AMG 595, an Anti-EGFRvIII Antibody Drug Conjugate ......Large Molecule Therapeutics AMG 595, an...

Large Molecule Therapeutics

AMG 595, an Anti-EGFRvIII Antibody–DrugConjugate, Induces Potent Antitumor Activityagainst EGFRvIII-Expressing GlioblastomaKevin J. Hamblett1, Carl J. Kozlosky1, Sophia Siu1,Wesley S. Chang2, Hua Liu1,Ian N. Foltz3, Esther S. Trueblood1, David Meininger1, Taruna Arora4, Brian Twomey4,Steven L. Vonderfecht4, Qing Chen4, John S. Hill4, and William C. Fanslow1

Abstract

Epidermal growth factor receptor variant III (EGFRvIII) is acancer-specific deletion mutant observed in approximately 25%to 50% of glioblastoma multiforme (GBM) patients. An anti-body drug conjugate, AMG 595, composed of the maytansinoidDM1 attached to a highly selective anti-EGFRvIII antibody via anoncleavable linker, was developed to treat EGFRvIII-positiveGBM patients. AMG 595 binds to the cell surface and internalizesinto the endo-lysosomal pathway of EGFRvIII-expressing cells.Incubation of AMG 595 with U251 cells expressing EGFRvIII ledto potent growth inhibition. AMG 595 treatment induced sig-nificant tumor mitotic arrest, as measured by phospho-histone

H3, in GBM subcutaneous xenografts expressing EGFRvIII. Asingle intravenous injection of AMG 595 at 17 mg/kg (250 mgDM1/kg) generated complete tumor regression in the U251vIIIsubcutaneous xenograft model. AMG 595 mediated tumorregression in the D317 subcutaneous xenograft model thatendogenously expresses EGFRvIII. Finally, AMG 595 treatmentinhibited the growth of D317 xenografts orthotopicallyimplanted into the brain as determined by magnetic resonanceimaging. These results demonstrate that AMG 595 is a promisingcandidate to evaluate in EGFRvIII-expressing GBM patients. MolCancer Ther; 14(7); 1614–24. �2015 AACR.

IntroductionAn estimated 23,380 new cases of brain cancer will be

diagnosed in the United States in 2014 (1). Roughly half ofall brain cancers are grade IV, also known as glioblastomamultiforme (GBM), which has an extremely poor prognosisand a median survival of 14.6 months after diagnosis (2, 3).Yet, in the past 20 years, only two agents have been approvedfor the treatment of GBM; temozolomide for first-line patientsas a combination with adjuvant radiotherapy followed bytemozolomide monotherapy (3) and bevacizumab for patientswith recurrent GBM (4). Sequencing of GBM by The CancerGenome Atlas (TCGA) effort and others is generating a clearerpicture of the molecular basis of GBM (5). The TCGA deter-mined that amplification of EGFR is almost exclusivelyobserved in the classical subtype of GBM. EGFR expression isassociated with a malignant phenotype in multiple cancers,including colon cancer (6), head and neck squamous cellcarcinoma (7), and GBM (8). Amplification of EGFR is

observed in approximately 40% to 70% of GBM patients (9,10). EGFR gene alterations are observed in tumors with ampli-fied EGFR (11). The most common genetic alteration found inGBM is EGFR variant III (EGFRvIII) wherein exons 2 to 7 ofEGFR have been deleted (12). Juxtaposition of EGFR exons 1and 8 forms a novel glycine residue between these two exons.Deletion of EGFR's exons 2 to 7 yields a protein that isincapable of binding to EGFR ligands (13) but remains con-stitutively activate leading to a malignant phenotype (14).EGFRvIII expression in GBM samples is reported between25% to 50%, depending on the method used for detection(15–17).

EGFRvIII is expressed in tumors, and its lack of normal tissueexpression makes it an ideal candidate for pursuing a targetedtherapeutic (13). Multiple modalities are being investigated totarget EGFRvIII-expressing tumors, including kinase inhibitorcombinations (18), peptide vaccination (19), and antibody tar-geting (20). Antibodies can be modified to improve potencythrough enhanced Fc receptor binding and effector function(21), engagement of T cells (22), or attachment of a cytotoxicdrug (23). Recently, the antibody–drug conjugates (ADC) Adce-tris (24) and Kadcyla (25) were approved for the treatment ofCD30-expressing Hodgkin lymphoma and anaplastic large celllymphoma and Her2-expressing breast cancer, respectively.

We have developed a fully human antibody that binds solely toEGFRvIII and does not bind to wild-type EGFR. This fully humananti–EGFRvIII-specific IgG1 antibody was conjugated to the anti-tubulin agent, DM1, via the noncleavable MCC linker to generateAMG595. In this report,wedescribeAMG595and show its in vitrofunctional characterization and demonstrate its ability tomediatetumor regression in EGFRvIII-expressing subcutaneous andorthotopic xenografts.

1Amgen Inc., Seattle,Washington. 2Amgen Inc., South San Francisco,California. 3Amgen Inc., Burnaby, British Columbia, Canada. 4AmgenInc., Thousand Oaks, California.

Note: Supplementary data for this article are available at Molecular CancerTherapeutics Online (http://mct.aacrjournals.org/).

Current address for T. Arora: NGMBiopharmaceuticals, South San Francisco, CA.

Corresponding Author: Kevin J. Hamblett, Zymeworks Biopharmaceuticals, 18W. Mercer St., Seattle, WA 98119. Phone: 206-237-1031; E-mail:[email protected]

doi: 10.1158/1535-7163.MCT-14-1078

�2015 American Association for Cancer Research.

MolecularCancerTherapeutics

Mol Cancer Ther; 14(7) July 20151614

on April 25, 2020. © 2015 American Association for Cancer Research. mct.aacrjournals.org Downloaded from

Published OnlineFirst April 30, 2015; DOI: 10.1158/1535-7163.MCT-14-1078

http://mct.aacrjournals.org/

Materials and MethodsReagents

U251, U251vIII, and D317 GBM cells were obtained throughan agreement with Dr. Darell Bigner (Duke University) and heldin a repository at Amgen. EGFRvIII is a genomic deletion mutantthat hasonly beenobserved inhuman tumors; there are no reportsthat EGFRvIII is expressed in normal tissues (13). EGFRvIIIexpression is lost frompatient-derived glioblastoma cells culturedin vitro (26, 27). EGFRvIII expression by flow cytometry or IHCwas used to authenticate cell lines, and cells were not passaged invitro for more than 3 months. U251vIII and U251 cells werecultured in 10% DMEM with 10% FBS. To generate fully humananti-EGFRvIII antibodies, Xenomouse animals (28) were immu-nized with either the EGFRvIII junctional peptide LEEKKG-NYVVTDHC conjugated to keyhole limpet hemocyanin (KLH)or cells expressing EGFRvIII. Following immunization, B cellswere either collected for generation of hybridomas or isolatedusing the Selected Lymphocyte Antibody Method (29). Specificanti–EGFRvIII-binding antibodies were selected for additionalanalysis. Antibodies were conjugated to the maytansinoid DM1(ImmunoGen, Inc.) using a noncleavable linker (30). Briefly, theanti-EGFRvIII antibody wasmodified with the hetero-bifunction-al linker succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC). Following removal of the excess SMCC,maleimide-labeled antibodywas incubatedwithDM1 to generateanti-EGFRvIII Ab-MCC-DM1 (AMG 595). Antibody and DM1concentrations were calculated by solving a pair of Beer's Lawequations at 252 and 280 nm (31). The human anti-EGFRvIIIantibody constant regions were modified to murine constantregions to generate a chimeric anti-EGFRvIII human variable/murine IgG1 constant domain antibody for use in IHC.

