.

During qPCR, 10 µl assays were performed with SsoAdvancedUniversal SYBR Green Supermix (Bio-Rad Laboratories,Mississauga, ON, Canada) in a MiniOpticon real-timethermocycler (Bio-Rad Laboratories). A single PCR product wasverified through melt curve analysis. The results were logtransformed and threshold adjusted to optimize for reactionefficiency (88–100%) and correlation (>0.99). Relative transcriptabundance was determined according to the Pfaffl method (Pfaffl,2004), employing RNA Polymerase II (Pol2) as the internalstandard. Pol2 did not show a significant difference in transcriptabundance in any tissues and/or treatments (data not shown).

Statistical analysisAll data sets are presented as means±s.e.m. and, for all statisticaltests, a P-value of <0.05 was considered significant; changes withP-values between 0.05 and 0.1 are accompanied with the actual P-value and/or noted as having insufficient statistical power. All datasets were analyzed for outliers (Grubbs’ test), normality (Shapiro–Wilk test) and homogeneity of variance (Levene’s test) to determinewhether the data set was parametric. Parametric two-sample datasets were tested with either Student’s t-test or paired t-test, whereasparametric data sets with more than two means were analyzed usingone-way ANOVAwith post hoc Tukey’s pairwise comparisons. If adata set failed the Shapiro–Wilk and Levene’s tests, the data werelog transformed and the tests were repeated. Two-sample data setsthat were still non-parametric were treated with the Mann–WhitneyU-test, and Kruskal–Wallis test with post hoc Mann–Whitneypairwise comparisons were performed on data sets with more thantwo means. All statistical analyses were carried out using thePaleontological Statistics (PAST) software (https://folk.uio.no/ohammer/past/; Hammer et al., 2001).

RESULTSNa+/K+ (NH4

+)-ATPase activityFor verification of the involvement of NKA, the activity of thisenzyme isolated from the gills was measured, using either K+ orNH4

+ as the substrate. With K+, NKA activity of whole-gillhomogenate was 17.0±0.9 nmol ADP min−1 mg−1 protein. WhenK+ was replaced by NH4

+ in this assay, the activity was significantlylowered (∼21%) to 13.4±0.7 nmol ADP min−1 mg−1 protein(N=3 pooled samples from a total of nine individuals, data notshown).

Table 1. Primer sequences used in qPCR

Transcript GenBank accession no. Forward primer sequence Reverse primer sequenceAmpliconsize (bp)

Annealingtemp.(°C)

NKA XM_013930336.1 CTAGGTGGACTTGGAGAGCG CCCACCAAACGCATATTACC 128 58HAT XM_013927166.1 CTGAATTCCTGGCCTACCAA TCACGTGCAGCTGATACCTC 100 58LpRh-1 XM_013920039.1 TGGTTTCATCTCGGTTATGGG AGCTGTAACCGTAGTTGTCTTC 173 58LpRh-2 XM_013917394.1 CCCTGTTCAATTGGTTGTGATG GGTCTTTAGAGGGATCCTGAAG 190 58CA-2 XM_013917846.1 ACTTACCACCCCTCCCTGTT CCCTATCACCTATCGGCAAA 191 58HCN XM_013918260.1 TCACTTGTTGCGTCAGTTCC TCCGTCAGACAGACTTGTGG 207 58Pol2 XM_013929629.1 TCGTTTGGAGCACACAACTT GAGAGATCCTTGTGGGGTCA 149 58EF-1α XM_013928278.1 GGCTACAATCCTGCCACTGT GTTTGACCCTTGCGTTCAAT 122 58

Primers are given in the 5′ to 3′ direction. Na+/K+-ATPase α-subunit (NKA), V-type H+-ATPase subunit B (HAT), Rhesus-protein 1 (LpRh-1), Rhesus-protein 2(LpRh-2), cytoplasmic carbonic anhydrase (CA-2), hyperpolarization-activated cyclic nucleotide-gated K+ channel (HCN) and RNA polymerase II (Pol2) wereemployed in quantitative real-time PCR (qPCR) analyses, whereas elongation factor-1α (EF-1α) was only used to test RNA purity (see Materials and methods).

5

RESEARCH ARTICLE Journal of Experimental Biology (2018) 221, jeb151894. doi:10.1242/jeb.151894

Journal

ofEx

perim

entalB

iology

mRNA transcript levels across tissues and within gilllamellaeTo identify the animal’s main site of ammonia excretion, the mRNAtranscript abundance of putatively key genes in this process wasassessed in the coxal gland, the CMRA and PMPA of the gill(Fig. 1C), and brain tissue (Fig. 2). Although both Rh-proteinisoforms exhibited the highest abundance in gill tissues, significantdifferential patterns emerged between the two isoforms: Rhesus-protein 1 (LpRh-1) expression in the CMRA was 20-fold higherthan that in the PMPA, whereas Rhesus-protein 2 (LpRh-2) showedover 2-fold higher transcript level in the PMPA than in the CMRA.In contrast to Rh-protein expression patterns, NKA abundance wasuniform across the CMRA, PMPA and coxal gland, but wassignificantly lower in the brain. Hyperpolarization-activated cyclicnucleotide-gated K+ channel (HCN) expression in the CMRA didnot significantly differ from that in the PMPA, but expression in thebrain was significantly higher than that in other investigated tissues.High transcript levels of Rh-proteins indicated the gills’ central role

in ammonia excretion; therefore, only the branchial regions wereanalyzed for mRNA transcript levels of the following genes.Cytoplasmic carbonic anhydrase (CA-2) expression level relative toPol2 was significantly higher (11-fold) in the CMRA (175.7±18.2;N=5) than in thePMPA(15.9±3.8;N=6).No significant differencewasobserved for HAT, for which expression levels relative to Pol2 were75.7±10.4 in the CMRA (N=6) and 60.8±9.1 in the PMPA (N=6).As a rough comparison of overall abundance of each gene relative

to Pol2, the relative mRNA transcript levels in the CMRA of the gillwere as follows: NKA 188.7±26.8, CA-2 175.7±18.2, HAT 75.7±10.4, LpRh-1 56.0±9.7, LpRh-2 1.0±0.2 and HCN 0.6±0.2.

Ventral versus dorsal branchial half-lamellaeTo clarify the ammonia transport function of the book gills in L.polyphemus, a preparation of the split gill lamella was employed tofurther characterize both the ventral and dorsal half-lamellae.

Mounting each half-lamella in an Ussing chamber allowed theobservation of lamellar properties relevant to ion transport,including GTE, PDTE and transepithelial ammonia fluxes. Anoticeable difference in GTE of the two half-lamellae wasobserved, where the dorsal half-lamella had significantly lowerGTE (0.20±0.04 mS cm−2; N=6) than the ventral half-lamella(145.40±33.95 mS cm−2; N=5) (Fig. 3B). The PDTE was zero forboth the ventral (N=5) and the dorsal (N=6) half-lamellae.

