Alpha-synuclein antisense oligonucleotides as a disease ... · the approach through...

Alpha-synuclein antisense oligonucleotides as a disease-modifying therapy for

Parkinson’s disease

Tracy A. Cole1*, Hien Zhao1, Timothy J. Collier2, Ivette Sandoval2, Caryl E. Sortwell2, Kathy

Steece-Collier2, Brian F. Daley2, Alix Booms2, Jack Lipton2, Mackenzie Welch3, Melissa

Berman3, Luke Jandreski3, Danielle Graham3, Andreas Weihofen3, Stephanie Celano2, Emily

Schulz2, Allyson Cole-Strauss2, Esteban Luna4, Duc Quach1, Apoorva Mohan1, C. Frank

Bennett1, Eric E. Swayze1, Holly B. Kordasiewicz1, Kelvin C. Luk4, Katrina L. Paumier2

1Ionis Pharmaceuticals, Inc., Carlsbad, California, USA.

2Michigan State University, Grand Rapids, Michigan, USA.

3Biogen, Cambridge, Massachusetts, USA.

4Department of Pathology and Laboratory Medicine, University of Pennsylvania Perelman

School of Medicine, Philadelphia, Pennsylvania, USA.

*Correspondence should be addressed to T.A.C. Ionis Pharmaceuticals, 2855 Gazelle Court,

Carlsbad CA 92008, USA. Email: [email protected]. Phone: 760-603-3806

Summary

Antisense oligonucleotides designed against SNCA, which are progressing to the clinic, have the

potential to be a disease modifying therapeutic for Parkinson’s disease patients.

not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted November 4, 2019. . https://doi.org/10.1101/830554doi: bioRxiv preprint

mailto:[email protected]

mailto:[email protected]

https://doi.org/10.1101/830554

2

Abstract

Parkinson’s disease (PD) is a prevalent neurodegenerative disease with no approved disease-

modifying therapies. Multiplications, mutations, and single nucleotide polymorphisms in the

SNCA gene, encoding alpha-synuclein protein (aSyn), either cause or increase risk for PD.

Intracellular accumulations of aSyn are pathological hallmarks of PD. Taken together, reduction

of aSyn production may provide a disease-modifying therapy for PD. We show that antisense

oligonucleotides (ASOs) reduce production of aSyn in rodent pre-formed fibril (PFF) models of

PD. Reduced aSyn production leads to prevention and removal of established aSyn pathology

and prevents dopaminergic cell dysfunction. In addition, we address the translational potential of

the approach through characterization of human SNCA targeting ASOs that efficiently suppress

the human SNCA transcript in vivo. We demonstrate broad activity and distribution of the human

SNCA ASOs throughout the non-human primate brain and a corresponding decrease in aSyn

cerebral spinal fluid (CSF) levels. Taken together, these data suggest that by inhibiting

production of aSyn it may be possible to reverse established pathology and thus supports the

development of SNCA ASOs as a potentially disease modifying therapy for PD and related

synucleinopathies.

Introduction

There is strong genetic evidence implicating the role of aSyn (alpha-synuclein protein) in the

pathogenesis of Parkinson’s disease (PD) (Chartier-Harlin et al., 2004; Devine et al., 2011;

Farrer et al., 2004; Fuchs et al., 2007; Fuchs et al., 2008; Ibanez et al., 2009; Kruger et al., 1998;

Mata et al., 2010; Mutez et al., 2011; Ross et al., 2008; Satake et al., 2009; Simon-Sanchez et al.,


https://doi.org/10.1101/830554

3

2009; Singleton et al., 2003; Soldner et al., 2016; Spillantini et al., 1997). Intracellular aSyn

aggregates are a pathological hallmark of PD that increase in number and spread through the

brain as symptoms worsen in PD patients (Goedert, 2015; Goedert et al., 2013). Duplication,

triplication or genetic mutations in the SNCA gene (produces aSyn protein) (A53T, A30P, E46K,

G51D, etc.) are linked to autosomal dominant forms of the disease (Chartier-Harlin et al., 2004;

Farrer et al., 2004; Fuchs et al., 2007; Miller et al., 2004; Ross et al., 2008; Singleton et al.,

