ARTICLE IN PRESS

Journal of Plant Physiology 164 (2007) 718—727

0176-1617/$ - sdoi:10.1016/j.

Abbreviationreactive oxyge�CorrespondE-mail addr

www.elsevier.de/jplph

Alternative oxidase regulation in roots ofVigna unguiculata cultivars differing indrought/salt tolerance

Jose Helio Costaa, Yves Jolivetb, Marie-Paule Hasenfratz-Sauderb,Elena Graciela Orellanoc, Maria da Guia Silva Limaa,Pierre Dizengremelb, Dirce Fernandes de Meloa,�

aDepartment of Biochemistry and Molecular Biology, Federal University of Ceara, P.O. Box 6029,60455-760 Fortaleza Ceara, BrazilbUMR 1137 INRA-UHP Nancy 1, Ecologie et Ecophysiologie Forestieres, BP 239, 54506 Vandœuvre-les-Nancy, FrancecFacultad Ciencias Bioquımicas y Farmaceuticas, Universidad Nacional de Rosario, Suipacha 531, Argentina

Received 10 January 2006; accepted 5 April 2006

KEYWORDSAlternative oxidase;Gene regulation;Mitochondria;Osmotic stress;Vigna unguiculata

ee front matter & 2006jplph.2006.04.001

s: Aox, alternative oxin speciesing author. Tel.: +55 85ess: dirmelo@ufc.br (D.

SummaryThe alternative oxidase (Aox) was studied at different levels (transcript, protein andcapacity) in response to an osmotic shock applied to roots of cowpea (Vignaunguiculata). Two cultivars of V. unguiculata were used, Vita 3 and Vita 5, tolerantand sensitive to drought/saline stress respectively. The seedlings (17-day-old) weregrown in hydroponic conditions and submitted to NaCl (100 and 200mM) or200.67 g L�1 PEG 6000 (iso-osmotic condition to 100mMNaCl). The VuAox1 andVuAox2a mRNA were not detected in either cultivar under all tested conditions whilethe VuAox2b gene was differently expressed. In the tolerant cultivar (Vita 3), theexpression of VuAox2b gene was stimulated by an osmotic stress induced by PEGwhich was associated with a higher amount and capacity of the Aox protein. In thesame cultivar, this gene was under-expressed in salt stress conditions with pooreffect on the protein level. In the sensitive cultivar (Vita 5), the transcript level ofthe VuAox2b was unchanged in response to PEG treatment, even though the proteinand the capacity tended to increase. Upon salt stress, the VuAox2b gene was over-expressed. At 100mM NaCl, this VuAox2b gene over-expression led to a higheramount and capacity of Aox. This effect was reduced at 200mMNaCl. Overall, these

Elsevier GmbH. All rights reserved.

dase; DTT, dithiothreitol; PEG, polyethylene glycol; PG, n-propylgallate; pyr, pyruvate; ROS,

40089825; fax: +55 85 40089829.Fernandes de Melo).

ARTICLE IN PRESS

Alternative oxidase regulation in Vigna unguiculata 719

results suggest complex mechanisms (transcriptional, translational and post-translational) for Aox regulation in response to osmotic stress.& 2006 Elsevier GmbH. All rights reserved.

Introduction

Vigna unguiculata (Cowpea) is a leguminous plantknown to offer good nutritional properties based onits seed protein content and to be both responsiveto favourable growing conditions and one of themost widely adapted culture to drought, hightemperatures, and other abiotic stress (Ehlers andHall, 1997). In response to salinity or drought,different cultivars have been characterised accord-ing to their level of tolerance like Vita 3, consideredas tolerant while Vita 5 is recognised as a sensitivecultivar (Fernandes de Melo et al., 1994).

High salinity and drought are common stressconditions that adversely affect plant growth andcrop production (Xiong et al., 2002). In both cases,the ability of plants to take up water is reduced andthis quickly causes reductions in growth rate, alongwith a cascade of metabolic changes (Munns, 2002).Various biochemical and physiological responses areinduced in order to help the plant to survive (Sekiet al., 2003). Among these changes, salinity anddrought generate reactive oxygen species (ROS)including superoxide radicals (O2