BIAcore affinity measurementBinding of AMG 595 and anti-EGFRvIII antibody to human

EGFRvIII was measured by solution equilibrium-binding assayusing Surface Plasmon Resonance (BIAcore). EGFRvIII was immo-bilizedon the secondflowcell of aCM5 chipusing amine coupling(reagents providedbyGEHealthcare)with anapproximate densityof7,000 responseunits. Thefirstflowcellwasusedas abackgroundcontrol. A concentration of 300pmol/L, 1.0 nmol/L, or 3.0 nmol/Lof AMG 595 or anti-EGFRvIII antibody was mixed with a serialdilution of EGFRvIII (ranging from 6.6 pmol/L to 390 nmol/L) inPBS plus 0.1 mg/mL BSA, 0.005% P20, and incubated at roomtemperature for 4hours. Bindingof the freeantibodies in themixedsolutionswasmeasured by injecting over the EGFRvIII-coated chipsurface. Nonlinear regression curve fit was used to calculate anti-body affinity and 95% confidence intervals (CI).

IHC of GBM patient samplesFormalin-fixed paraffin-embedded (FFPE) GBM sections were

heat treated in Biocare's DIVA solution using Biocare's decloakingchamber (Biocare) for SP1 at 125�C for 30 seconds and SP2 at90�C for 10 seconds. FrozenGBMsectionswerefixedwith acetoneat 4�C for 5 minutes. Tissue sections were incubated for 60minutes with 0.69 mg/mL of the chimeric anti-EGFRvIII humanvariable/murine constant antibody, followed by EnVisionþmouse horseradish peroxidase polymer (DAKO) and DAB chro-mogen to visualize EGFRVIII expression. Mouse IgG1 (Invitro-gen) was used as an isotype-negative reagent control on all tissuesections.

Quantitative PCR of GBM patient samplescDNA was synthesized from total RNA using the High-Capacity

cDNAArchive Kit (Life Technologies). Per sample, 1 mg of RNAwasreverse transcribed in a 100 mL reaction volume. Quantitative PCR(qPCR) was performed with a 7900HT SDS instrument using thefollowing reagents: EGFRvIII forward primer: 50GAGTCGGGCT-CTGGAGGAA30, reverse primer: 50GGCCCTTCGCACTTCTTACAC30, probe: 50[FAM]-TCACCACATAATTACCTTTCT-[quencher]30.The EGFRvIII primers were synthesized at Amgen, and the probewas synthesized at Applied Biosystems (Life Technologies). EGFR-vIII-positive and negative control DNAs were assayed with eachsample batch. Each qPCR reaction nominally contained 100 ng ofcDNA. Cycle Threshold (CT) values were extracted with the "CT

Analysis" settingsconfigured for "AutomaticBaseline"and"ManualCT," using the default threshold setting of 0.2.

Internalization of AMG 595To assess cell surface binding, internalization, and trafficking of

AMG 595, U251vIII cells were plated onto collagen-coated glasschamber slides (Thermo Scientific) and grown to approximately60% confluence. For live cell surface labeling of EGFRvIII, cellswere transferred to ice and incubatedwith AMG595 at 1 mg/mL incomplete media containing lysosomal protease inhibitors (LPI)leupeptin (10 mg/mL) and pepstatin (5 mmol/L) for 30minutes at4�C. Cells were washed twice in coldmedia containing lysosomalprotease inhibitors and either fixed immediately in 3% formal-dehyde in PBS for 20 minutes on ice (t¼ 0) or incubated at 37�Cfor 30 minutes, 4 hours, or 24 hours, and then fixed. Cells werepermeabilized and blocked in TBST þ 5% donkey serum þ 0.1%TX-100, then AMG 595 was detected with a donkey anti-humanIgG-AlexaFluor 488 (Jackson ImmunoResearch). Early endosomemarker EEA1was detected using a rabbit antibody (Cell SignalingTechnology) followed by anti-rabbit IgG-Alexa 647–conjugatedantibody (Invitrogen). Lysosomal marker LAMP1 was detectedwith amouse antibody (BDBiosciences), followed by anti-mouseAlexa 568–conjugated antibody (Invitrogen). Cells were cover-slipped with ProLong GoldþDAPI antifade reagent (Invitrogen),and images were acquired using a 100X (N.A. 1.4) oil immersionobjective lens on a Zeiss LSM 510 confocal microscope system(Carl Zeiss; Jena GmBH).

Colocalization image analysisImages were cropped in Adobe Photoshop (Adobe) to select

regions of interest (ROI) for analysis. Gray scale images (8 bit) ofEEA1 and LAMP1 staining were pseudocolored red and mergedwith images of human IgG staining in green to generate compositeimages for quantitative colocalization analysis using Columbussoftware (Perkin-Elmer). Colocalization analysis was performedon pairs of channels within the composite image (hIgG/EEA1,hIgG/LAMP1) to generate Pearson R values at each time point.

AMG 595 mediated cell growth inhibitionU251 and U251vIII cells were cultured in a 96-well tissue

culture plate and incubated at 37�C with 5% CO2 for approxi-mately 4 to 6 hours. After the incubation, serial dilutions of AMG595, control conjugate, DM1, or Lysine-MCC-DM1were added tocell cultures and continuously incubated at 37�Cwith 5%CO2 for4 days before measurement of cellular ATP levels using theCellTiter-Glo reagent (Promega). The ATP levels were directlycorrelated with viable cell number. Luminescence was measuredusing a Wallac EnVision 2103 multilabel reader (Perkin Elmer)

AMG 595, an Anti-EGFRvIII ADC for Glioblastoma

www.aacrjournals.org Mol Cancer Ther; 14(7) July 2015 1615




with a reading time of 0.1 second per well. The IC50 value wasdetermined from the dose–response curve by using nonlinearregression analysis (sigmoidal curve fit) of log-transformed con-centration data using Prism 6.03 (GraphPad Software).