When an ammonia gradient mimicking in vivo conditions (noammonia on apical side, ∼300 µmol l−1 ammonia on basolateralside) was applied over the half-lamella, transepithelial ammoniaefflux (Jamm,TE) at a rate of 220.28±63.89 nmol cm−2 h−1 wasobserved across the ventral epithelium, as calculated by the lossof ammonia in the basolateral solution, but no net efflux wasdetected across the dorsal epithelium (Fig. 6A). The ventralhalf-lamella generated metabolic ammonia at a rate of83.54±40.80 nmol cm−2 h−1 released towards the apical side, butit is important to note the possibility of ammonia release towards thebasolateral side and/or tissue decomposition. Interestingly, despitethe low conductance and lack of transepithelial ammonia flux for thecentral region of the dorsal half-lamella, this tissue still producedmetabolic ammonia. Of this, 98.50±18.30 nmol cm−2 h−1 wasreleased towards the apical side and 34.03±17.73 nmol cm−2 h−1

towards the basolateral side (Fig. 6B).Differences between branchial regions were also observed at the

molecular level. Compared with the dorsal half-lamella, the ventralhalf-lamella exhibited significantly (at least 2-fold) higher relativegene expression of LpRh-1, CA-2 and HCN, but the oppositepattern was detected for LpRh-2 (Fig. 3A).

Effects of HAA treatmentJuvenile and adult L. polyphemus were exposed to 997 µmol l−1

NH4Cl to observe the effects of short-term (7–9 days) HAAtreatment on the animals’ hemolymph parameters, ammonia

0

0.5

1.0

1.5

2.0

a a

a

b

Fold

-diff

eren

ce in

rela

tive

trans

crip

t abu

ndan

ce

C

0

0.2

0.4

0.6

0.8

1.0

1.2

1.4a

b

c

B

c

0

0.5

1.0

1.5

20

25 A

PMPA CMRA Coxal Brain PMPA CMRA Coxal Brain

PMPA CMRA Coxal BrainPMPA CMRA Coxal Brain

b

b

a

c

0

2

4

40

42

b

b

c

aD

6

38

Fig. 2. Relative gene expression levels in thecoxal gland, brain, and the CMRA and PMPAof gills. (A) Rhesus-protein 1 (LpRh-1),(B) Rhesus-protein 2 (LpRh-2), (C) Na+/K+-ATPase α-subunit (NKA) and (D)hyperpolarization-activated cyclic nucleotide-gated K+ channel (HCN) levels in adultL. polyphemus. All transcript levels are relative toRNA polymerase II, and the values for theCMRA, coxal gland and brain are shown as afold-difference of the PMPA (which is set to 1.0).Data represent means±s.e.m. Significantdifferences between tissues of an individual geneare indicated by lowercase letters (Kruskal–Wallis test with post hocMann–Whitney pairwisecomparison; P<0.05; N=5–6).

6

RESEARCH ARTICLE Journal of Experimental Biology (2018) 221, jeb151894. doi:10.1242/jeb.151894

Journal

ofEx

perim

entalB

iology

excretion rates and mRNA transcript levels of genes related toammonia homeostasis. Hemolymph pH averaged 7.59±0.04 incontrol adults and slightly decreased to 7.47±0.05 when exposed toHAA (P=0.09; Table 2). Hemolymph PCO2

(164.1±24.3 Pa) and[HCO3

−] (2.47±0.41 mmol l−1) of control adults significantlyincreased to 346.9±51.8 Pa and 3.95±0.34 mmol l−1, respectively,following HAA treatment. No difference was found in hemolymphammonia concentration between control animals (320.8±36.9 µmol l−1) and HAA-exposed animals (334.0±28.3 µmol l−1).Control juveniles excreted ammonia at a rate of 298.0±

31.7 nmol g−1 fresh mass h−1 when placed in ammonia-freeseawater, but exhibited significantly pronounced uptake ofammonia at a rate of 2393.3±924.4 nmol g−1 fresh mass h−1

immediately after being placed in HAA seawater (1000 µmol l−1

NH4Cl; Fig. 4A). However, following a 7–9 day treatment of997 µmol l−1 NH4Cl seawater (average tank ammonia concentrationduring the treatment period), animals excreted ammonia at a rate of331.6±55.7 nmol g−1 fresh mass h−1 in HAA seawater (Fig. 4B),similar to the excretion rate of control animals in ammonia-freeseawater. When reintroduced to ammonia-free seawater, HAA-treated animals excreted ammonia at a rate of 733.0±99.6 nmol g−1 fresh mass h−1, which was significantly higherthan the excretion rate of control animals in ammonia-free seawater.Split gill lamella experiments (Fig. 6A) revealed that ventral

epithelium from HAA-treated animals exhibited an ammonia influx

of 311.38±58.77 nmol cm−2 h−1 to the basolateral side, which issignificantly different from the net efflux of 220.28±63.89 nmol cm−2 h−1 observed in the control epithelium.Although ammonia entered the branchial lamellae via the ventralepithelium, ammonia was excreted against its PNH3

and NH4+

gradients via the dorsal epithelium at a rate of 61.89±24.47 nmol cm−2 h−1, whereas, in contrast, the epithelium ofcontrol animals showed no transepithelial transport. Of themetabolically produced ammonia, 37.41±80.68 nmol cm−2 h−1

was released towards the basolateral side for the ventral epitheliumand 75.85±49.57 nmol cm−2 h−1 was released towards the apicalside for the dorsal epithelium; these values were not significantlydifferent from those in control tissues (Fig. 6B).

HAA treatment also induced significant changes in branchialgene expression levels. Following HAA treatment, the relativemRNA transcript levels of CA-2 and HCN in the ventral half-lamella nearly doubled, accompanied by a 1.4-fold increase in HATexpression (Fig. 7A). In the dorsal half-lamella, HAA treatment

0

0.5

1.0

1.5

2.0

2.5

3.0

NKA HAT CA-2 HCN LpRh-2 LpRh-1

Fold

-diff

eren

ce in

rela

tive

trans

crip

t abu

ndan

ce

*

*

* *

Ventral half-lamellaDorsal half-lamella

A

Ventral Dorsal

B

GTE

(mS

cm

–2)

200180160140120100

8060400.2

0

*

Fig. 3. Differences in relative mRNA transcript levels between the ventral and dorsal gill epithelia. (A) Relative transcript abundance of genes putativelyinvolved in ammonia and/or acid–base regulation and (B) transepithelial conductance (GTE). NKA (N=11–12), H+-ATPase subunit B (HAT; N=11), cytoplasmiccarbonic anhydrase (CA-2; N=9–12), HCN (N=11–12), LpRh-2 (N=12) and LpRh-1 (N=9–12) transcript abundances were standardized to that of RNApolymerase II for adult L. polyphemus. The values for the dorsal half-lamella are shown as a fold-difference of the ventral half-lamella (which is set to 1.0).GTE wasdetermined for the central region of each half-lamella (N=5–6). Data represent means±s.e.m. Asterisks denote significant differences in relative gene expressionor GTE between ventral and dorsal epithelia (two-tailed Mann–Whitney test; P<0.05).