�), hydrogen per-oxide (H2O2) and hydroxyl radicals (OHd) (Hasegawaet al., 2000). ROS, products of altered chloroplastand mitochondrial metabolism during stress, causeoxidative damage to different cellular componentsincluding membrane lipids, proteins and nucleicacids (Haliwell and Gutteridge, 1986). The allevia-tion of this oxidative damage could provideenhanced plant resistance to salt stress (Apse andBlumwald, 2002). As it is well known, plantmitochondria possess a specific electron pathway,cyanide resistant, mediated by the alternativeoxidase (Aox). This enzyme branches from the mainrespiratory chain at the level of ubiquinone. Itsactivity in vitro is dependent on substrate level,ubiquinone concentration as well as its redox poise,on redox state of Aox and a-keto acid level, mainlypyruvate (pyr) (Siedow and Umbach, 2000). Indeed,it would be expected that a higher concentration ofAox protein would result in a higher Aox activity.However, there is no direct correlation betweenAox protein abundance and its activity or engage-ment in respiration (Juszczuk and Rychter, 2003).The role of Aox in non-thermogenic plants remainsunclear but, in the last few years, it has beenconsistently attributed to lower mitochondrial ROS

formation in plant cells (Purvis, 1997; Maxwell etal., 1999; Robson and Vanlerberghe, 2002).

In higher plants, a small Aox gene family exists.The multigene family encoding Aox consists of twodiscrete subfamilies: Aox1-type and Aox2-typegenes (Whelan et al., 1996). In both groups, Aoxgenes are differentially expressed in response toenvironmental, developmental, and other cellsignals (Finnegan et al., 1997; Saisho et al., 1997,2001; McCabe et al., 1998; Considine et al., 2001;Saika et al., 2002). The functioning of Aox2-typeproteins would be linked to developmental pro-cesses, while the Aox1-type proteins would bepreferentially induced in stress conditions (Con-sidine et al., 2002). However, very recently, thedramatic response of Aox2 to a specific subset oftreatment conditions also indicated a role for Aox2in stress responses (Clifton et al., 2005).

Previously, two Aox2-type genes were identifiedin V. unguiculata and these genes are orthologousto soybean Aox genes 2a and 2b (Costa et al.,2004). In this paper, the expression of the Aoxgenes, and the amount and capacity of Aox proteinwere studied in roots of Vita 3 and Vita 5 cultivarsin relation to plant response towards unfavourableconditions (salt and PEG stress).

Materials and methods

Plant material and stress conditions

Vita 3 and Vita 5 cowpea seeds (V. unguiculata(L.) Walp) were obtained from the seed bank of theDepartamento de Fitotecnia, Universidade Federaldo Ceara. Fortaleza, Ceara, Brasil. Seeds weresurface sterilised for 5min in 0.5% (w/v) CaOCl,rinsed with water, and germinated in the dark, at25 1C, on filter paper soaked with distilled water.After 3 days, the seedlings were transferred tohydroponics systems and transported to a con-trolled growth chamber with a light intensity of200 mEm�2 s�1 at leaf level, a 14 h photoperiod,temperatures of 24 1C (day) and 20 1C (night) and70% relative humidity. The seedlings were grownin Knop medium (1.44 g L�1 Ca(NO3)2, 0.25 g L�1

KNO3, 0.25 g L�1 KH2PO4 and 0.246 g L�1 MgSO4 �

7H2O) with micronutrients (65.7mg L�1 FeEDTA,

ARTICLE IN PRESS

J.H. Costa et al.720

2.86mg L�1 H3BO3, 2.84mg L�1 MnCl2 4H2O,0.286mg L�1 Na2O4Mo 2H2O, 0.22mg L�1 ZnSO4

7H2O, 0.079mg L�1 CuSO4 5H2O and 0.0476mg L�1

CoSO4 7H2O) and the osmotic stress was inducedafter 10 days of germination by adding NaCl (100and 200mM) or polyethylene glycol (PEG) 6000(200.67 g L�1) in the nutrient medium. The 200mMNaCl treatment was applied by addition of twice100mM NaCl within an interval of 24 h. After 7 daysof osmotic stress, the roots were rinsed 2min indistilled water at 4 1C. The roots were used toisolate mitochondria or immediately frozen inliquid nitrogen and stored at �80 1C before extrac-tion of total RNA.

Isolation of purified mitochondria

Mitochondria were isolated from roots of freshplants. Roots (ca. 70 g) were cut into 350mL of coldextraction medium containing 0.45M mannitol,5.0mM Dithiothreitol (DTT), 5.0mM EDTA, 1% (w/v) BSA and 30mM MOPS buffer, the pH beingadjusted to 7.4. They were homogenised for 7minin a cold mortar and the homogenate was filteredthrough a 150 mm nylon net and submitted todifferential centrifugation according to Silva Limaand Pinheiro (1975). The washing medium con-tained 0.45M mannitol, 1mM EDTA, 0.5% (w/v) BSAand 10mM MOPS buffer, pH 7.2. Mitochondriapurification was performed in a discontinuousPercoll gradient as previously described by Cornuet al. (1996).