Animal care and useFemale CB17 SCIDor CD-1 nu/numice between 4 and 6weeks

of agewere cared for in accordance to theGuide for the Care andUseof Laboratory Animals, 8th Edition. Mice were group-housed at anAAALAC international-accredited facility in sterile ventilatedmicroisolator (or static) housing on corn cob bedding. Allresearch protocols were approved by the Institutional AnimalCare and Use Committee. Animals had ad libitum access topelleted feed and water via automatic watering system or waterbottle. Animals were maintained on a 12:12-hour light:dark cyclein rooms and had access to enrichment opportunities. Tumorvolume and animal weights were measured two or three times aweek. Tumor length and width were measured with electronicdigital calipers. Tumor volume (mm3)was calculated as (W2� L)/2, where width (W) is defined as the smaller of the two measure-

ments and length (L) is defined as the larger of the two measure-ments. Subcutaneous efficacy experiments were performed in amasked fashion with one individual measuring tumor volumeand animal weights while a separate individual prepared testarticles and injected the animals.

Serial in vivo propagation of D317Fragments of the D317 tumor (derived from a patient with a

GBM and shown to express EGFRvIII) were serially propagated inimmunocompromised mice to maintain EGFRvIII expression(26). Animals bearing D317 human GBM xenografts were eutha-nized and tumors removed under sterile conditions. Tumors wereaseptically sectioned into similar sized fragments that fit into 13gauge implant trocars. Tumors were implanted via trocar into theflanks of na€�ve CB-17/SCID mice.

Pharmacodynamics of AMG 595Mice bearing subcutaneous D317 tumors were randomized

into treatment groups based on tumor volume. Animal cohortsreceived vehicle, control conjugate, or AMG 595 by intravenous

Figure 1.A, schematic representation of AMG595 consisting of the anti-EGFRvIIIantibody conjugated to themaytansine derivative DM1 by thenoncleavable linker MCC. B, GBMpatient samples analyzed forEGFRvIII expression by qPCR(CT values) and IHC.

Hamblett et al.

Mol Cancer Ther; 14(7) July 2015 Molecular Cancer Therapeutics1616




injection 14 days after implantation. Forty hours after treatment,animals were euthanized to collect tumors thatwere processed forIHC assessment of phospho-histone H3 levels as a measure ofmitotic arrest. Results are reported as the number of positivephospho-histone H3 cells in an area of 1 mm2 (phH3(þ)/mm2).The average number of phospho-histone H3–positive cells permm2 in the treatment groups was compared with the numberobserved in the control treatment groups.

Efficacy of AMG 595 in subcutaneous U251vIII xenograftsTen million U251vIII cells mixed with growth factor–

reduced Matrigel (BD Biosciences) were implanted subcutane-ously into CD-1 nu/nu mice. Once tumor volumes wereapproximately 300 mm3, animals were randomized into treat-ment groups of ten animals each. Animals were administered asingle intravenous dose of either a nontargeted control conju-gate Ab-MCC-DM1 at 14.4 mg/kg (250 mg DM1/kg) or AMG595 at 1.7, 5.6, or 17 mg/kg based on antibody dose (25, 82,and 250 mg DM1/kg, respectively). Earlier experiments dem-onstrated no difference in the vehicle and control conjugategroups (Supplementary Fig. S1).

D317 subcutaneous xenograft AMG 595 dose response andretreatment

CB-17/SCID mice bearing subcutaneous D317 tumors weremeasured, and once tumors reached approximately 240 mm3,animals were randomized into treatment groups of ten animalseach for treatment initiation. Treatment was administeredintravenously via the tail vein once weekly for four injections.Animal cohorts received vehicle, a nontargeted control conju-gate (Ab-MCC-DM1) at 26.8 mg/kg (375 mg DM1/kg), 7.3,14.6, or 22 mg/kg of AMG 595 (125, 250, and 375 mg DM1/kg,respectively). Five animals that achieved complete regressionfollowing initial treatment that recurred were retreated with

two doses of AMG 595, administered 1 week apart on days 94and 101.

Ex vivo EGFRvIII expression analysis by flow cytometryThree animals bearing D317 subcutaneous xenografts treated

with the initial four doses of AMG 595 were euthanized, andtumors that regrew were excised. Tumors were minced withscissors and passed through a cell screen before incubation withred blood cell lysis buffer (Sigma) for 10 minutes, followed bycentrifugation. Tumor cells were counted and then dual stainedwith either a human IgG1 control antibody or human IgG1 anti-EGFRvIII antibody and a mouse IgG1 kappa antibody (BDBiosciences) or mouse anti-human HLA-ABC antibody (BD Bio-sciences) at 4�C for approximately 30 to 40 minutes. Cells werewashed and incubated for approximately 30 to 40minutes at 4�Cwith an anti-human IgG-Alexa 647–conjugated antibody and ananti-mouse IgG-Alexa 488–conjugated antibody. Cells were ana-lyzed on a FACSCalibur (BD Biosciences).

Efficacy of AMG 595 in orthotopic xenograftCB-17/SCIDmicewere exposed towhole body irradiationwith

a g-source (1.44 Gy). Three days later, animals were stereotacti-cally implanted into the right frontal lobewith 1�105D317 cells.Animal cohorts of eight animals each received vehicle or 22mg/kg(375 mg DM1/kg) AMG 595 by intravenous injection 3 days afterD317 orthotopic implantation. Treatment was administeredtwice weekly for 2 weeks. Twelve and 20 days following implantanimals tumors T2-weighted images were collected using MRIwith a 4.7 Tesla magnet.

Statistical analysisGroup comparisons for pharmacodynamic data were per-

formed using the Mann–Whitney test using GraphPad Prismversion 6.03.

Figure 2.Cell surface binding, internalization,and time-dependent trafficking ofAMG 595 to endosomes andlysosomes in U251vIII cells. Cells werelive-labeled with AMG 595 at 4�C todetect surface EGFRvIII; a singlerepresentative cell is shown in eachimage (top row). Cells were incubatedat 37�C for 30 minutes, 4 hours,and 24 hours and then fixed andpermeabilized. Immunofluorescentlabeling with antibodies againsthuman IgG (AlexaFluor 488), earlyendosome marker EEA1, (AlexaFluor647) and lysosomal marker LAMP-1(AlexaFluor 555) was used to detectthe internalized ADC as it movedthrough the endo-lysosomalpathway. Colocalization images andcoefficients are included in thetwo right columns for hIgG þ EEA1and hIgG þ LAMP-1.






Group tumor volumes are shown as mean plus or minus SEMand plotted as a function of measurement time after implanta-tion. Statistical significance of observed differences betweengrowth curves was evaluated by repeated measures analysis ofcovariance of the log-transformed tumor volume data with Dun-nett-adjusted multiple comparisons posttest. Efficacy statisticalcalculations were made through the use of JMP software v7.0interfaced with SAS v9.1 (SAS Institute, Inc.).