Table 2. Hemolymph parameters of adult Limulus polyphemusfollowing a 7–9 day exposure to control, high ambient ammonia (HAA;997 μmol l−1 NH4Cl) or high PCO2 (311 Pa, pH 7.4) seawater

ParameterControlanimals HAA animals

High PCO2

animals

pH 7.59±0.04 7.47±0.05(P=0.09)

7.62±0.05

PCO2 (Pa) 164.1±24.3 346.9±51.8* 301.7±33.7*[HCO3

−] (mmol l−1) 2.47±0.41 3.95±0.34* 5.32±0.20*Ammonia concentration(µmol l−1)

320.8±36.9 334.0±28.3 183.8±19.6*

Data represent means±s.e.m. Asterisks denote significant differences fromcontrol values (log transformation and two-tailed t-test for PCO2 comparisonbetween control and HAA animals; two-tailed t-test for all other comparisons;P<0.05; N=5–6). P-value is given for any parameter that may appear to besignificant compared with the control value but lacks sufficient statistical power.

–4000

–3000

–2000

–1000

0

1000

Who

le-a

nim

al a

mm

onia

excr

etio

n ra

te (n

mol

g–1

fres

h m

ass

h–1 ) A

*0

100

200

300

400

500

600

700

800

900

1000 B

*

Ammonia-freeseawater

HAA seawater

Fig. 4. Whole-animal ammonia excretion by juvenile L. polyphemusfollowing a 7–9 day treatment in control or high ambient ammonia (HAA)seawater. Animals from each treatment were exposed to ammonia-free water(6 µmol l−1 total ammonia; A) and HAAwater (997 µmol l−1 NH4Cl; B), and theammonia excretion rates were determined. Data represent means±s.e.m.Asterisks denote significant differences in excretion rate between animalsplaced in ammonia-free seawater and HAA seawater within each treatmentperiod (Kruskal–Wallis test with post hocMann–Whitney pairwise comparison;P<0.05; N=5 for HAA animals in ammonia-free seawater; N=6 for all othercomparisons).

7

RESEARCH ARTICLE Journal of Experimental Biology (2018) 221, jeb151894. doi:10.1242/jeb.151894

Journal

ofEx

perim

entalB

iology

roughly doubled and tripled the transcript levels of CA-2 andLpRh-1, respectively (Fig. 7B).

Effects of high PCO2 treatmentA 7–9 day exposure to elevated PCO2

(311 Pa) induced significantincreases of nearly 2-fold in hemolymph PCO2

(301.7±33.7 Pa) and2-fold in [HCO3

−] (5.32±0.20 mmol l−1; Table 2). However, therewas no change in hemolymph pH in high PCO2

-treated animals(pH 7.62±0.05). Simultaneously, both hemolymph ammoniaconcentration (183.8±19.6 µmol l−1; Table 2) and whole-animalammonia excretion rate (170.2±40.3 nmol g−1 fresh mass h−1;N=5)of hypercapnia-treated animals significantly decreased by 43%compared with those of control animals. Out of all investigatedgenes, hypercapnia treatment only significantly elevated the relativegene expression level of HAT in the ventral half-lamella (Fig. 8A).

DISCUSSIONIn this study, we provide evidence that the exposed and well-ventilated book gills of L. polyphemus excrete ammonia (Fig. 6A,B).As outlined in the Introduction, horseshoe crab book gills exhibitdistinct regions: a CMRA and a PMPA (Fig. 1C). This is remarkablein itself as these morphological differences have so far only beenfound in the gills of osmoregulating crustaceans such as Carcinusmaenas (Goodman and Cavey, 1990), but not in the gills ofosmoconforming invertebrates. The presence of branchial CMRA inosmoconforming L. polyphemus suggests a non-osmoregulatoryyet energy-requiring function, and is likely related to acid–base

regulation and/or ammonia excretion. A specialized function ofCMRA in acid–base regulation/ammonia excretion is supported bysignificantly higher gene expression levels of CA-2, HCN and LpRh-1 in the CMRA than in the PMPA (Fig. 2A,D), with all three genesknown to be involved in either of these related processes in otherinvertebrates (Adlimoghaddam et al., 2015; Fehsenfeld andWeihrauch, 2013, 2016a,b; Martin et al., 2011; Quijada-Rodriguezet al., 2015; Weihrauch et al., 2012). Although mRNA transcriptlevels for NKA were not particularly high in the CMRA comparedwith levels in the PMPA and coxal gland, the branchial NKA couldaccept NH4

+ as substrate; in addition, Henry et al. (1996) confirmedhigh specific activities of this enzyme, indicating post-transcriptionalregulation of the pump.

Both LpRh-1 and LpRh-2 displayed particularly highexpression in branchial tissues compared with that in the coxalgland and brain (Fig. 2A,B), a pattern previously observed forRhcg1 and Rhcg2 in fish (Nawata et al., 2007), as well as themarine Dungeness crab, Metacarcinus magister, Rh-protein(Martin et al., 2011). In contrast, the Rhbg isoform in fish showsa rather uniform expression among tissues (Nawata et al., 2007).Interestingly, although LpRh-1 showed high transcript levels inthe CMRA, LpRh-2 mRNA abundance was higher in the PMPA,indicating distinct functions of the two isoforms. However,significant quantitative PCR results should be interpreted as anindication of the protein’s importance rather than a directassumption of actual protein abundance, because mRNAexpression does not always correlate with protein tissue

Dorsal half-lamella

Ventral half-lamella

Control animals

C

Ventral half-lamella

HAA-treated animals

Initialt=0 h

Finalt=2 h

9.03±0.78

0.38±0.04

8.07±0.01

9.41±0.82

0.00±0.00 301.68±2.62

309.32±4.07

8.28±0.00

19.66±0.20

289.67±3.89

0.00±0.00

8.10±0.00

0.00±0.00 305.94±2.66

7.60±0.00

4.26±0.04

Dorsal half-lamellaD

998.05±9.66

35.10±1.51

7.99±0.02

1033.15±8.63

967.40±5.48 269.48±2.93

262.18±4.18

8.25±0.02

15.79±0.88

246.39±3.48

43.21±0.24

8.10±0.00

1010.61±5.72 273.29±2.97

7.60±0.00

3.81±0.04

Apical(seawater)

Basolateral(Ringer's)Epithelium

Apical(seawater)

Basolateral(Ringer's)Epithelium

Apical(seawater)

Basolateral(Ringer's)Epithelium

Apical(seawater)

Basolateral(Ringer's)Epithelium

A

Initialt=0 h

Finalt=2 h

pH

[NH4+] (µmol l–1)

Tamm (µmol l–1)

pH

[NH3] (µmol l–1)

[NH4+] (µmol l–1)

Tamm (µmol l–1)

pH

[NH3] (µmol l–1)

[NH4+] (µmol l–1)

Tamm (µmol l–1)

pH

[NH3] (µmol l–1)

[NH4+] (µmol l–1)

Tamm (µmol l–1)

pH

[NH3] (µmol l–1)

[NH4+] (µmol l–1)

Tamm (µmol l–1)

pH

[NH3] (µmol l–1)

[NH4+] (µmol l–1)

Tamm (µmol l–1)

[NH3] (µmol l–1)

pH

[NH4+] (µmol l–1)

Tamm (µmol l–1)

[NH3] (µmol l–1)

pH

[NH4+] (µmol l–1)