Oxygen uptake

Oxygen uptake was followed polarographicallywith a Clark electrode (Hansatech) at 25 1C.Respiratory studies were performed in 1.0mL ofreaction medium containing 0.45M mannitol, 5mMMgCl2, 10mM KCl, 0.1% (w/v) BSA and 10mMKH2PO4, pH 7.2. The oxidation of exogenous NADH(1mM) was measured with 100 mg of mitochondrialprotein. Potassium cyanide (800 mM) and n-propyl-gallate (PG) (100 mM) were used as inhibitors of thecytochrome and the alternative pathways, respec-tively. DTT (10mM) was added to reduce the Aoxand pyr (1mM) was used to stimulate the reducedform of Aox. Protein concentration was determinedby the procedure of Bradford (1976).

Electrophoresis and protein blot analysis

Analytical polyacrylamide gel electrophoresis inthe presence of SDS (SDS–PAGE) was carried out in aBio-Rad Mini-PROTEAN II cell. Samples of purified

mitochondria were previously diluted 1:10 in wash-ing medium (BSA-free), homogenised and pelletedin a microcentrifuge at 10,000g for 10min at 4 1C.The mitochondrial pellets were suspended in thewashing medium (BSA-free) and the protein con-centration was determined. Mitochondrial fraction(5mg) was mixed in a 50mL volume of sample buffer(2% SDS (w/v), 10% (v/v) glycerol, 100mM Tris–HCl,pH 6.8, and 0.01% (w/v) bromophenol blue) andboiled for 5min. Electrophoresis of these samples(5mg of protein loaded for each lane) was carriedout with the buffer system of Laemmli (1970) usinga 4.5% (w/v) stacking gel and a 10% (w/v)polyacrylamide resolving gel. After 30min-proteintransfer (180mA) in a Trans blot SD Semi DryTransfer Cell, the nitro-cellulose membrane wasprobed with a 1:500 dilution of a monoclonalantibody raised against the Aox proteins of Saur-omatum guttatum, Schott (Aox monoclonal anti-bodies from GT Monoclonal Antibodies GTMA).Immune-reactivity was detected with an enhancedchemiluminescence method (Renaissance, NEN Du-Pont, Boston, MA). The density of the bands wasanalysed with Scion Image, Release beta 3b soft-ware (Scion Corporation, USA).

Extraction of total RNA and RT-PCR

Two hundred milligram of roots were powderedwith liquid nitrogen in a mortar with a pestle. TotalRNA was then extracted using the RNeasy plant minikit according to the manufacturer protocol (Qiagen,Hilden, Germany). Total RNA (1.5mg) from eachsample was heated to 70 1C in a water bath for10min, cooled 2min on ice and used for reversetranscription. Semi-quantitative RT-PCR was per-formed using the Ready To Go RT-PCR beads kit(Pharmacia) with specific primers for each Aox geneand it was concomitantly controlled by amplificationof V. unguiculata actin cDNA. The VuAox1 primerswere obtained from the gene sequence (accessnumber: DQ100440) while the VuAox2a, VuAox2band actin primers were obtained according to Costaet al. (2004). The primer sequences were: VuAox1sense: 50 ATGATGATGAGTCGCAGC 30 and antisense:50 TTGTCCAATTCCTTGAGGA 30; VuAox2a sense:50 GCATTGAGTTGTACGGTTCG 30 and antisense: 50

TGGTAAAGGACTGTACTAAGC 30; VuAox2b sense: 50

GGATGTCCACTCTTCCAGAC 30 and antisense: 50 GC-TCAATGGTAACCAATAGG 30; Actin sense: 50

GCGTGATCTCACTGATGCC 30 and antisense: 50 TCGC-AATCCACATCTGTTGG 30. The thermal cycling pro-gram performed to maximize the amplification speci-ficity was: 40min at 42 1C (reverse transcription),followed by 30 cycles of amplification, each one of

ARTICLE IN PRESS

Alternative oxidase regulation in Vigna unguiculata 721

1min at 92 1C (denaturation), then 1min at 55 1C(annealing), and 2min at 72 1C (elongation). Afterthe last cycle, the 72 1C elongation step wasextended to 10min. The RT-PCR products wereanalysed by electrophoresis in a 1.5% (w/v) agarosegel, stained with ethidium bromide and photo-graphed with a gel imaging system (itf labortech-nik-Germany). To compare the level of expression ofAox mRNA against the reference gene Actin mRNAdata, the image analysis was employed. The densityof the bands was analysed with Scion Image, Releasebeta 3b software (Scion Corporation, USA).