ResultsGeneration of AMG 595

To generate a specific anti-EGFRvIII fully human antibodyXenomouse� animals were immunized with the EGFRvIII pep-tide-KLH or cells expressing EGFRvIII. Fully human antibodieswere assessed for binding to EGFRvIII and counter-screened forbinding to wild-type EGFR. The lead antibody was selected basedon its binding affinity for EGFRvIII [740 pmol/L, 95% CI, (550–

1,000)] and lack of binding to wild-type EGFR. This antibody wasconjugated toDM1with the noncleavable linkerMCC (Fig. 1A) togenerate AMG 595. Binding affinity of AMG 595 to EGFRvIII was610 pmol/L, 95% CI, (440–840), similar to that observed for theunconjugated antibody. A chimeric form of the anti-EGFRvIIIantibody was generated to stain human tissue sections for EGFR-vIII expression. Figure 1B shows representative tissue sectionstaining for EGFRvIII in GBM samples; five of 16 patient sampleswere positive for EGFRvIII expression by IHC and qPCR. Onesample was positive by IHC only, another was positive by qPCRonly, whereas in the remaining 14 samples, EGFRvIII expressionstatus was matched for qPCR and IHC (87.5% concordance)demonstrating the EGFRvIII specificity of the anti-EGFRvIII anti-body used in AMG 595.

Internalization of AMG 595The ability of AMG 595 to internalize into EGFRvIII-expressing

cells and its subcellular localization was explored in U251vIII

Figure 3.A, AMG 595 demonstrates potent cell growth inhibition of EGFRvIII-expressing cells. U251vIII (A) and U251 (B) cells were plated and exposed to media, AMG 595,control conjugate, DM1, or Lys-MCC-DM1 for 96 hours. Viable cell number remaining in the cultures was assessed using Cell TiterGlo and measurement ofluminescence. C, DM1was conjugated to anti-EGFRvIII antibody yielding conjugateswithDARs from 1.25 to 5.5 and exposed toU251vIII cells for 96 hours. Cell viabilitywas assessed using Cell TiterGlo as in A and B. The data are expressed as the mean � SEM for duplicate measurements (n ¼ 2).

Hamblett et al.





cells, which had a CT value of 23.10, similar to that identified forthe EGFRvIII-positive glioblastoma patient samples describedabove. AMG595bound to the cell surface ofU251vIII cells (Fig. 2,top row) at 4�C, t¼ 0 timepoint. A peripheral membrane patternof staining was observed, with no localization with endosome orlysosomal markers. Upon elevating the temperature to 37�C for0.5 hours, the staining shifted to a punctate pattern, with AMG595 localized within EEA1þ early endosomes (Fig. 2). After 4hours, most of the internalized AMG 595 had trafficked toLAMP1þ lysosomes as evidenced by the colocalization coefficient0.69 and visually in Fig. 2 (far right column). At 24 hours, in thepresence of LPI, internalized AMG 595 was still present in thelysosomes.

AMG 595 potently inhibits cell growthCell growth was assessed by measuring ATP levels which

correlated with cell number. In U251vIII cells, AMG 595 wasmore potent at killing the cells thanDM1alonewith an IC 50 of 25� 3 pmol/L, based on DM1 concentration (Fig. 3A). However, innon–EGFRvIII-expressing U251 cells, AMG 595 did little to affectgrowth and was similar to the effect observed with controlconjugate (Fig. 3B); this was also demonstrated in A431 cells thatoverexpress wild-type EGFR (Supplementary Fig. S2). InU251vIII

and U251 cells, DM1 showed similar potency at approximately0.25 nmol/L. The IC50 of Lysine-MCC-DM1, the cataboliteformed in lysosomes of cells treated with AMG 595 or othernoncleavable linker DM1 ADC, was approximately 300-fold lesspotent than AMG 595 in EGFRvIII-expressing cells.

Todefine the optimal drug antibody ratio (DAR), anti-EGFRvIIIantibody was conjugated with different levels of DM1 rangingfrom 1.2 to 5.5 DM1 molecules per antibody and ability to killEGFRvIII-expressing cells measured (Fig. 3C). The two lowestDARs, 1.2 and 2.4, showed decreased cell growth inhibitionIC50 as compared with the higher DAR conjugates, which rangedfrom 3.4 to 5.5. With no improvement in the IC50 at higher DARvalues, the optimal DAR for AMG 595 was determined to beapproximately 3.5.

Pharmacodynamics of AMG 595To assess the induction of mitotic arrest following treatment

with AMG595 in vivo, subcutaneousD317 tumors fromAMG595or control-treated animalswere removed and assessed for levels ofphospho-histone H3 by IHC. Tumors in animals treated with 5.3mg/kg of AMG 595 (80 mg DM1/kg) generated an average of 868phospho-histone H3–positive cells/mm2, approximately 2-foldincrease compared with vehicle (P ¼ 0.0043) and control

Figure 4.AMG 595 induces tumor mitotic arrestin vivo as measured by increasedphospho-histone H3. Mice bearingD317 human GBM subcutaneousxenografts were treated with eithervehicle, AMG 595 at two dose levels5.3 mg/kg and 16.7 mg/kg (80 and250 mg DM1/kg, respectively), or anontarget control conjugate at 17.8mg/kg (250 mg DM1/kg). Forty hoursafter treatment, tumors werecollected and sectioned for IHCanalysis of phospho-histone H3.Representative 20� images areshown at left. Phospho-histone H3quantification for each group is shownat right. � , P < 0.05 versusvehicle as determined by theMann–Whitney test.






Hamblett et al.





conjugate (P¼ 0.0159) as shown in Fig. 4. At the 16.7mg/kg dose(250 mg DM1/kg), AMG 595 treatment also demonstrated anincreased number of phospho-histone H3–expressing cells com-pared with vehicle (P ¼ 0.0043) and control conjugate (P ¼0.0317).

Efficacy of AMG 595 in subcutaneous U251vIII xenograftsAnimals bearing U251vIII human GBM subcutaneous xeno-

grafts were randomized for treatment with either AMG 595 orcontrol conjugate. Tumors in animals treated with control con-jugate grew from an average of 328 � 28 mm3 on day 18 to anaverage of 1,374 � 248 mm3 on day 35 after implantation (Fig.5A). Although there was a trend for a delay in tumor growth ratemediated by the AMG 595 at 1.7 mg/kg (25 mg DM1/kg) dosecompared with the control conjugate, it was not statisticallysignificant (P ¼ 0.1164). AMG 595 significantly delayed tumorgrowth at the 5.6 mg/kg (82 mg DM1/kg; P < 0.0001) and the 17mg/kg (250 mg DM1/kg; P < 0.0001) dose levels compared withcontrol conjugate. From days 35 to 53, all animals treated withAMG595 at 17mg/kg possessed tumors less than 75mm3 in size.There was no significant percent difference in body weight inanimals treatedwith AMG595 at any dose comparedwith controlconjugate (Fig. 5B). Serum concentrations of AMG 595 were doseproportional from 1 to 21 days after administration (Supplemen-tary Fig. S3).