Tamm (µmol l–1)

[NH3] (µmol l–1)

27.24±4.91

1.14±0.19

8.08±0.01

28.38±5.09

0.00±0.00 301.68±2.62

284.65±4.75

8.27±0.01

17.77±0.30

266.88±4.55

0.00±0.00

8.10±0.00

0.00±0.00 305.94±2.66

7.60±0.00

4.26±0.04

B

Initialt=0 h

Finalt=3 h

Initialt=0 h

Finalt=3 h

915.38±10.40

35.21±1.50

8.03±0.02

950.58±9.83

962.24±5.39 272.97±2.20

336.66±2.15

8.28±0.02

21.56±0.93

315.10±2.51

42.98±0.24

8.10±0.00

1005.22±5.63 276.82±2.23

7.60±0.00

3.86±0.03

Fig. 5. Schematic diagram of bathing solution parameters used during Ussing chamber experiments with ventral and dorsal epithelia of control andHAA-treated L. polyphemus. The apical solution consisted of artificial seawater whereas the basolateral solution consisted of physiological saline. Alltissues collected from control adults (A,C) were exposed to a basolateral-to-apical directed ammonia gradient, whereas all tissues collected from HAA-treatedjuveniles (B,D) were exposed to an apical-to-basolateral directed ammonia gradient. The calculated proportions of each ammonia species (NH3 and NH4

+) basedon pH, pKa, αNH3 and total ammonia (Tamm) are shown for the beginning (t=0 h) and the end of the experiment (t=2 h for control; t=3 h for HAA).

8

RESEARCH ARTICLE Journal of Experimental Biology (2018) 221, jeb151894. doi:10.1242/jeb.151894

Journal

ofEx

perim

entalB

iology

abundance or enzyme activity, as post-translational processescould affect the final abundance and/or activity of the protein.In addition to differences between the CMRA and PMPA, flux

experiments on split half-lamellae revealed fundamental differencesin ammonia transport rates and GTE between the ventral and dorsalhalf-lamellae (Figs 3B and 6A). Considering that L. polyphemus is amarine species, the dorsal half-lamella exhibited, very atypically,low conductance compared with, for instance, the GTE measured innon-ion transporting exopodites of the brackish water-acclimatedisopod Idotea baltica (GTE≈14 mS cm–2; Postel et al., 2000) orepithelia from freshwater organisms, such as the gill epithelia ofred crab Dilocarcinus pagei (GTE≈4 mS cm–2; Onken andMcNamara, 2002) and Chinese mitten crabs, Eriocheir sinensis(GTE≈4 mS cm–2; Weihrauch et al., 1999). It is notable that whilethis ion-tight half-lamella did not promote transepithelial ammoniatransport, metabolic ammonia was still released towards theenvironment, indicating an existing pathway for gaseous NH3.Metabolic ammonia could also have formed as a result of tissuedecomposition.The ventral half-lamella is responsible for transbranchial

ammonia excretion, and exhibited high GTE as expected for thegill of a marine arthropod (Fig. 3B; Freire et al., 2008; Weihrauchet al., 1999). The measured ammonia efflux in an outwardly

directed gradient (∼300:0 μmol l−1) was comparable with fluxesmeasured under the same applied gradient in the perfused gill of thegreen crab C. maenas (Weihrauch et al., 1998), where the flux was∼202 nmol g−1 fresh mass h−1. The importance of the ventral half-lamella in ammonia transport and acid–base regulation was alsoevident from the high transcript levels of LpRh-1 and HCN(Fig. 3A; Carrisoza-Gaytán et al., 2011; Fehsenfeld andWeihrauch, 2016b), and of CA-2, one of the general key playersin transepithelial CO2 transport and ammonia excretion(Fehsenfeld and Weihrauch, 2016a; Gilmour, 2012; Wright andWood, 2009).

Book gill lamellae are positioned in a fashion that may causeexcreted waste products of a lamella’s ventral epithelium to bereleased on to the dorsal epithelium of adjacent lamellae. This wastemay accumulate when the branchial tissue is at rest, and thus is not‘flapping’ (Vosatka, 1970); backflow of waste could become anissue, particularly in a tissue that is ‘ion-leaky’, rendering wasteexcretory processes a semi-futile cycle. Functionally different half-lamellae within the same gill could minimize backflow diffusionand mitigate wasteful excretion. This is perhaps especiallybeneficial during periods of impaired waste excretion. Forexample, during air exposure, the thin gill lamellae are likelydifficult to keep apart in the absence of water. Therefore, the low

–150

–100

–50

0

50

100

150

–500

–400

–300

–200

–100

0

100

200

300

400

Control HAA Control HAA

Ventral half-lamella Dorsal half-lamella

J am

m,T

E (n

mol

cm

–2 h

–1)

A

J am

m,m

et (n

mol

cm

–2 h

–1)

B

*

–160

–120

–80

–40

0

40

80 C

Control half-lamellae HAA half-lamellae

InitialFinal

PN

H3 gr

adie

nt (m

Pa)

Ventral Dorsal Ventral Dorsal

*

‡

‡

Fig. 6. Ammonia movement across split gill lamellae of control and HAA-treated L. polyphemus. (A) Transepithelial ammonia flux (Jamm,TE) and(B) metabolic ammonia release (Jamm,met) of ventral and dorsal half-lamellae under (C) different partial pressure of NH3 (PNH3) gradients. Tissues were exposed toartificial seawater on the apical side and physiological saline on the basolateral side (see Fig. 5 for pH and ammonia parameters). A positive rate indicatesan efflux of ammonia towards the apical side whereas a negative rate indicates an influx of ammonia towards the basolateral side. A positive PNH3 gradient is anoutwardly directed NH3 gradient (basolateral to apical) whereas a negative PNH3 gradient is an inwardly directed NH3 gradient (apical to basolateral). Alltissues collected from control adults were exposed to an apically directed ammonia gradient, whereas all tissues collected from HAA-treated juveniles wereexposed to seawater containing approximately 1000 μmol l−1 ammonium chloride, inducing a basolaterally directed ammonia gradient. The initial (t=0 h) and final(t=2 h for control; t=3 h for HAA) PNH3

gradients are shown. Data represent means±s.e.m. N=6 for control tissues, N=8–9 for HAA tissues. Asterisks denotesignificant differences in Jamm,TE of the dorsal epithelium compared with that of the ventral epithelium within the respective treatment (control or HAA; two-tailedt-test; P<0.05). A significant difference in Jamm,TE of HAA-treated epithelium compared with that of control tissues within the respective type of epithelium isdenoted by ‡ (ventral or dorsal; two-tailed Mann–Whitney test; P<0.05).

9

RESEARCH ARTICLE Journal of Experimental Biology (2018) 221, jeb151894. doi:10.1242/jeb.151894

Journal

ofEx

perim

entalB

iology

conductive properties of the dorsal epithelium can serve as a barrierto ionic waste products such as NH4

+. Evidence for this is providedby the observed ammonia flux patterns of tissues from HAA-treatedanimals, but understanding the way in which water flows over thelamellae of the book gills would be useful information to furthersuch a hypothesis.