Results

Alternative oxidase gene expression

Figure 1 shows the transcript levels of VuAox2b inthe roots of two cultivars of V. unguiculata, Vita 3and Vita 5, after 7 days of stress (100, 200mM NaCl

2.8

VuAox2b

actin

Co

ntr

ol

100m

M N

aCl

200m

M N

aCl

20

2.4

2.0

Vita

1.6

1.2

0.8

0.4

0Control

Rel

ativ

e in

teg

rate

d d

ensi

ty(V

uA

ox2b

cD

NA

/ A

ctin

cD

NA

)

100mM Na

Vita 3

(A)

(B)

Figure 1. Analysis of VuAox2b transcripts in roots of Vigna ugermination and 7 days of stress. (A) RT-PCR products of VuAbromide. (B) Relative quantity of VuAox2b transcripts obtaincDNA and Actin cDNA bands. Data were reproducible in thre

or 200.67 g L�1 PEG). The specificity of Aox2-typegene primers was tested using plasmids containingAox2a and Aox2b inserts by PCR while the Aox1primers specificity was certified after amplificationby RT-PCR and sequencing of the cDNA fromcotyledons (access number DQ100441). Actin cDNAamplification was used as a constitutive control. NoRT-PCR products of VuAox1 and VuAox2a weredetected in both cultivars under all tested condi-tions. On the contrary, the level of VuAox2b geneexpression differed in response to the osmoticstress applied and according to the cultivar(Fig. 1A). The amount of VuAox2b transcripts hasbeen normalised through a ratio of integrateddensities of the VuAox2b and Actin cDNA bands(Fig. 1B). In control conditions, the VuAox2btranscript level was higher in Vita 3 than in Vita 5cultivar. For Vita 3, it drastically decreased at 100and 200mM NaCl while it increased in response toan osmotic stress induced by PEG. For Vita 5, thetranscript level was higher in salt stress conditions,

0.67

g L

-1 P

EG

Co

ntr

ol

100m

M N

aCl

200m

M N

aCl

200.

67 g

L-1

PE

G

3 Vita 5

Cl 200mM NaCl 200.67 g L-1 PEG

Vita 5

nguiculata cultivars, Vita 3 and Vita 5, after 17 days ofox2b and Actin on 1.5% agarose gel stained with ethidiumed through a ratio of integrated densities of the VuAox2be experiments.

ARTICLE IN PRESS

J.H. Costa et al.722

particularly at 100mM NaCl, while PEG stresscondition did not modify the expression profile.

Alternative oxidase protein level

The Aox was detected by immunoblotting ofpurified protein mitochondria (Fig. 2). In all studiedconditions, the Aox protein was mainly detected inthe oxidised form (ca. 70 kDa) (Fig. 2A). However,in response to the osmotic stress and for bothcultivars, the level of the Aox reduced form (ca.35 kDa) increased. In control conditions, the Aoxamount, oxidised plus reduced forms, is higher inVita 3 compared to Vita 5 and such profile wasobserved in all tested conditions (Fig. 2B). In bothcultivars, there was an increase in the protein levelunder 100mM NaCl, however it was greater in Vita5 than in Vita 3 as compared to respective controls.

Control

Control

Inte

gra

ted

den

sity

of

ban

ds

(oxi

dis

ed p

lus

red

uce

d A

ox fo

rms)

0

100

200

30

34.7

51.8

80

V3 V5 VV3

116(kDa)

300

400

500

600

700

800

900

1000

100m

100 mM Na

(A)

(B)

Figure 2. Immunoblot analysis of Aox protein from root purifiand 7 days after the submission to the stress. (A) SDS-gel bloloaded in each lane. Numbers before the arrows indicate the(B) Measure of intensity of the Aox bands in all conditions (oxbeta 3b software (Scion Corporation, USA). Data are the ave

Under 200mM NaCl, the level of Aox protein wasidentical to the one in control condition for Vita 3and Vita 5 cultivars. Higher Aox amounts weredetected in the presence of PEG for both cultivars,to reach the level got for the 100mM NaCltreatment.

Alternative oxidase capacity

The oxygen uptake of Vita 3 (Fig. 3A) and Vita 5(Fig. 3B) in purified mitochondria was measured incontrol and stress conditions with NADH as sub-strate. Cyanide addition allowed determining theelectron pathway using the Aox, thus revealing abasal Aox capacity. To obtain a full Aox capacity,it is necessary to consider the oxygen uptakeafter protein activation with pyr. However, thisactivation is only possible when the protein is in the

Vita 3

5 V5V3 V5V3

Vita 5

M NaCl 200mM NaCl 200.67 g L-1 PEG

Cl 200 mM NaCl 200.67 g L-1 PEG

ed mitochondria of 17-day-old Vigna unguiculata cultivarst of 5 mg of total protein from Vita 3 (V3) and Vita 5 (V5)molecular masses (kDa) of the standard protein markers.idised plus reduced forms) using the Scion Image-Releaserage values7SD of three independent experiments.