D317 subcutaneous xenograft AMG 595 dose response andretreatment

To assess the ability of AMG 595 to impact tumors thatendogenously express EGFRvIII, mice bearing D317 xenograftswere treated with either a dose response of AMG 595, controlconjugate, or vehicle. AMG595 at the 7.3mg/kg (125mgDM1/kg)dose level inhibited tumor growth compared with both thevehicle and control conjugate–treated cohorts (P < 0.0001; Fig.5C). Tumor regression was observed in all animals treated with14.6 and 22 mg/kg of AMG 595 (250 and 375 mg DM1/kg,respectively; P < 0.0001). At the 22 mg/kg dose level, 7 of10 animals achieved complete regression. No body weight losswas observed in animals throughout the course of the study(Fig. 5D). After an initial response to treatment with AMG 595D317, tumors regrew in some animals. To assess if tumors thatregrew expressed EGFRvIII, tumors were removed from 3 ani-mals, tumor disaggregates were produced and analyzed by flowcytometry. Human tumor cells collected from the recurrentxenografts expressed EGFRvIII (Fig. 5E). To explore if recurrenttumors remained responsive to AMG 595, five tumors thatregrew, ranging in size from 178 to 715 mm3, were retreatedwith two doses of AMG 595 at 22 mg/kg (375 mg DM1/kg)starting 94 days following implant. The five individual tumor

volumes are shown in Fig. 5F from initial treatment to retreat-ment. Immediately following the first retreatment dose, tumorscontinued to grow; however, following the second retreatmentdose, the tumors were all significantly smaller than their largestvolume, three of which were unmeasurable 113 days followingimplant.

Efficacy of AMG 595 in orthotopic D317 GBM modelAn orthotopically implanted intracranial xenograft model of

EGFRvIII-expressing GBM was developed to assess the ability ofAMG 595 tomediate antitumor activity in a tumor growing in thebrain. Three days following stereotactic implant of D317 cells,treatment was initiated with vehicle or AMG 595. All 8 vehicle-treated animals had measurable tumors by MRI 12 days after cellimplant (Fig. 6). Seven of 8 animals treatedwith AMG595 had noevidence of tumor in the brain on day 12. By day 20, tumorvolumes increased in all vehicle-treated animals, with two ani-mals succumbing to disease before the day 20 MRI image. Incontrast, no tumors were observed by MRI in any AMG 595–treated animals on day 20.

DiscussionExploiting molecular targets such as EGFR is one strategy to

develop therapeutics with the potential to improve survival inpatients with GBM. Endogenous expression of EGFR on the skinand other tissues represents a potential source of on-target toxicityor exaggerated phenomenon for an ADC mechanism of actiondirected against wild-type EGFR. The EGFR deletion mutantEGFRvIII provides a bonafide tumor-specific antigen that couldminimize any potential on-target toxicity effects that might beobserved with a wild-type EGFR-targeted conjugate. AlthoughEGFRvIII is only expressed in a subset of GBM patients, it canbe used as a biomarker to prospectively select patients for treat-mentmoving toward personalized therapy (32, 33). The antibodycomponent of AMG 595 was shown to stain GBM samples with ahigh level of correlation with EGFRvIII mRNA indicating a highdegree of specificity for the anti-EGFRvIII Ab used in AMG 595.The sample size of GBM samples examined here was too small toprovide a reliable estimate of EGFRvIII prevalence and wasbeyond the scope of the current study.

Robust internalization is required for noncleavable linker ADCtechnology to be effective (34). The AMG 595/EGFRvIII complexrapidly internalized into the cellular endo-lysosomal pathwayfirst localizing to endosomes followed by time-dependent local-ization in the lysosomes, similar to what has been reported forother ADCs (31, 35, 36). Once in the lysosome, AMG 595 iscatabolized into Lysine-MCC-DM1 (data not shown), similar toother Ab-MCC-DM1 conjugates (37). The potency of the free

Figure 5.Regression of U251vIII and D317 human GBM subcutaneous xenografts following AMG 595 treatment. A and B, U251vIII human GBM cells were subcutaneouslyimplanted into CD-1 nu/nu mice. Mice were randomized into different groups (n ¼ 10) and treated with one of three dose levels of AMG 595: 1.7, 5.6, and17 mg/kg (25, 82, and 250 mg DM1/kg, respectively), or a nontargeted control conjugate at 14.4 mg/kg (250 mg DM1/kg). Tumor volume (mm3; A) and percent initialbody weight (B) are shown. C–F, D317 human GBM cells were subcutaneously implanted into CB-17/SCID mice. Mice were randomized into cohorts of 10mice each and treated with vehicle, 7.3, 14.6, or 22 mg/kg of AMG 595 (125, 250, or 375 mg DM1/kg, respectively), or 26.8 mg/kg of control conjugate(375 mg DM1/kg) once weekly for 4 weeks. C, tumor volume; hash marks depict one animal euthanized due to large tumor volume. D, percent initial body weight.E, three animals in which tumors regrew had tumors removed and assessed for EGFRvIII by flow cytometry (four-digit code represents individual animalnumbers). F, individual tumor volumes for 5 animals that had tumors regrow following initial treatment were retreated with AMG 595; numbers denote the last fourdigits of identification chips (four-digit code represents individual animal numbers). For A and C (tumor volume) and B and D (percent initial body weight),data shown are mean � SEM.






warhead Lysine-MCC-DM1 is much less than AMG 595 onEGFRvIII-expressing cells, demonstrating that the catabolizedwarhead will not lead to significant bystander killing of normalcells which was demonstrated to occur when employing a cleav-able linker byKovtun and colleagues (38). A key factor in selectinga noncleavable linker for AMG 595 was to minimize potentialbystander toxicity of normal cells in the brain.

Two glioblastoma models were evaluated in these experi-ments, U251vIII, a transfected cell line with 484,000 EGFRvIIIreceptors/cell and D317, a patient-derived model with 199,000EGFRvIII receptors/cell (Supplementary Table S1). EndogenousEGFRvIII expression is difficult to maintain in standard cellculture conditions (26, 27), which limited the evaluation ofD317 to in vivo experiments. D317 human GBM xenografts had

a high basal level of phospho-histone H3 which was expectedwith a fast growing tumor such as D317. U251vIII human GBMxenografts grew at a slower rate than D317 human GBMxenografts and had significantly lower basal phospho-histoneH3 levels (data not shown). The increased phospho-histone H3levels following AMG 595 treatment of D317 xenografts dem-onstrated the induction of mitotic arrest, as expected, uponintracellular delivery of a maytansinoid, similar to the anti-tubulin agent vinblastine (39). No dose response was observedwith AMG 595 treatment; however, the dynamic range of theassay was merely 2-fold; to improve the sensitivity of the assayfurther, optimization of the assay itself and the collection timeare likely required. Recent clinical studies testing aurora kinaseinhibitors included exploratory pharmacodynamic endpointsto assess phospho-histone H3 levels in normal skin (40, 41).Preclinical efficacy has been observed with several conjugates,whereas translation into the clinic based on a maximallyeffective minimal dose has been difficult to determine duelargely to the lack of pharmacodynamic markers that can beemployed in preclinical and clinical studies. Incorporation ofpharmacodynamic endpoints, such as phospho-histone H3 inthe case of tubulin inhibitor-based ADCs, into clinical trialsmay lead to improved preclinical to clinical translation.