HAAWhen foraging or in hiding, horseshoe crabs often bury themselveswithin the sediment (Shuster, 1982). Under such conditions ofreduced branchial ventilation and limited water exchange, theconcentration of ammonia in the immediate vicinity of the animalmay substantially increase from both the animal’s own metabolismand the reduced bacterial nitrification due to hypoxia (Weihrauch,1999; Widdicombe et al., 2016). Similar potential impairment inammonia excretion can also occur when sexually mature adultsgatheron beaches tomate,where subsequent air exposure of upwardsof 4 h (Shuster and Botton, 1985) may slow or halt the excretion ofsuch water-soluble waste products until the animals return to sea.These natural challenges may help explain why horseshoe crabsseemingly cope rather well with impairments in ammonia excretion.Although a massive ammonia influx occurred after an acute

exposure to HAA, excretion rates recovered to control values whenanimals were exposed to the new conditions for 7–9 days (Fig. 4).The lack of change in hemolymph ammonia levels following aprolonged HAA exposure (Table 2) indicates the animals’ capacity

to excrete this toxic waste product under the new conditions of a∼3-fold inwardly directed gradient. A physiological state of enhancedexcretion was also evident through a doubling of ammonia excretionrates when animals were placed in ammonia-free seawater, althoughhemolymph parameters indicated a slight respiratory acidosis(Table 2).

Split gill lamella experiments showed that in the ventral half-lamella of HAA-treated animals, an ammonia influx of 311.38±58.77 nmol cm−2 h−1 (Fig. 6A) occurred likely as a result of thetissue’s high ion conductance. However, the actual measured influxrate was well below the predicted level of 819.45 nmol cm−2 h−1, asdetermined through a rearrangement of Fick’s laws of diffusion (seeEqn 8), across the ion-leaky ventral epithelium, indicating that theventral epithelium partially counteracted the ammonia influx(Fig. 6A). This ability may be facilitated by elevated mRNAtranscript levels of HCN, CA-2 and HAT (Fig. 7A), a pump thatgenerates a transmembrane H+ gradient and often works in liaisonwith the H+-providing cytoplasmic CA-2, which can create a partialpressure gradient for NH3 as it continues to react with H+ to formNH4

+ on one side of the membrane. NH4+ can be trapped within

vesicles either for an exocytosis-mediated excretion, as seen in thegreen crab C. maenas (Weihrauch et al., 2002), or for apicalammonia trapping when apically localized in epithelial cells, whichis often observed in animals living in low-buffered freshwaterhabitats and is less likely to occur in the highly buffered seawaterenvironment (Larsen et al., 2014).

0

1

2

3

4

NKA HAT CA-2 HCN LpRh-2 LpRh-1

P=0.09

*

A

* *

0

1

2

3

4

NKA HAT CA-2 HCN LpRh-2 LpRh-1

B

Fold

-cha

nge

in re

lativ

e tra

nscr

ipt a

bund

ance

* *

Fig. 7. Effect of HAA treatment on mRNA transcript levels of genesputatively involved in ammonia and/or acid–base regulation. The mRNAtranscript levels of NKA, HAT, CA-2, HCN, LpRh-2 and LpRh-1 in the (A)ventral and (B) dorsal epithelia of HAA-treated adult L. polyphemus arepresented as fold-change compared with those of control animals (graydashed line). All transcript levels are relative to RNA polymerase II. Datarepresent means±s.e.m. Asterisks denote significant differences in relativemRNA expression between control (6 μmol l−1 total ammonia) and HAA(997 μmol l−1 NH4Cl) animals (two-tailed t-test; P<0.05; N=5–6). P-values aregiven for any comparison that may visually appear to be significant but lackssufficient statistical power.

0

0.5

1.0

1.5

2.0

NKA HAT CA-2 HCN LpRh-2 LpRh-1

B

Fold

-cha

nge

in re

lativ

e tra

nscr

ipt a

bund

ance

0

0.5

1.0

1.5

2.0

NKA HAT CA-2 HCN LpRh-2 LpRh-1

*

A

Fig. 8. Effect of hypercapnia treatment on mRNA transcript levels ofgenes putatively involved in ammonia and/or acid–base regulation. ThemRNA transcript levels of NKA, HAT, CA-2, HCN, LpRh-2 and LpRh-1 in the(A) ventral and (B) dorsal epithelia of hypercapnia-exposed adult L.polyphemus are presented as fold-change compared with those of controlanimals (gray dashed line). All transcript levels are relative to RNA polymeraseII. Data represent means±s.e.m. Asterisks denote significant differences inrelative mRNA expression between control (64 Pa) and high PCO2 (311 Pa)-exposed animals (two-tailed t-test; P<0.05; N=5–6).

10

RESEARCH ARTICLE Journal of Experimental Biology (2018) 221, jeb151894. doi:10.1242/jeb.151894

Journal

ofEx

perim

entalB

iology

Although ammonia influx can occur via the ventral epithelium inHAA, ammonia was excreted against its PNH3

and NH4+ gradients

via its dorsal counterpart. Dorsal half-lamellae from HAA-treatedanimals were capable of maintaining near-control basolateralammonia levels (∼300 µmol l−1) against a 3-fold inwardlydirected ammonia gradient and even possessed the capacity forsome degree of apically directed, possibly active, NH4

+

excretion (Fig. 6A). This is likely facilitated by the dorsalepithelium’s ion-tight properties prohibiting NH4

+ movement, aswell as an increase in LpRh-1 and CA-2 mRNA abundance (3-foldand 2-fold, respectively; Fig. 7B). This may indicate a difference inthe role of LpRh-1 in the two half-lamellae, given that in controlanimals LpRh-1 expression was higher in the ventral epitheliumthan in its dorsal counterpart (Fig. 3A), yet its expression onlyresponded to HAA acclimation in the dorsal epithelium (Fig. 7B).The functional difference between the half-lamellae could be

useful in minimizing ammonia influx during periods of elevatedambient ammonia. However, despite the dorsal epithelium’scapacity to excrete ammonia against an inwardly directedgradient, it did not adequately counteract the influx observed inthe ventral epithelium. Perhaps another organ, such as the coxalgland, contributes to such processes under HAA stress. Unlike thegills, the coxal gland is not directly exposed to the environment andits potentially high ammonia levels; in addition, the gland has levelsof NKA comparable to those of the gills (Fig. 2C) and the activity ofNKA has been observed to surpass that of the central gill regions(Henry et al., 1996; Towle et al., 1982), indicating the tissue’spotential for active NH4

+ transport. Previous studies have alsoindicated that the urine of L. polyphemus is acidic (pH 6.85) andrich in ammonia (ca. 650 μmol l−1) compared with the animals’native hemolymph status (Mangum et al., 1976), which is indicativeof an ammonia excretory organ. Further investigation is required todetermine the functional role of the coxal gland in ammoniaexcretory processes and how it responds to HAA.