2003). Moreover, polymorphisms that occur within specific regions of the SNCA gene increase

the overall risk of PD by either increasing the production or slowing the clearance of aSyn

(Cronin et al., 2009; Fuchs et al., 2008; Mata et al., 2010; Nalls et al., 2014; Simon-Sanchez et

al., 2009; Soldner et al., 2016). A toxic gain of function of aSyn is also established in other

synucleinopathies including multiple systems atrophy (MSA) (Spillantini et al., 1998), Diffuse

Lewy body disease (DLBD) (Nishioka et al., 2010), and Gaucher disease (GD) (Aflaki et al.,

2017), which collectively affects about 1% of people over 60 years of age. Clinically diagnosed

Dementia with Lewy bodies (DLB) (Spillantini et al., 1998) and pure autonomic failure (PAF)

(Arai et al., 2000; Isonaka et al., 2017) also exhibit Lewy pathology, suggesting a toxic gain of

function of aSyn in DLB and PAF.

To date, there are multiple therapeutic strategies being investigated, including antibodies

and small molecule approaches targeting different forms and conformational states of aSyn,

however, the toxic species of aSyn has not yet been confirmed, potentially limiting therapeutic

benefit of these approaches (Dehay et al., 2015; Kingwell, 2017). In addition, antibodies and

small molecules often only target extracellular pools of the protein. However, antisense

oligonucleotide (ASO) therapy can potentially overcome the limitations of these approaches


https://doi.org/10.1101/830554

4

since they inhibit the production of aSyn by targeting RNA intracellularly, thereby reducing all

forms of the aSyn protein (Bennett and Swayze, 2010).

To determine the efficacy of ASOs in synucleiopathies, we use rat and mouse aSyn pre-

formed fibril (PFF) transmission models, which replicate aspects of human PD progression

including seeding and aggregate deposition of endogenous aSyn, reduced striatal dopamine,

dopaminergic cell dysfunction (tyrosine hydroxylase (TH) loss) in the substantia nigra, and

motor dysfunction (Luk et al., 2012; Paumier et al., 2015). We hypothesize that these

pathological changes can be prevented or reversed by inhibiting the production of aSyn using

ASOs targeted to the Snca gene. Though aSyn pathology has been shown to be reversible with

complete genetic ablation in adult mice in overexpression and toxin models (Hayashita-Kinoh et

al., 2006; Lim et al., 2011; Masliah et al., 2005; Tran et al., 2014; Uehara et al., 2019; Zharikov

et al., 2015) and with suppression in cells (Luna et al., 2018), we aimed to determine if partial

transient and/or sustained suppression of endogenous aSyn with a therapeutically relevant

approach in vivo could lead to reversal of established pathology and prevention of TH loss. We

also aimed to improve cellular function, of which some aspects have been shown to be

dysfunctional in iPSC-derived PD patient neurons, PD patient tissue, as well as in animal models

of PD (Di Maio et al., 2016; Ludtmann et al., 2018; Martin et al., 2006; Muller et al., 2013;

Tapias et al., 2017). Remarkably, we found a robust clearance of aSyn pathology when

production of aSyn is inhibited, which results in improvement in cell function as measured by

double strand DNA breaks. With human SNCA targeting ASOs, we demonstrate widespread

target engagement in the brain of transgenic mice expressing human SNCA and in all of the PD

relevant brain regions in NHPs, thus demonstrating the therapeutic potential of ASOs for PD and

other synucleinopathies.


https://doi.org/10.1101/830554

5

Results

Reduction of Snca improves cellular function in cells and prevents pathogenic aSyn

aggregate deposition in an in vivo PFF model of PD

Two 2’-O-methoxyethyl/DNA gapmer ASOs targeting Snca were used for in vitro and in vivo

experimentation in addition to a control ASO (Table 1A). In previous work, ASO suppression of

Snca in a primary cortical culture PFF system inhibited Snca mRNA and reversed pSer129+

pathology and cellular dysfunction (Luna et al., 2018). To examine the capability of ASOs to

improve cellular function we utilized this same ASO (ASO1) and system. As cellular function is

impaired in PD we sought to characterize DNA double strand breaks, an increase in which

indicates dysfunctional DNA repair, to determine whether a Snca ASO could mitigate

dysfunction. As expected, application of PFFs resulted in production of pSer129+ aggregates in

primary mouse cortical cultures and this led to double strand breaks (γH2AX Ser139) (Fig. 1A

and B). Remarkably, pSer129+ pathology was prevented and double strand breaks (γH2AX

Ser139) were normalized to control levels with application of Snca ASO1, but not a control ASO

(Fig. 1A and B).