Comparison of ADC preclinical efficacy is challenging with thedifferent antibody targets, linkers, warheads, tumor type, tumorburden pharmacokinetics, and model relevance. The presence orabsence of bystander activity with cleavable or noncleavablelinkers and thewarhead employed are arguably themost essentialfactors in comparing ADCs. Only a handful of ADCs using theMCC noncleavable linker attached to DM1 have entered clinicaltrials (42), of which only two have reported results, IMGN 529,reported preliminary data in a phase I study (43), and Kadcyla(25). Preclinical efficacy datawere reported inmultiplemodels fortrastuzumab-MCC-DM1 which required 15 mg/kg to generateregressions as a single or multiple dose dependent on the model(44). AMG 595 in vivo dose levels to generate regressions in twosubcutaneous models are within 1.5- to 2-fold compared withtrastuzumab-MCC-DM1.

D317 tumors that initially responded to AMG 595 treatmentand later recurred were shown to express EGFRvIII. Furthermore,retreatment of recurring tumors led to significant reduction oftumor volume, demonstrating that tumors expressed EGFRvIIIand remained responsive to AMG 595 after initial treatment. In aphase II clinical trial exploring the efficacy of an EGFRvIII vaccinein GBMpatients that expressed EGFRvIII, upon recurrence 9 of 11patients were found to lack EGFRvIII expression (45). Sampsonand colleagues measured EGFRvIII expression by IHC, EGFRvIIIhas a precise epitope, and the lack of EGFRvIII staining by IHCcould reflect either the presence of patient-generated anti-EGFR-vIII antibodies blocking the specific EGFRvIII epitope or GBMcells that lack EGFRvIII expression as a result of either eliminationof all EGFRvIII cells or treatment-induced downregulation ofEGFRvIII. Orthogonal methods to verify EGFRvIII protein expres-sion in patients will be necessary to understand themechanism ofthis change in EGFRvIII expression following vaccine treatment.Detailed analysis of clinical samples before and after AMG 595treatment will reveal if patients that respond to AMG 595 con-tinue to express EGFRvIII upon recurrence, similar to what wasobserved preclinically.

The goal of the subcutaneous U251vIII and D317 models wasto demonstrate that targeted delivery of an anti-EGFRvIII ADC

Figure 6.Efficacy of AMG 595 in an EGFRvIII orthotopic model: CB17 SCID mice werestereotactically implanted with D317 cells in the right frontal lobe. Three daysafter cell implant, animals were treated with vehicle or AMG 595 (n ¼ 8/group). MRI was performed on study groups 12 and 20 days followingimplantation. Four representative animals from each group are shown;tumors are indicated with the white circles. Before day 20 (study end), 2animals in the vehicle-treated group succumbed to disease.


Hamblett et al.




could eliminate EGFRvIII-expressing tumor cells specifically.Despite the ability of AMG 595 to generate regression in subcu-taneous tumormodels, one of the potential limitations of treatingbrain tumors is the blood–brain barrier, significantly impairingthe ability of large and small molecules to access the tumor. Incontrast with other diseases in the brain where the blood–brainbarrier remains intact, initial debulking surgery, the subsequentradiation, and the tumor itself are thought to compromise theblood–brain barrier (46). Reports of radiolabeled antibodiesaccumulating in the brain such as the 806 antibody (20) suggestthat in some cases a large molecule can reach tumors within thebrain. Orthotopic models of GBM in mice cannot completelymimic the human disease; however, they can provide a closerapproximation compared with subcutaneous xenograft models.Despite the approximatemolecularweight of AMG595at 150kD,which is expected to be excluded from entry into the brain by theblood–brain barrier, it was encouraging that AMG 595 mediatedinhibition of tumor growth in the D317 orthotopic GBMmodel.One of the limitations of this orthotopic D317 experiment wasinitiation of AMG 595 treatment was 3 days following implant,which may only allow partial reformation of the blood–brainbarrier for the first dose of AMG 595. The efficacy of AMG 595 inestablished orthotopic tumors will be explored in a future pub-lication. Ultimately, the only way to address if AMG 595 canaccess GBM tumors in the brain is by testing the hypothesis in acarefully designed clinical trial.

The tumor-specific nature of EGFRvIII, internalization, andminimal potency as an unmodified anti-EGFRvIII antibodymake EGFRvIII an attractive target to explore with a selectiveADC. In this report, we described the generation of an anti–EGFRvIII-specific fully human ADC, AMG 595. AMG 595demonstrated potent efficacy in vitro and in preclinical subcu-taneous models/orthotopic model of GBM. The ability to targetEGFRvIII-expressing GBM cells is an attractive option forpatients and warrants clinical exploration. Currently, AMG595 is being tested in a phase I clinical trial enrolling patientsshown to have a GBM that expresses EGFRvIII, with early signsof efficacy (47).

Disclosure of Potential Conflicts of InterestK.J. Hamblett, C.J. Kozlosky, S. Siu, W.S. Chang, I.N. Foltz, E.S. Trueblood, B.

Twomey, J.S. Hill, and W.C. Fanslow have ownership interest (includingpatents) in Amgen. No potential conflicts of interest were disclosed by theother authors.

Authors' ContributionsConception and design: K.J. Hamblett, C.J. Kozlosky, W.S. Chang, J.S. Hill,W.C. FanslowDevelopment of methodology: K.J. Hamblett, C.J. Kozlosky, W.S. Chang,H. Liu, E.S. Trueblood, D. Meininger, T. Arora, S.L. Vonderfecht, Q. Chen,J.S. Hill, W.C. FanslowAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): K.J. Hamblett, C.J. Kozlosky, S. Siu, W.S. Chang,H. Liu, E.S. Trueblood, D. Meininger, B. Twomey, S.L. Vonderfecht,W.C. FanslowAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): K.J. Hamblett, C.J. Kozlosky, W.S. Chang, H. Liu,E.S. Trueblood, D. Meininger, B. Twomey, S.L. Vonderfecht, Q. Chen, J.S. Hill,W.C. FanslowWriting, review, and/or revision of the manuscript: K.J. Hamblett,C.J. Kozlosky, S. Siu,W.S. Chang,H. Liu, I.N. Foltz, B. Twomey, S.L. Vonderfecht,J.S. Hill, W.C. FanslowAdministrative, technical, or material support (i.e., reporting or organizingdata, constructing databases): S. Siu, J.S. Hill, W.C. FanslowStudy supervision: K.J. Hamblett, J.S. Hill, W.C. FanslowOther (antibody generation efforts for AMG 595): I.N. Foltz

AcknowledgmentsThe authors thank Dr. Darell Bigner for providing the cell lines and patient

tumor samples, Amgen Burnaby for the generation of the anti-EGFRvIII anti-body, ImmunoGen Inc. for supplying DM1, Chris Hale for assistance incolocalization analysis, and Oncodesign for performing the orthotopic D317GBM experiment.