HypercapniaHorseshoe crabs may encounter elevated environmental PCO2

in theirnatural environmentswhen buried, as a result of poorwater circulation(McGaw, 2005; Taylor et al., 1985), or when emersed, as occursduring reproduction (Rudloe, 1980), which could affect acid–basestatus. When animals were exposed to hypercapnia for 7–9 days, thehemolymph carbonate system adjusted to a new steady-state level,characterized by elevated PCO2

levels and [HCO3−] while pH

remained unaffected (Table 2). An identical response was observedin the marine Dungeness crab, M. magister, under comparableconditions (Hans et al., 2014), with the predicted purpose of ensuringcontinued CO2 diffusion out of the body along its partial pressuregradient (Melzner et al., 2009). Increased hemolymph [HCO3

−] mayhave occurred as a means of counteracting a resulting acidification ofthe body fluid pH due to an increased CO2 load, which is typicallyobserved in fish and crustaceans (Appelhans et al., 2012; Hayashiet al., 2004; Spicer et al., 2007).In both L. polyphemus and M. magister, hemolymph ammonia

levels decreased after high PCO2treatment (Table 2), which was

associated with partial metabolic depression in M. magister (Hanset al., 2014) but requires verification in L. polyphemus. Moreover,metabolic depression in response to elevated ambient PCO2

and thesubsequent respiratory acidosis are usually associated with anuncompensated extracellular pH shift (Pörtner et al., 2004).However, much like the Dungeness crab, the predicted respiratoryacidosis was fully compensated in L. polyphemus. The observedupregulation of HAT in the transporting ventral half-lamella (Fig. 8A)

might reflect the necessary physiological changes required to keep thehemolymph pH constant. Altogether, this indicates that at least L.polyphemus in the adult stage has sufficient plasticity to withstandshort-term exposure to increased ambient PCO2

levels and decreasedpH regimes, which reflect the predicted future ocean scenario for theyear 2300 (Caldeira and Wickett, 2005).

Despite similarities in external morphology and the presence ofbranchial CMRA in both juveniles and adults, it is possible thatthere are physiological differences between the age groups used inthis study as they inhabit different water depths (Rudloe, 1981;Shuster, 1982). However, the two age groups exhibited similarpatterns in ammonia regulatory response to hypercapnia, wherereduced ammonia excretion by juveniles and a decrease inhemolymph ammonia concentration of adults occurred at thesame scale (43%; Table 2). Both age groups also showed efficientcounteractive ammonia excretory capacities when challenged withHAA, as seen by the lack of change in ammonia excretion andhemolymph ammonia concentration (Fig. 4B; Table 2), which weretested on juveniles and adults, respectively. Regardless, futurestudies comparing the juvenile and adult response to environmentalstresses would be beneficial in determining any physiologicaldifferences between the two age groups.

ConclusionsThis study confirmed regional differences in L. polyphemus bookgills through the use of split gill experiments with Ussing chambersand qPCR. Although the ventral epithelium excreted ammoniaunder normal conditions, the dorsal epithelium could be a barrieragainst inwardly directed gradients of ionic waste products such asNH4

+, as shown by active ammonia flux towards the apical side intissues from HAA-treated animals, as well as elevated LpRh-1 andCA-2 mRNA expression. However, another pathway of ammoniaexcretion was suggested because of the animal’s ability to maintainnormal whole-animal ammonia excretion levels and hemolymphconcentrations during HAA treatment, possibly involving the coxalgland. Current literature on ammonia regulation would benefit fromfurther studies on the role of the coxal gland, its link with acid–baseregulation and the mechanisms behind such processes.

AcknowledgementsWe would like to express our deepest gratitude to Dr Barbara Batelle (WhitneyLaboratory for Marine Bioscience) for providing us with adult specimens and for herexpertise in tissue dissection. Wewould like to thank the Animal Holding Facility staff(University of Manitoba) for caring for the research animals, as well as MichaelJ. Gaudry for his assistance in confirming the cytoplasmic carbonic anhydrasesequence through a RAxML gene tree and creating custom tissue holders for Ussingchambers. The majority of the data in this publication are part of a thesis (StephanieHans, Acid–base regulation and ammonia excretion in the American horseshoecrab, Limulus polyphemus, MSc thesis, University of Manitoba, 2016. URI: http://hdl.handle.net/1993/31775).

Competing interestsThe authors declare no competing or financial interests.

Author contributionsConceptualization: S.H.; Methodology: S.H., A.R.Q.-R., G.J.P.A., H.O., J.R.T.;Investigation: S.H.; Writing - original draft: S.H.; Writing - review & editing: A.R.Q.-R.,G.J.P.A., H.O., J.R.T., D.W.; Supervision: D.W.; Project administration: D.W.;Funding acquisition: D.W.

FundingThe study was supported by Natural Sciences and Engineering Research Council ofCanada(NSERC)DiscoveryGrant toD.W.andJ.R.T.,CanadaFoundation for Innovation(CFI) grant to D.W. and J.R.T., University of Manitoba Faculty of Science GraduateStudentship to S.H., University of Manitoba Graduate Enhancement of Tri-CouncilStipends to D.W., Faculty of Science Fieldwork Support Program to D.W., CanadaResearch Chair Programs to J.R.T., and Wagner College faculty research grant to H.O.

11

RESEARCH ARTICLE Journal of Experimental Biology (2018) 221, jeb151894. doi:10.1242/jeb.151894

Journal

ofEx

perim

entalB

iology

ReferencesAdlimoghaddam, A., Boeckstaens, M., Marini, A.-M., Treberg, J. R., Brassinga,A.-K. C. and Weihrauch, D. (2015). Ammonia excretion in Caenorhabditiselegans: mechanism and evidence of ammonia transport of the Rhesus proteinCeRhr-1. J. Exp. Biol. 218, 675-683.

Appelhans, Y. S., Thomsen, J., Pansch, C., Melzner, F. and Wahl, M. (2012).Sour times: seawater acidification effects on growth, feeding behaviour and acid–base status of Asterias rubens and Carcinus maenas. Mar. Ecol. Prog. Ser. 459,85-98.

Avise, J. C., Nelson, W. S. and Sugita, H. (1994). speciational history of “LivingFossils”: molecular evolutionary patterns in horseshoe crabs. Evolution 48,1986-2001.

Botton, M. L. (1984). The importance of predation by horseshoe crabs, Limuluspolyphemus, to an intertidal sand flat community. J. Mar. Res. 42, 139-161.

Bower, C. E. andBidwell, J. P. (1978). Ionization of ammonia in seawater: effects oftemperature, pH, and salinity. J. Fish. Res. Board Can. 35, 1012-1016.

Butterworth, R. F. (2002). Pathophysiology of hepatic encephalopathy: a new lookat ammonia. Metab. Brain Dis. 17, 221-227.

Caldeira, K. and Wickett, M. E. (2005). Ocean model predictions of chemistrychanges from carbon dioxide emissions to the atmosphere and ocean.J. Geophys. Res. 110, 1-12.

Cameron, J. N. and Heisler, N. (1983). Studies of ammonia in the rainbow trout:physicochemical parameters, acid-base behaviour and respiratory clearance.J. Exp. Biol. 105, 107-125.

Carrisoza-Gaytan, R., Rangel, C., Salvador, C., Saldana-Meyer, R., Escalona,C., Satlin, L.M., Liu,W., Zavilowitz, B., Trujillo, J., Bobadilla, N. A. et al. (2011).The hyperpolarization-activated cyclic nucleotide-gated HCN2 channel transportsammonium in the distal nephron. Kidney Int. 80, 832-840.