To further extend this work, we assessed Snca ASOs in a rodent model of PD. Rodent

aSyn PFF intrastriatal injection models result in accumulation of phospho-S129 (pSer129+)

aggregates that propagate to interconnected regions (including from the substantia nigra (SN) to

the striatum) leading to dysfunction of the nigrostriatal system (Luk et al., 2012; Paumier et al.,

2015). A single 700µg ICV injection of Snca-targeted ASO1 reduced Snca mRNA by ~50% 70

days after ASO administration (Fig. 1, C to E), this resulted in prevention of pSer129+ aggregate

deposition in the PFF mouse model (~96% reduction, Fig 1F and G) 56 days following PFF

injection. PFF injected mice exhibit significant deficits in a wire hang motor function task, as


https://doi.org/10.1101/830554

6

published previously (Luk et al., 2012). Following administration of ASO1, mice that were

injected with PFFs no longer exhibit a significant deficit in comparison to naïve mice (Fig. 1H).

ASO-mediated reduction of Snca is dose-responsive, exhibits a prolonged duration of

action, and dose-responsively prevents pathogenic aSyn aggregate deposition in an in vivo

PFF model of PD

More extensive characterization of ASO1 demonstrated dose-dependent reduction of Snca mRNA

in vivo 21 days following a single intracerebroventricular (ICV) administration in rats (Fig. 2, A

to C). Dose-dependent ASO-mediated Snca mRNA suppression with ASO1 also resulted in dose-

dependent prevention of pSer129+ aggregate deposition in comparison to the PBS group at 61

days post PFF injection (82 days post ASO ICV administration) in the SN (Fig. 2, D to F and fig.

S1, A and B). This is consistent with complete prevention of aggregates in aSyn KO mice and

attenuated aggregation in heterozygous KO mice injected with PFFs (Luk et al., 2012). There was

no evidence of dopaminergic cell dysfunction at this time point (fig. S1C) as expected (Paumier et

al., 2015) and the control ASO exhibited a profile similar to PBS administered rats, indicating the

control ASO does not alter disease (Fig. 2, E to F and fig. S1, A to C). ASO1 reduced Snca mRNA

and prevented pSer129+ aggregate deposition in the SN and across multiple brain regions,

including prefrontal cortex and motor cortex 61 days post PFF injection (fig. S1, D to G).

A second Snca targeting ASO (ASO2) was also evaluated. Snca ASO2 also reduced

pSer129+ aggregate counts, but to a lesser extent than ASO1 (fig. S1, F and G). This is

consistent with ASO2 being a less potent molecule than ASO1 with almost no Snca mRNA

suppression remaining 82 days post ASO administration (fig. S1, D and E), and more modest

Snca mRNA suppression than ASO1 at 42 days post ASO administration (fig. S1, H to J). Taken

together, these data suggest aSyn pathology is dependent on aSyn expression levels.


https://doi.org/10.1101/830554

7

ASO-mediated suppression of Snca prevents dopaminergic cell dysfunction in an in vivo

PFF model of PD

PFF rodent models, like the human condition, undergo neurodegeneration in a number of CNS

regions after pathology is established (Goedert et al., 2013; Luk et al., 2012; Paumier et al.,

2015), this typically takes about 4-66 months after PFF injection. Fortunately, ASO1 exhibits a

long duration of action with significant target suppression up to 84 days in cortex, striatum and

midbrain then returning to baseline ~160 days post a single ICV administration at 1000µg (Fig.