Grant SupportThis research was funded by Amgen, Inc.The costs of publication of this article were defrayed in part by the

payment of page charges. This article must therefore be hereby markedadvertisement in accordance with 18 U.S.C. Section 1734 solely to indicatethis fact.

ReceivedDecember 17, 2014; revised April 23, 2015; accepted April 23, 2015;published OnlineFirst April 30, 2015.

References1. Siegel R, Ma J, Zou Z, Jemal A. Cancer statistics, 2014. CA Cancer J Clin

2014;64:9–29.2. Stupp R, Hegi ME, Mason WP, van den Bent MJ, Taphoorn MJ, Janzer RC,

et al. Effects of radiotherapywith concomitant and adjuvant temozolomideversus radiotherapy alone on survival in glioblastoma in a randomisedphase III study: 5-year analysis of the EORTC-NCIC trial. Lancet Oncol2009;10:459–66.

3. Stupp R, Mason WP, van den Bent MJ, Weller M, Fisher B, Taphoorn MJ,et al. Radiotherapy plus concomitant and adjuvant temozolomide forglioblastoma. N Engl J Med 2005;352:987–96.

4. Moustakas A, Kreisl TN. New treatment options in the management ofglioblastoma multiforme: a focus on bevacizumab. OncoTargets Ther2010;3:27–38.

5. Verhaak RG, Hoadley KA, Purdom E, Wang V, Qi Y, Wilkerson MD, et al.Integrated genomic analysis identifies clinically relevant subtypes of glio-blastoma characterized by abnormalities in PDGFRA, IDH1, EGFR, andNF1. Cancer Cell 2010;17:98–110.

6. O'Dwyer PJ, Benson AB 3rd. Epidermal growth factor receptor-targetedtherapy in colorectal cancer. Semin Oncol 2002;29:10–7.

7. Kalyankrishna S, Grandis JR. Epidermal growth factor receptor biology inhead and neck cancer. J Clin Oncol 2006;24:2666–72.

8. Bigner SH, Burger PC, Wong AJ, Werner MH, Hamilton SR, MuhlbaierLH, et al. Gene amplification in malignant human gliomas: clinical

and histopathologic aspects. J Neuropathol Exp Neurol 1988;47:191–205.

9. Jeuken J, Sijben A, Alenda C, Rijntjes J, Dekkers M, Boots-Sprenger S, et al.Robust detection of EGFR copy number changes and EGFR variant III:technical aspects and relevance for glioma diagnostics. Brain Pathol 2009;19:661–71.

10. Weller M, Kaulich K, Hentschel B, Felsberg J, Gramatzki D, Pietsch T,et al. Assessment and prognostic significance of the epidermal growthfactor receptor vIII mutation in glioblastoma patients treated withconcurrent and adjuvant temozolomide radiochemotherapy. Int J Can-cer 2014;134:2437–47.

11. Wong AJ, Ruppert JM, Bigner SH, Grzeschik CH, Humphrey PA,Bigner DS, et al. Structural alterations of the epidermal growth factorreceptor gene in human gliomas. Proc Natl Acad Sci U S A 1992;89:2965–9.

12. NicholasMK, Lukas RV, Jafri NF, Faoro L, Salgia R. Epidermal growth factorreceptor - mediated signal transduction in the development and therapy ofgliomas. Clin Cancer Res 2006;12:7261–70.

13. PedersenMW,MeltornM, Damstrup L, PoulsenHS. The type III epidermalgrowth factor receptor mutation. Biological significance and potentialtarget for anti-cancer therapy. Ann Oncol 2001;12:745–60.

14. Wikstrand CJ, Reist CJ, Archer GE, Zalutsky MR, Bigner DD. The class IIIvariant of the epidermal growth factor receptor (EGFRvIII):






characterization and utilization as an immunotherapeutic target. J Neu-rovirol 1998;4:148–58.

15. Biernat W, Huang H, Yokoo H, Kleihues P, Ohgaki H. Predominantexpression of mutant EGFR (EGFRvIII) is rare in primary glioblastomas.Brain Pathol 2004;14:131–6.

16. Wikstrand CJ, Hale LP, Batra SK, Hill ML, Humphrey PA, Kurpad SN, et al.Monoclonal antibodies against EGFRvIII are tumor specific and react withbreast and lung carcinomas and malignant gliomas. Cancer Res 1995;55:3140–8.

17. Yoshimoto K, Dang J, Zhu S, Nathanson D, Huang T, Dumont R, et al.Development of a real-time RT-PCR assay for detecting EGFRvIII inglioblastoma samples. Clin Cancer Res 2008;14:488–93.

18. Mellinghoff IK, WangMY, Vivanco I, Haas-Kogan DA, Zhu S, Dia EQ, et al.Molecular determinants of the response of glioblastomas to EGFR kinaseinhibitors. N Engl J Med 2005;353:2012–24.

19. Del Vecchio CA, Li G, Wong AJ. Targeting EGF receptor variant III: tumor-specific peptide vaccination for malignant gliomas. Expert Rev Vaccines2012;11:133–44.

20. Scott AM, Lee FT, Tebbutt N, Herbertson R, Gill SS, Liu Z, et al. A phase Iclinical trial with monoclonal antibody ch806 targeting transitional stateand mutant epidermal growth factor receptors. Proc Natl Acad Sci U S A2007;104:4071–6.

21. Niwa R, Sakurada M, Kobayashi Y, Uehara A, Matsushima K, Ueda R, et al.Enhanced natural killer cell binding and activation by low-fucose IgG1antibody results in potent antibody-dependent cellular cytotoxicity induc-tion at lower antigen density. Clin Cancer Res 2005;11:2327–36.

22. Molhoj M, Crommer S, Brischwein K, Rau D, SriskandarajahM, HoffmannP, et al. CD19-/CD3-bispecific antibody of the BiTE class is far superior totandem diabody with respect to redirected tumor cell lysis. Mol Immunol2007;44:1935–43.

23. Alley SC, Okeley NM, Senter PD. Antibody-drug conjugates: targeted drugdelivery for cancer. Curr Opin Chem Biol 2010;14:529–37.

24. Senter PD, Sievers EL. The discovery and development of brentuximabvedotin for use in relapsed Hodgkin lymphoma and systemic anaplasticlarge cell lymphoma. Nat Biotechnol 2012;30:631–7.

25. Verma S, Miles D, Gianni L, Krop IE, Welslau M, Baselga J, et al. Trastu-zumab emtansine for HER2-positive advanced breast cancer. N Engl J Med2012;367:1783–91.

26. Bigner SH, Humphrey PA, Wong AJ, Vogelstein B, Mark J, Friedman HS,et al. Characterization of the epidermal growth factor receptor in humanglioma cell lines and xenografts. Cancer Res 1990;50:8017–22.