Chasiotis, H., Ionescu, A., Misyura, L., Bui, P., Fazio, K., Wang, J., Patrick, M.,Weihrauch, D. and Donini, A. (2016). An animal homolog of plant Mep/Amttransporters promotes ammonia excretion by the anal papillae of the diseasevector mosquito, Aedes aegypti. J. Exp. Biol. 219, 1346-1355.

Cruz, M. J., Sourial, M. M., Treberg, J. R., Fehsenfeld, S., Adlimoghaddam, A.and Weihrauch, D. (2013). Cutaneous nitrogen excretion in the African clawedfrog Xenopus laevis: effects of high environmental ammonia (HEA). Aquat.Toxicol. 136-137, 1-12.

Dickson, A. G. (1981). An exact definition of total alkalinity and a procedure for theestimation of alkalinity and total inorganic carbon from titration data. Deep-SeaRes. 28A, 609-623.

Dickson, A. G. (1990). Standard potential of the reaction AgCl(s)+1/2H2(g)=Ag(s)+HCl(aq), and the standard acidity constant of the ion HSO4

− insynthetic sea water from 273.15 to 318.15 K. J. Chem. Thermodyn. 22, 113-127.

Dickson, A. G. and Millero, F. J. (1987). A comparison of the equilibrium constantsfor the dissociation of carbonic acid in seawater media. Deep-Sea Res. 34,1733-1743.

Fehsenfeld, S. and Weihrauch, D. (2013). Differential acid-base regulation invarious gills of the green crabCarcinusmaenas: effects of elevated environmentalpCO2. Comp. Biochem. Physiol. A 164, 54-65.

Fehsenfeld, S. andWeihrauch, D. (2016a). Mechanisms of acid–base regulation inseawater-acclimated green crabs (Carcinus maenas). Can. J. Zool. 94, 95-107.

Fehsenfeld, S. and Weihrauch, D. (2016b). The role of an ancestralhyperpolarization-activated cyclic nucleotide-gated K+ channel in branchialacid-base regulation in the green crab, Carcinus maenas. J. Exp. Biol. 219,887-896.

Freire, C. A., Onken, H. and McNamara, J. C. (2008). A structure-function analysisof ion transport in crustacean gills and excretory organs.Comp. Biochem. Physiol.A Mol. Integr. Physiol. 151, 272-304.

Gibbs, A. and Somero, G. N. (1989). Pressure adaptation of Na+/K+-ATPase ingills of marine teleosts. J. Exp. Biol. 143, 475-492.

Gilmour, K. M. (2012). New insights into the many functions of carbonic anhydrasein fish gills. Respir. Physiol. Neurobiol. 184, 223-230.

Goldsmith, D. J. A. and Hilton, P. J. (1992). Relationship between intracellularproton buffering capacity and intracellular pH. Kidney Int. 41, 43-49.

Goodman, S. H. and Cavey, M. J. (1990). Organization of a phyllobranchiate gillfrom the green shore crab Carcinus maenas (Crustacea, Decapoda). Cell TissueRes. 260, 495-505.

Hammer, Ø., Harper, D. A. T. and Ryan, P. D. (2001). PAST: paleontologicalstatistics software package for education and data analysis. Electron 4, 9-18.

Hans, S., Fehsenfeld, S., Treberg, J. R. and Weihrauch, D. (2014). Acid–baseregulation in the Dungeness crab (Metacarcinus magister). Mar. Biol. 161,1179-1193.

Hayashi, M., Kita, J. and Ishimatsu, A. (2004). Acid–base responses to lethalaquatic hypercapnia in three marine fishes. Mar. Biol. 144, 153-160.

Henry, R. P., Jackson, S. A. and Mangum, C. P. (1996). Ultrastructure andtransport-related enzymes of the gills and coxal gland of the horseshoe crabLimulus polyphemus. Biol. Bull. 191, 241-250.

Larsen, E. H., Deaton, L. E., Onken, H., O’Donnell, M., Grosell, M., Dantzler,W. H. andWeihrauch, D. (2014). Osmoregulation and excretion.Compr. Physiol.4, 405-573.

Lewis, E. and Wallace, D. W. R. (1998). Program developed for CO2 systemcalculations (ed. T. C. D. I. A. Center). Oakridge, TN: Oak Ridge NationalLaboratory, U.S. Department of Energy.

Mangum, C. P., Booth, C. E., DeFur, P. L., Heckel, N. A., Henry, R. P., Oglesby,L. C. and Polites, G. (1976). The ionic environment of hemocyanin in Limuluspolyphemus. Biol. Bull. 150, 453-467.

Marcaida, G., Felipo, V., Hermenegildo, C., Min ana, M.-D. and Grisolia, S.(1992). Acute ammonia toxicity is mediated by the NMDA type of glutamatereceptors. FEBS Lett. 296, 67-68.

Martin, M., Fehsenfeld, S., Sourial, M. M. and Weihrauch, D. (2011). Effects ofhigh environmental ammonia on branchial ammonia excretion rates and tissueRh-protein mRNA expression levels in seawater acclimated Dungeness crabMetacarcinus magister. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 160,267-277.

Masui, D. C., Furriel, R. P. M., McNamara, J. C., Mantelatto, F. L. M. and Leone,F. A. (2002). Modulation by ammonium ions of gill microsomal (Na+,K+)-ATPasein the swimming crab Callinectes danae: a possible mechanism for regulation ofammonia excretion. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 132,471-482.

McCormick, S. D. (1993). Methods for nonlethal gill biopsy and measurement of Na+, K+-ATPase activity. Can. J. Fish Aquat. Sci. 50, 656-658.

McGaw, I. J. (2005). Burying behaviour of two sympatric crab species: Cancermagister and Cancer productus. Sci. Mar. 69, 375-381.

Mehrbach, C., Culberson, C. H., HAwley, J. E. and Pytkowicz, R. M. (1973).Measurement of the apparent dissociation constants of carbonic acid in seawaterat atmospheric pressure. Limnol. Oceanogr. 18, 897-907.

Melzner, F., Gutowska, M. A., Langenbuch, M., Dupont, S., Lucassen, M.,Thorndyke, M. C., Bleich, M. and Portner, H.-O. (2009). Physiological basis forhigh CO2 tolerance in marine ectothermic animals: pre-adaptation throughlifestyle and ontogeny? Biogeoscineces 6, 2313-2331.

Nawata, C. M., Hung, C. C. Y., Tsui, T. K. N., Wilson, J. M., Wright, P. A. andWood, C. M. (2007). Ammonia excretion in rainbow trout (Oncorhynchus mykiss):evidence for Rh glycoprotein andH+-ATPase involvement.Physiol. Genomics 31,463-474.

Novitsky, T. J. (1984). Discovery to commercialization: the blood of the horseshoecrab. Oceanus 27, 13-18.

Onken, H. andMcNamara, J. C. (2002). Hyperosmoregulation in the red freshwatercrab Dilocarcinus pagei (Brachyura, Trichodactylidae): structural and functionalasymmetries of the posterior gills. J. Exp. Biol. 205, 167-175.