ARTICLE IN PRESS

Figure 3. Respiration of purified mitochondria isolated from 17-day-old roots and 7 days of stress of the Vita 3 (A) andVita 5 (B) cultivars. Numbers along the traces refer to rates of O2 uptake (nmolO2mg protein�1min�1). Data representthe more similar traces of the averages of three independent mitochondria preparations.

Alternative oxidase regulation in Vigna unguiculata 723

reduced state. The subsequent addition of DTTallowed the Aox to reach this state. In everycondition, the addition of pyr after KCN stimulatedthe cyanide-resistant oxygen consumption in a ratiobetween 2.2 and 3.9 (Fig. 3). The highest stimula-tion was observed for control mitochondria of thetwo cultivars. The addition of DTT after pyr, poorlystimulated the activated state of the Aox (in a ratioaround 1.4) and the effect was only got in controland 100mM NaCl conditions, in both cultivars (Fig.3). At last, the addition of PG (a specific Aoxinhibitor) fully inhibited the oxygen uptake, allow-ing to check that the cyanide resistance is linked tothe Aox activity (Fig. 3). The full Aox capacity is

represented in Fig. 4 taking into account anaverage of three independent mitochondrial as-says. Two conditions severely modified the level ofAox capacity in an opposite way. In response to100mM NaCl, the full capacity diminished for Vita3, while, in the same stress condition, it signifi-cantly increased for Vita 5. A more drastic osmoticshock (200mM NaCl or PEG) tended to decrease thefull Aox capacity for Vita 5.

Discussion

Recently, Aox1 (accession number DQ100440) andAox2-type genes (Costa et al., 2004), encoding

ARTICLE IN PRESS

Control0

20

40

60

80

100

120

140

160

180

nm

ol O

2 m

g p

rote

in-1

min

-1

100 mM NaCl 200 mM NaCl 200.67 g L-1 PEG

Vita 3 Vita 5

Figure 4. Aox capacity after addition of KCN, pyruvateand DTT in purified mitochondria from roots of 17-day-oldVigna unguiculata cultivars (Vita 3 and Vita 5) and 7 daysof stress in the presence of NADH as substrate. Data of O2

uptake are the average values7SD from the respiratorymeasurements of three independent mitochondria pre-parations.

J.H. Costa et al.724

mitochondrial Aoxs in V. unguiculata have beencharacterised. The Aox2-type genes have beenfound to be orthologous to soybean Aox genes 2aand 2b (Costa et al., 2004). In roots, VuAox1 andVuAox2a transcripts were not detected, even underosmotic stress induced by NaCl or PEG treatments.Concerning the result obtained with VuAox1, itdiffers from the induction of Aox1 found in soybeanobtained under stress conditions in suspensioncells, and in infected nitrogen fixing nodules ofsoybean roots (Millar et al., 1997; Djajanegaraet al., 2002). In soybean tissues, Aox1 has beendetected almost exclusively in cotyledons (Tanudjiet al., 1999) and expressed at lower level thanAox2a and Aox2b (Finnegan et al., 1997; McCabe etal., 1998; Considine et al., 2002). In addition, thelimited number of soybean Aox1 EST (TIGR ESTdatabase search), supports the hypothesis thatAox1 gene is barely expressed in soybean tissues.Apparently, Aox regulation in Vigna differed fromthe one in soybean as previously showed inresponse to cold treatment (Gonzalez-Meleret al., 1999). Concerning VuAox2a gene, transcriptswere abundant only in photosynthetic tissues whileAox2b gene, reported as ubiquitous, was predomi-nantly expressed in roots (Finnegan et al., 1997;Considine et al., 2002; Costa et al., 2004). Incontrol conditions, this gene was expressed in bothV. unguiculata cultivars, however approximately30% higher level of VuAox2b transcripts were foundin Vita 3 compared to Vita 5 (Fig. 1). A similartendency was determined for the amount ofAox protein and its basal capacity (after cyanideaddition), while for the fully activated state,the difference was less significant (Figs. 2–4). In

these conditions, Vita 3 has the potential (tran-script and protein) to engage more the alternativepathway.

In this study, we have examined Aox regulation inthe roots of the two Vigna cultivars which weresubmitted to an osmotic shock for 7 days. Accordingprevious data, this stress period corresponds toan adequate delay to measure the respectiveparameters leading to physiological modifications(Fernandes de Melo et al., 1994).