3A). To determine if ASO-mediated suppression of aSyn production could prevent TH loss, rats

were administered a single ICV 1000µg dose of ASO1 prior to PFF injection and assessed 181

days later (Fig. 3B). ASO1 administration resulted in significant reduction of pSer129+

aggregates in comparison to PBS (~53% reduction) and control ASO (~48% reduction) treated

rats (Fig. 3C), and significantly attenuated PFF-mediated TH loss in the SN compared to PBS at

181 days post a single ASO administration (Fig. 3D). Striatal dopamine levels were also

normalized, in comparison to the respective contralateral side, with ASO1 treatment compared to

PBS or control ASO (Fig. 3E). Snca mRNA had returned to normal levels at this 181 day

timepoint (in comparison to PBS treated rats), which likely explains the modest accumulation of

aSyn aggregates when compared to almost complete ablation of pathology at the 61 day

timepoint when aSyn production was still suppressed (fig. S2, A and B in comparison to fig. S1,

B, C, D, and E).

Pathogenic aSyn aggregate deposition is reversible and its amelioration reduces TH loss

To determine if ASO-mediated Snca suppression could be beneficial after established

pathology, ASO1 was administered by ICV bolus at 700µg 14 days after PFF injection in mice, a

timepoint with established pSer129+ aggregates in the SN (Fig. 4A). Snca mRNA was


https://doi.org/10.1101/830554

8

significantly reduced in the striatum and midbrain 56 days after PFF injection (Fig 4, B and C).

Strikingly, ASO1 reduced the number of established aggregates (~92% reduction, Fig 4D) 56 days

post PFF injection. A trend toward improvement in a wire hang behavioral task was also found in

mice (Fig. 4E). In addition, ASO1 was administered by ICV bolus at 1000µg 21 days after PFF

injection in rats, a timepoint with established pSer129+ aggregates in the SN (Fig. 4, F and H).

Though maximal PFF deposition occurs at 60 days post injection, rats euthanized 21 days post-

PFF injection exhibit extensive aggregate deposition that was resolved by ASO administration ~40

days later (Fig 4H). Strikingly, ASO1 reduced the number of established aggregates at 60 (~90%

reduction) and 81 (~51% reduction) days post PFF injection (39 and 61 days post ASO

administration) compared to pSer129+ aggregate counts at 21 days (PFF only). mRNA reduction

was as expected (Fig. 4G). Similar reductions in pSer129+ aggregates were found in the insular

cortex confirming widespread activity of the ASO (Fig. 4I). Thus, in both mice and rats ASO1

resulted in reversal of deposition of established aggregates.

To determine if suppression of aSyn after established aggregate deposition could prevent

TH loss, rats received a single 1000µg ICV injection of ASO1 administered 21 days after PFF

injection and assessed 181 days post PFF (160 days post ASO administration) (Fig. 4J). ASO1

significantly attenuated PFF-mediated TH loss in the SN compared to PBS, while a control ASO

did not (Fig. 4K). Interestingly, ASO1 administration resulted in a significant increase (~22%) in

pSer129+ aggregates compared to PBS and control ASO administered rats at 160 days post PFF

injection (Fig. 4L), possibly due to reduced dysfunction of aggregate-bearing neurons. In this

cohort, there were no significant differences in striatal dopamine levels for any of the treatment

groups (Fig. 4M). The increase in aggregates in ASO1 administered animals relative to PBS 160

days after a single ASO administration is consistent with aSyn levels returning to normal over time


https://doi.org/10.1101/830554

9

(fig. S2, D and E), and likely higher than PBS due to the prevention of TH loss in ASO1 treated

animals. Remarkably, the transient reduction in aSyn production after aggregates were established

was sufficient to preserve TH expression in dopaminergic neurons highlighting the therapeutic

value of directly targeting the underlying disease.

Sustained reduction of Snca with ASO administered after aggregates are established

reduces aggregate pathology and prevents TH loss

To evaluate a paradigm of sustained Snca reduction, mice were administered two ICV bolus

700µg administrations of ASO1 at 14 days prior to and 76 days after PFF injection, which

resulted in sustained reduction in Snca mRNA with ~50% reduction remaining 224 days after

PFF injection and 238 days after the initial ASO administration (Fig. 5, A to C). Sustained Snca

mRNA reduction resulted in sustained reduction in aSyn pathology and a prevention of TH loss

224 days after PFF injection (Fig. 5, D to F). Snca mRNA and pSer129+ aggregate reduction

were similar to the ~60 day mouse (Fig. 1 D to F) and rat studies (Fig. 2, A to G and fig. S1, B-

K) though tissues were collected 224 days post PFF injection. Thus, maintaining Snca

suppression prevented aggregates from accumulating and prevented TH loss.