27. PanditaA, AldapeKD, ZadehG,GuhaA, JamesCD.Contrasting in vivo andin vitro fates of glioblastoma cell subpopulations with amplified EGFR.Genes Chromosomes Cancer 2004;39:29–36.

28. Mendez MJ, Green LL, Corvalan JR, Jia XC, Maynard-Currie CE, Yang XD,et al. Functional transplant of megabase human immunoglobulin locirecapitulates humanantibody response inmice.NatGenet 1997;15:146–56.

29. Babcook JS, Leslie KB, OlsenOA, Salmon RA, Schrader JW. A novel strategyfor generating monoclonal antibodies from single, isolated lymphocytesproducing antibodies of defined specificities. Proc Natl Acad Sci U S A1996;93:7843–8.

30. Chari RV, Martell BA, Gross JL, Cook SB, Shah SA, Blattler WA, et al.Immunoconjugates containing novel maytansinoids: promising antican-cer drugs. Cancer Res 1992;52:127–31.

31. Polson AG, Yu SF, Elkins K, Zheng B, Clark S, Ingle GS, et al. Antibody-drugconjugates targeted toCD79 for the treatment of non-Hodgkin lymphoma.Blood 2007;110:616–23.

32. Cloughesy TF, Cavenee WK, Mischel PS. Glioblastoma: from molecularpathology to targeted treatment. Annu Rev Pathol 2014;9:1–25.

33. Olar A, Aldape KD. Using the molecular classification of glioblastoma toinform personalized treatment. J Pathol 2014;232:165–77.

34. Polson AG, Calemine-Fenaux J, Chan P, Chang W, Christensen E, ClarkS, et al. Antibody-drug conjugates for the treatment of non-Hodgkin'slymphoma: target and linker-drug selection. Cancer Res 2009;69:2358–64.

35. Law CL, Gordon KA, Toki BE, Yamane AK, Hering MA, Cerveny CG, et al.Lymphocyte activation antigenCD70 expressed by renal cell carcinoma is apotential therapeutic target for anti-CD70 antibody-drug conjugates. Can-cer Res 2006;66:2328–37.

36. Sutherland MS, Sanderson RJ, Gordon KA, Andreyka J, Cerveny CG, Yu C,et al. Lysosomal trafficking and cysteine proteasemetabolism confer target-specific cytotoxicity by peptide-linked anti-CD30-auristatin conjugates.J Biol Chem 2006;281:10540–7.

37. Erickson HK, Park PU, Widdison WC, Kovtun YV, Garrett LM, Hoffman K,et al. Antibody-maytansinoid conjugates are activated in targeted cancercells by lysosomal degradation and linker-dependent intracellular proces-sing. Cancer Res 2006;66:4426–33.

38. Kovtun YV, Audette CA, Ye Y, Xie H, Ruberti MF, Phinney SJ, et al.Antibody-drug conjugates designed to eradicate tumors with homoge-neous and heterogeneous expression of the target antigen. Cancer Res2006;66:3214–21.

39. Juan G, Traganos F, James WM, Ray JM, Roberge M, Sauve DM, et al.Histone H3 phosphorylation and expression of cyclins A and B1measuredin individual cells during their progression through G2 and mitosis.Cytometry 1998;32:71–7.

40. DittrichC, FridrikMA, Koenigsberg R, LeeC,Goeldner RG,Hilbert J, et al. Aphase 1 dose escalation study of BI 831266, an inhibitor of Aurora kinase B,in patients with advanced solid tumors. Investigational New Drugs2015;33:409–22.

41. Moreno L, Marshall LV, Pearson AD, Morland B, Elliott M, Campbell-Hewson Q, et al. A phase I trial of AT9283 (a Selective Inhibitor of AuroraKinases) in children and adolescents with solid tumors: A Cancer ResearchUK Study. Clin Cancer Res 2015;21:267–73.

42. Mullard A. Maturing antibody-drug conjugate pipeline hits 30. Nat RevDrug Discov 2013;12:329–32.

43. Stathis A, Freedman AS, Flinn IW, Maddocks KJ, Weitman S, Berdeja JG,et al. A phase I study of IMGN529, an antibody-drug conjugate (ADC)targeting CD37, in adult patients with relapsed or refractory B-cell Non-Hodgkin's Lymphoma (NHL). Blood 2014;124:1760.

44. Lewis Phillips GD, Li G, Dugger DL, Crocker LM, Parsons KL, Mai E,et al. Targeting HER2-positive breast cancer with trastuzumab-DM1,an antibody-cytotoxic drug conjugate. Cancer Res 2008;68:9280–90.

45. Sampson JH, Heimberger AB, Archer GE, Aldape KD, Friedman AH,Friedman HS, et al. Immunologic escape after prolonged progression-freesurvival with epidermal growth factor receptor variant III peptide vacci-nation in patients with newly diagnosed glioblastoma. J Clin Oncol2010;28:4722–9.

46. Grossman SA, Batara JF.Currentmanagementof glioblastomamultiforme.Semin Oncol 2004;31:635–44.

47. Santostefano M, Engwall M, Everds N, Guzman R, Chow V, Upreti V, et al.AMG 595: a novel ADC with therapeutic potential in glioblastoma. 35thAnnual Meeting of the American College of Toxicology Program; 2014;Orlando, FL.


Hamblett et al.




2015;14:1614-1624. Published OnlineFirst April 30, 2015.Mol Cancer Ther Kevin J. Hamblett, Carl J. Kozlosky, Sophia Siu, et al. GlioblastomaPotent Antitumor Activity against EGFRvIII-Expressing

Drug Conjugate, Induces−AMG 595, an Anti-EGFRvIII Antibody

Updated version

10.1158/1535-7163.MCT-14-1078doi:

Access the most recent version of this article at:

Material

Supplementary

http://mct.aacrjournals.org/content/suppl/2015/05/02/1535-7163.MCT-14-1078.DC1

Access the most recent supplemental material at:

Cited articles

http://mct.aacrjournals.org/content/14/7/1614.full#ref-list-1

This article cites 46 articles, 19 of which you can access for free at:

Citing articles

http://mct.aacrjournals.org/content/14/7/1614.full#related-urls

This article has been cited by 5 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://mct.aacrjournals.org/content/14/7/1614To request permission to re-use all or part of this article, use this link



http://mct.aacrjournals.org/lookup/doi/10.1158/1535-7163.MCT-14-1078

http://mct.aacrjournals.org/content/suppl/2015/05/02/1535-7163.MCT-14-1078.DC1

http://mct.aacrjournals.org/content/14/7/1614.full#ref-list-1

http://mct.aacrjournals.org/content/14/7/1614.full#related-urls

http://mct.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://mct.aacrjournals.org/content/14/7/1614


AMG 595, an Anti-EGFRvIII Antibody Drug Conjugate ......Large Molecule Therapeutics AMG 595, an...

Documents

Transcript of AMG 595, an Anti-EGFRvIII Antibody Drug Conjugate ......Large Molecule Therapeutics AMG 595, an...