In response to NaCl treatment, changes in theexpression of VuAox2b gene were observed. ForVita 5, the transcript level was hugely stimulated at100mM NaCl, with a similar effect at the proteinlevel. In this case, the protein level in Vita 5reached the Vita 3 level. It was also in thiscondition that the Aox capacity level (basal or fullcapacity) was the highest. At 200mM NaCl, theeffect was largely attenuated. The enhancement ofthe Aox amount and capacity could respond to ahuge stimulation of respiration, based on the rateof oxygen uptake. In this condition, the ubiquinonepool may be highly reduced and the alternativeelectron transfer may protect against harmfulreactive oxygen generation (Wagner and Krab,1995). This role of Aox has been confirmed inothers conditions with the use of an antisensetransgene which implied higher cellular levels ofROS from mitochondrial origin (Maxwell et al.,1999; Yip and Vanlerberghe, 2001).

For Vita 3, the more tolerant cultivar, the Aoxbehaviour differed from the one observed in Vita 5in response to salinity. Thus, at 100 and 200mMNaCl, the transcript level severely declined whilethe amount and the capacity of the protein wereslightly modified. Considering the higher toleranceof Vita 3 to NaCl, we can suppose that endogenousstress conditions differed between the two culti-vars by a different energy metabolism solicitation.At the root level, such events could concernion compartmentalisation in the vacuole orion loading in the xylem, which are energy-dependent processes. It has been previouslyshown that, when the two cultivars were submittedto salinity, there was a higher level of sodium inthe lower parts of Vita 5 plants compared toVita 3 (Fernandes de Melo et al., 1994). Thisability to control endogenous levels of ionsappears to be fundamental to distinguish betweena salt-sensitive plant and a tolerant one (Munns,2002). For the V. unguiculata cultivars, thisconcept is also partly validated by the fact thatthe vacuolar proton pumps (H+-ATPase and H+-PPase) genes were over-expressed earlier in Vita 3than in Vita 5, when the plants were submitted to100mM NaCl treatment (A. C. Sobreira, 2003.

ARTICLE IN PRESS

Alternative oxidase regulation in Vigna unguiculata 725

Thesis, Federal University of Ceara, Fortaleza, CE,Brazil).

The modulation of Aox2b gene expression ap-pears to be dependent on the nature of the osmoticstress. With PEG, chosen to produce iso-osmoticconditions to 100mM NaCl, the transcript profilediffered from the salt treatment one (Fig. 1). InVita 3 roots, PEG induced a higher level oftranscripts and a simultaneous increase in theamount and the capacity of the protein. For Vita5, the transcript level was not modified while theprotein amount and the basal Aox activity in-creased. In the absence of salt in the externalmedium, we can hypothesise that PEG is suscep-tible to induce more drastic conditions of waterdeficit than salt, particularly after 7 days oftreatment. In these conditions, the over-expressionof Aox may alleviate the conditions of an oxidativestress. This response is more significant in Vita 3,known also to be more drought-tolerant (Fernandesde Melo et al., 1994).

In our results, some discrepancies betweentranscript, protein and capacity levels haveemerged, which may be explain by the implicationof regulatory mechanisms at transcriptional, trans-lational and/or post-translational levels. Our datapoint out Aox2b as a single gene candidate tomodulate responsive-stress conditions. In this con-text, it has been envisaged by McCabe et al. (1998)an enhancement of Aox2b expression during theage development of soybean cotyledons concomi-tant to a reduction of Aox2a transcript and a lowlevel of Aox1 expression. Indeed, very recently,Clifton et al. (2005) reported Aox2 gene as alsoresponsive to a specific subset of stress conditions.At the post-translational level, it is important toconsider the regulation due to changes in the redoxstate of the protein. When present as a dimer, theAox is not active, while the reduction of a disulfurbond transforms the protein in two monomers(Umbach and Siedow, 1993), which could beactivated by a-keto acids like pyr (Millar et al.,1993). In our experiment, the Aox has been mainlydetected in the oxidised state (Fig. 2A). This couldresult from the process of mitochondria isolation,even if antioxidants were present in the extractionmedium (Millenaar et al., 1998). However, with thesame extraction procedure, the part of thereductive form significantly increased in somestress conditions. In this case, mitochondria ofstressed roots would conserve a higher capacity toreduce the disulfide bond of Aox than mitochondriaof control roots. This evidence is also supportedby the determination of the basal Aox capacity(Fig. 3), before the addition of DTT. Except for the100mM NaCl treatment with Vita 3, every other

stress conditions lead to a higher di-oxygen uptakeafter cyanide addition, compared to control. More-over, in some stress conditions (PEG and 200mMNaCl), the addition of DTT was without effect onthe oxidation rate in both cultivars (Fig. 3). In vivo,the redox state of the Aox could be regulated by athioredoxin system (McIntosh et al., 1998) whichcomponents have been characterised in plantmitochondria (Marcus et al., 1991; Konrad et al.,1996). Recently, mitochondrial thioredoxins wereshown to reduce Aox homodimer and to allow itsactivation by pyruvate (Gelhaye et al., 2004).