To determine if prolonged ASO-mediated Snca suppression could be more beneficial than

transient reduction after established pathology, ASO1 was administered ICV at 14 and 90 days

following PFF injection with study termination at 180 days post PFF in mice (Fig. 5G). Snca

mRNA and PSer129+ aggregates were reduced in the substantia nigra (Fig. 5, H to J). TH

positive loss was also prevented with prolonged aSyn reduction post PFF administration in

comparison to PBS administered mice (Fig. 5K). This differs from single ICV dose injection

following PFF in which aggregate number was increased in ASO1 treated rats in comparison to

PBS treated rats 180 days following PFF injection when mRNA expression had returned to


https://doi.org/10.1101/830554

10

baseline levels (Fig. 4L and Fig. 3A) Thus, therapeutic treatment with Snca ASOs administered

with established aggregates requires sustained reduction of Snca to prevent aggregates from

accumulating once Snca RNA levels return to baseline.

Human SNCA ASOs are potent, suppress aSyn broadly in the primate CNS and CSF aSyn

is a potential pharmacodynamic biomarker

The ASOs used thus far target the rodent Snca transcripts. To treat human patients, we designed

ASOs to suppress the human SNCA transcript, using similar designs and chemistries as ASOs

already in clinical testing (Tabrizi et al., 2019). Human sequence targeting SNCA ASOs hASO1

and hASO2 (Table 1B) suppress human SNCA mRNA in a dose- and concentration-dependent

manner (Fig. 6, A to D and fig. S3, A and B) in vitro in SH-SY5Y human cells and in vivo in the

aSyn wild type human full-length transgenic mouse (similar to (Nussbaum and Ellis, 2003). The

human SNCA ASOs also exhibit an extended duration of action lasting 10 weeks after a single

administration (fig. S3, C to E). To determine the activity and distribution of human ASOs in a

larger brain, hASO1 and hASO2 were dose intrathecally (IT) in non-human primates (NHPs,

cynomolgus). Following repeated IT delivery of hASO1 or hASO2 to the NHPs, SNCA mRNA

(RT-qPCR) and aSyn protein (ELISA) are reduced throughout the brain and spinal cord (Fig. 6,

E to H). Further analyses of NHP brain tissue by in situ hybridization (SNCA mRNA) and

immunohistochemistry (ASO and aSyn protein) support the conclusion that SNCA ASOs

distribute broadly and result in reduction of SNCA mRNA and protein throughout the brain and

spinal cord (Fig. 6I and fig. S4), including regions implicated in PD. aSyn protein in the CSF is

significantly reduced with hASO1 in comparison to vehicle (aCSF) administered NHPs (Fig. 6J).

In addition, aSyn protein reduction in the frontal cortex correlates to aSyn protein reduction in


https://doi.org/10.1101/830554

11

the CSF, suggesting the use of aSyn in the CSF as a potential pharmacodynamic biomarker (Fig.

6K).

Discussion

Our study demonstrates that ASO-mediated suppression of Snca prevented and reversed

the progression of aSyn mediated pathology in rodent transmission models of PD demonstrating

the potential of SNCA ASOs as a therapy for PD patients. Long term studies with sustained

reduction of aSyn prevented and even delayed pathology and associated TH loss. Furthermore,

central delivery of human SNCA ASOs reduced expression of mRNA and protein throughout the

brains of both the humanized mouse and NHPs demonstrating that human SNCA ASOs are active

in regions of the brain susceptible to PD in a larger species. In NHPs the reduction of aSyn was

reflected in the CSF supporting further investigation of the use of aSyn protein levels in the CSF

as a target engagement biomarker to allow evaluation of efficacy of human SNCA ASOs in the

clinic.