Pfaffl, M.W. (2004). Quantification strategies in real-time PCR. InA-Z of QuantitativePCR (ed. S. A. Bustin), pp. 87-112. La Jolla, CA, USA: International UniversityLine (IUL).

Pitts, R. J., Derryberry, S. L., Jr, Pulous, F. E. and Zwiebel, L. J. (2014). Antennal-expressed ammonium transporters in the malaria vector mosquito Anophelesgambiae. PLoS ONE 9, e111858.

Portner, H.-O., Langenbuch, M. and Reipschlager, A. (2004). Biological impact ofelevated ocean CO2 concentrations: lessons from animal physiology and earthhistory. J. Oceanogr. 60, 705-718.

Postel, U., Petrausch, G., Riestenpatt, S., Weihrauch, D., Malykh, J., Becker, W.and Siebers, D. (1998). Inhibition of Na+/K+-ATPase and of active ion-transportfunctions in the gills of the shore crab Carcinus maenas induced by cadmium.Mar. Biol. 130, 407-416.

Postel, U., Becker,W., Brandt, A., Luck-Kopp, S., Riestenpatt, S., Weihrauch, D.and Siebers, D. (2000). Active osmoregulatory ion uptake across the pleopods ofthe isopod Idotea baltica (Pallas): electrophysiological measurements on isolatedsplit endo- and exopodites mounted in a micro-ussing chamber. J. Exp. Biol. 203,1141-1152.

Quijada-Rodriguez, A. R., Treberg, J. R. and Weihrauch, D. (2015). Mechanismof ammonia excretion in the freshwater leech Nephelopsis obscura:characterization of a primitive Rh protein and effects of high environmentalammonia. Am. J. Physiol. Regul. Integr. Comp. Physiol. 309, R692-R705.

Robertson, J. D. (1970). Osmotic and ionic regulation in the horseshoe crabLimulus polyphemus (Linnaeus). Biol. Bull. 138, 157-183.

Rudloe, A. (1980). The breeding behavior and patterns of movement of horseshoecrabs, Limulus Polyphemus, in the vicinity of breeding beaches in Apalachee Bay,Florida. Estuaries 3, 177-183.

Rudloe, A. (1981). Aspects of the biology of juvenile horseshoe crabs, Limuluspolyphemus. Bull. Mar. Sci. 31, 125-133.

Shuster, C. N. Jr. (1979). Distribution of the American horseshoe “crab”, Limuluspolyphemus (L.). Prog. Clin. Biol. Res. 29, 3-26.

Shuster, C. N. Jr. (1982). A pictorial review of the natural history and ecology of thehorseshoe crab Limulus polyphemus, with reference to other Limulidae. Prog.Clin. Biol. Res. 81, 1-52.

Shuster, C. N., Jr and Botton, M. L. (1985). A contribution to the population biologyof horseshoe crabs, Limulus polyphemus (L.), in Delaware Bay. Estuaries 8,363-372.

Smith, S. A., Berkson, J. M. and Barratt, R. A. (2002). Horseshoe crab (Limuluspolyphemus) hemolymph, biochemical and immunological parameters. Proc. Int.Assoc. Aquat. Anim. Med. 33, 101-102.

12

RESEARCH ARTICLE Journal of Experimental Biology (2018) 221, jeb151894. doi:10.1242/jeb.151894

Journal

ofEx

perim

entalB

iology

Spicer, J. I., Raffo, A. and Widdicombe, S. (2007). Influence of CO2-relatedseawater acidification on extracellular acid–base balance in the velvet swimmingcrab Necora puber. Mar. Biol. 151, 1117-1125.

Taylor, A. C., Morris, S. and Bridges, C. R. (1985). Oxygen and carbon dioxidetransporting properties of the blood of three sublittoral species of burrowing crabs.J. Comp. Physiol. B 155, 733-742.

Towle, D. W., Mangum, C. P., Johnson, B. A. and Mauro, N. A. (1982). The role ofthe coxal gland in ionic, osmotic, and pH regulation in the horseshoe crab, Limuluspolyphemus. Prog. Clin. Biol. Res. 81, 147-172.

Truchot, J. P. (1976). Carbon dioxide combining properties of the blood of the shorecrab Carcinus maenas (L): carbon dioxide solubility coefficient and carbonic aciddissociation constants. J. Exp. Biol. 64, 45-57.

Vosatka, E. D. (1970). Observation on the swimming. righting, and burrowingmovementsof younghorseshoecrabs,Limuluspolyphemus.OhioJ.Sci.9, 276-283.

Weihrauch, D., Becker, W., Postel, U., Riestenpatt, S. and Siebers, D. (1998).Active excretion of ammonia across the gills of the shore crab Carcinus maenasand its relation to osmoregulatory ion uptake. J. Comp. Physiol. B 168, 364-376.

Weihrauch, D., Becker, W., Postel, U., Luck-Kopp, S. and Siebers, D. (1999).Potential of active excretion of ammonia in three different haline species of crabs.J. Comp. Physiol. B 169, 25-37.

Weihrauch, D., Ziegler, A., Siebers, D. and Towle, D. W. (2002). Active ammoniaexcretion across the gills of the green shore crab Carcinus maenas: participation

of Na(+)/K(+)-ATPase, V-type H(+)-ATPase and functional microtubules. J. Exp.Biol. 205, 2765-2775.

Weihrauch, D., Wilkie, M. P. and Walsh, P. J. (2009). Ammonia andurea transporters in gills of fish and aquatic crustaceans. J. Exp. Biol. 212,1716-1730.

Weihrauch, D., Chan, A. C., Meyer, H., Doring, C., Sourial, M. M. and O’Donnell,M. J. (2012). Ammonia excretion in the freshwater planarian Schmidteamediterranea. J. Exp. Biol. 215, 3242-3253.

Widdicombe, S., Spicer, J. I. and Kitidis, V. (2016). Effects of ocean acidifcationon sediment fauna. In Ocean Acidification, pp. 176-191. eBook Collection(EBSCOhost), Ipswich, MA: EBSCO Publishing.

Wilson, R. W. and Taylor, E. W. (1992). Transbranchial ammonia gradients andacid-base responses to high external ammonia concentration in rainbow trout(Oncorhynchus mykiss) acclimated to different salinities. J. Exp. Biol. 166,95-112.

Wright, P. A. (1995). Nitrogen excretion: three end products, many physiologicalroles. J. Exp. Biol. 198, 273-281.

Wright, P. A. and Wood, C. M. (2009). A new paradigm for ammonia excretionin aquatic animals: role of Rhesus (Rh) glycoproteins. J. Exp. Biol. 212,2303-2312.

Young-Lai, W.W., Charmantier-Daures, M. and Charmantier, G. (1991). Effect ofammonia on survival and osmoregulation in different life stages of the lobsterHomarus americanus. Mar. Biol. 110, 293-300.

13

RESEARCH ARTICLE Journal of Experimental Biology (2018) 221, jeb151894. doi:10.1242/jeb.151894

Journal

ofEx

perim

entalB

iology