In summary, up and down-regulation occurredthrough the VuAox2b gene in response to osmoticstress. The response differed between the twocultivars but, it is important to notice that,whatever the conditions, the Vita 3 cultivarmaintains a higher amount of Aox protein. Vita 5,the more sensitive cultivar, tends in some stressconditions (100mM NaCl and PEG) to reach thisprotein level while a more drastic stress (NaCl200mM) failed to do the same. Our findingsindicate a fine and differential regulation exertedby Aox in roots of V. unguiculata cultivars, differingin drought/salt tolerance, suggesting that Aox playsa role in the mechanisms of plants adjusting tounfavourable environmental conditions.

Acknowledgements

We are grateful to Bozena Szal from the Instituteof Experimental Plant Biology, University of War-saw, Poland, for skilful advice on mitochondriaisolation and to Joelle Gerard from Henri PoincareUniversity, Nancy, France, for her helpful contribu-tion on experimental essays. We also want toexpress our gratitude to Dr. Tom Elthon for thekind gift of the alternative oxidase monoclonalantibody. This research was supported by CAPESand CNPq.

References

Apse MP, Blumwald E. Engineering salt tolerance inplants. Curr Opin Biotechnol 2002;13:146–50.

Bradford MM. A rapid and sensitive method for thequantitation of microgram quantities of proteinutilizing the principle of protein–dye binding. AnalBiochem 1976;72:248–54.

Clifton R, Lister R, Parker KL, Sappl PG, Elhafez D, MillarAH, et al. Stress-induced co-expression of alternativerespiratory chain components in Arabidopsis thaliana.Plant Mol Biol 2005;58:193–212.

ARTICLE IN PRESS

J.H. Costa et al.726

Considine MJ, Daley DO, Whelan J. The expression ofalternative oxidase and uncoupling protein duringfruit ripening in mango. Plant Physiol 2001;126:1619–29.

Considine MJ, Holtzapffel RC, Day DA, Whelan J, MillarAH. Molecular distinction between alternative oxidasefrom monocots and dicots. Plant Physiol 2002;129:949–53.

Cornu S, Pireaux JC, Gerard J, Dizengremel P. NAD(P)+-dependent isocitrate dehydrogenases in mitochondriapurified from Picea abies seedlings. Physiol Plant1996;96:312–8.

Costa JH, Hasenfratz-Sauder M-P, Pham-Thi AT, Silva LimaMG, Dizengremel P, Jolivet Y, et al. Identification inVigna unguiculata (L.) Walp. of two cDNAs encodingmitochondrial alternative oxidase orthologous tosoybean alternative oxidase genes 2a and 2b. PlantSci 2004;167:233–9.

Djajanegara I, Finnegan PM, Mathieu C, McCabe T,Whelan J, Day DA. Regulation of alternative oxidasegene expression in soybean. Plant Mol Biol 2002;50:735–42.

Ehlers JD, Hall AE. Cowpea (Vigna unguiculata L. Walp.).Field Crops Res 1997;53:187–204.

Fernandes de Melo D, Jolivet Y, Fac-anha AR, Filho EG,Silva Lima M, Dizengremel P. Effect of salt stress onmitochondrial energy metabolism of Vigna unguicula-ta cultivars differing in NaCl tolerance. Plant PhysiolBiochem 1994;32:405–12.

Finnegan PM, Whelan J, Millar AH, Zhang Q, Smith MK,Wiskich JT, et al. Differential expression of themultigene family encoding the soybean mitochondrialalternative oxidase. Plant Physiol 1997;114:455–66.

Gelhaye E, Rouhier N, Gerard J, Jolivet Y, Gualberto J,Navrot N, et al. A specific form of thioredoxin hoccurs in plant mitochondria and regulates thealternative oxidase. Proc Natl Acad Sci USA 2004;101:14545–50.

Gonzalez-Meler MA, Ribas Carbo M, Giles L, Siedow JN.The effect of growth and measurement temperatureon the activity of the alternative respiratory pathway.Plant Physiol 1999;120:765–72.

Haliwell B, Gutteridge JMC. Oxygen free radicals and ironin relation to biology and medicine: some problemsand concepts. Arch Biochem Biophys 1986;246:501–14.

Hasegawa PM, Bressan RA, Zhu JK, Bohnert HJ. Plantcellular and molecular responses to high salinity. AnnuRev Plant Physiol Mol Biol 2000;51:463–99.

Juszczuk IM, Rychter AM. Alternative oxidase in higherplants. Acta Biochim Polonica 2003;50:1257–71.

Konrad A, Banze M, Follmann H. Mitochondria of plantleaves contain two thioredoxins. Completion of thethioredoxins profile of higher plants. J Plant Physiol1996;149:317–21.

Laemmli UK. Cleavage of strutural proteins during theassembly of the head of the bacteriophage T4. Nature1970;227:680–5.

Marcus F, Chamberlain SH, Chu C, Masiarz FR, Shin S, YeeBC, et al. Plant thioredoxin h: an animal-like

thioredoxin occurring in multiple cell compartments.Arch Biochem Biophys 1991;287:195–8.

Maxwell DP, Wang Y, McIntosh L. The alternative oxidaselowers mitochondrial reactive oxygen productionin plant cells. Proc Natl Acad Sci USA 1999;96:8271–6.

McCabe TC, Finnegan PM, Millar H, Day DA, Whelan J.Differential expression of alternative oxidase genes insoybean cotyledons during postgerminative develop-ment. Plant Physiol 1998;118:675–82.

McIntosh L, Eichler T, Gray G, Maxwell D, Nickels R, WangY. Biochemical and genetic controls exerted by plantmitochondria. Biochim Biophys Acta 1998;1365:278–84.

Millar AH, Wiskich JT, Whelan J, Day DA. Organic acidactivation of the alternative oxidase of plant mito-chondria. FEBS Lett 1993;329:259–62.

Millar AH, Finnegan PM, Whelan J, Drevon JJ, Day DA.Expression and kinetics of the mitochondrial alter-native oxidase in nitrogen-fixing nodules of soybeanroots. Plant Cell Environ 1997;20:1273–82.

Millenaar FF, Benschop JJ, Wagner AM, Lambers H. Therole of the alternative oxidase in stabilizing the in vivoreduction state of the ubiquinone pool and theactivation state of the alternative oxidase. PlantPhysiol 1998;118:599–607.

Munns R. Comparative physiology of salt and waterstress. Plant Cell Environ 2002;25:239–50.

Purvis AC. Role of the alternative oxidase in limitingsuperoxide production by plant mitochondria. PhysiolPlant 1997;100:165–70.

Robson CA, Vanlerberghe GC. Transgenic plant cellslacking mitochondrial alternative oxidase have in-creased susceptibility to mitochondria-dependent andindependent pathways of programmed cell death.Plant Physiol 2002;129:1908–20.

Saika H, Ohtsu K, Hamanaka S, Nakazono M, Tsutsumi N,Hirai A. AOX1c, a novel rice gene for alternativeoxidase; comparison with Aox1a and Aox1b. GenesGenet Syst 2002;77:31–8.

Saisho D, Nambara E, Naito S, Tsutsumi N, Hirai A,Nakazono M. Characterization of the gene family foralternative oxidase from Arabidopsis thaliana. PlantMol Biol 1997;35:585–96.

Saisho D, Nakazono M, Lee KH, Tsutsumi N, Akita S, HiraiA. The gene for alternative oxidase-2 (AOX2) fromArabidopsis thaliana consists of five exons unlike otherAOX genes and is transcribed at an early stage duringgermination. Genes Genet Syst 2001;76:89–97.

Seki M, Kamei A, Yamaguchi-Shinozaki K, Shinozaki K.Molecular responses to drought, salinity and frost:common and different paths for plant protection. CurrOpin Biotechnol 2003;14:194–9.

Siedow JN, Umbach AL. The mitochondrial cyanide-resistant oxidase: structural conservation amid reg-ulatory diversity. Biochim Biophys Acta 2000;1459:432–9.

Silva Lima M, Pinheiro PA. Effect of 2,4-dinitrophenol onmitochondria of Vigna sinensis cv. Serido. Biochimie1975;57:1401–3.

ARTICLE IN PRESS

Alternative oxidase regulation in Vigna unguiculata 727

Tanudji M, Djajanegara IN, Daley DO, McCabe TC,Finnegan PM, Day DA, et al. The multiple alternativeoxidase proteins of soybean. Aust J Plant Physiol 1999;26:337–44.

Umbach AL, Siedow JN. Covalent and noncovalent dimersof the cyanide-resistant alternative oxidase protein inhigher plant mitochondria and their relationship toenzyme activity. Plant Physiol 1993;103:845–54.

Wagner AM, Krab K. The alternative respiration pathwayin plants: role and regulation. Physiol Plant 1995;95:318–25.

Whelan J, Millar AH, Day DA. The alternative oxidase isencoded in a multigene family in soybean. Planta1996;198:197–201.

Xiong L, Schumaker KS, Zhu JK. Cell signaling during cold,drought, and salt stress. Plant Cell 2002(Suppl.):165–83.

Yip JYH, Vanlerberghe GC. Mitochondrial alternativeoxidase acts to dampen the generation of activeoxygen species during a period of rapid respirationinduced to support a high rate of nutrient uptake.Physiol Plant 2001;112:327–33.