PD and other synucleinopathies are generally characterized as toxic gain of function in

SNCA, suggesting that therapeutics designed to lower aSyn production would be beneficial to

patients (Giasson et al., 2002; Klein et al., 2002; Kruger et al., 1998; Zarranz et al., 2004). To

date, there are multiple protein-based therapeutic strategies being investigated targeting different

forms and conformational states of aSyn in clinical trials (Kingwell, 2017). However, the toxic

species of aSyn has not yet been confirmed, potentially limiting therapeutic benefit of these

approaches (Dehay et al., 2015; Kingwell, 2017). In addition, protein targeting therapies

hypothesized to clear aSyn aggregates as they are transmitted from cell to cell may not be as

effective in targeting intracellular Lewy body inclusions. An ASO therapy can potentially

overcome these limitations by targeting mRNA intracellularly and reducing all forms of aSyn


https://doi.org/10.1101/830554

12

protein (Bennett and Swayze, 2010; Rigo et al., 2014). Indeed, ASO-mediated suppression of

aSyn reduced aSyn pathology in a dose dependent manner. In all cases, the levels of aSyn

pathology corresponded to the levels of endogenous aSyn production. An ASO less effective at

suppressing Snca mRNA was less effective at suppressing aSyn pathology. If the Snca mRNA

levels were allowed to return to normal levels, the aSyn pathology returned, however, this increase

was prevented with continued suppression of aSyn production. Taken together, these data

illustrate the link between production of endogenous aSyn and aSyn pathology.

Our observation that ASO treatment was beneficial in reducing the number of pSyn

aggregates at a time when pre-existing pathology is present is particularly interesting. This is

consistent with previous work reporting reversal of deposition of soluble aSyn as well as insoluble

forms of pathology following reduction of aSyn production by tetracycline-controlled

transactivator (tTA) to prevent expression of the A53T mutant aSyn transgene (Lim et al., 2011).

In the genetic study, stopping production also reversed detrimental changes in hippocampal

synaptic markers, and hippocampal memory deficits (Lim et al., 2011). Our results replicate and

extend these findings with a therapeutically relevant modality, and in a model where we are

targeting endogenous aSyn, rather than a transgene. In both cases, stopping aSyn production had

a dramatic effect on aSyn pathology and neuronal health. This finding may suggest that de novo

production and recruitment of aSyn is required for maintaining the stability of aggregates until a

threshold is reached for irreversible cell death. This concept remains to be explored. Regardless,

these data suggest that treatment initiation after disease onset in sporadic patients has the potential

to reverse disease.

Many toxin, genetic, viral-mediated, and alpha-synuclein injection Parkinson disease

animal models have been generated to evaluate the role of aSyn in Parkinson’s disease (Jagmag et


https://doi.org/10.1101/830554

13

al., 2015; Koprich et al., 2017; Recasens et al., 2014). Each model exhibits advantages and

limitations (Koprich et al., 2017). The aSyn PFF injection models, used here, exhibits advantages

in modeling sporadic PD by relying on fibril seeding and templating of normal endogenous levels

of aSyn in specific interconnected brain circuits, avoiding the global overexpression produced in

germline transgenic models and the forced local supraphysiological overexpression common in

viral vector models (Duffy et al., 2018). The evolution of aggregate formation in morphology

(diffuse punctate to compact) and important characteristics of Lewy bodies (e.g., proteinase-K

resistance, Thioflavin-S positive) progressing over time to result in DA neuron degeneration at 6

months post-PFF injection, provides a platform for analyzing the potential of neuroprotective

therapies, such as ASOs, for translation to treatment of idiopathic PD. In this regard, our findings

are promising.

Few tolerability concerns exist for lowering SNCA as evidenced by genetically engineered

Snca deficient mice (Abeliovich et al., 2000; Cabin et al., 2002; Chandra et al., 2004; Goldberg

and Lansbury, 2000; Greten-Harrison et al., 2010). There are reports of cell death in vivo using an

shRNA against Snca (Benskey et al., 2018; Collier et al., 2016), which was not found here with

ASOs or in other publications using siRNAs, shRNAs, or ASOs against Snca (Alarcon-Aris et al.,

2018; Uehara et al., 2019; Zharikov et al., 2015). The aSyn antibodies, Prasinezumab (PRX002)

and Cinpanemab (BIIB054), completed first-in-human trials in which no serious adverse events

were found with aSyn lowering (Brys et al., 2019; Schenk et al., 2017). In addition, our animal

model studies and others (Games et al., 2014; Spencer et al., 2017; Tran et al., 2014; Zharikov et

al., 2015) have shown a benefit with less than 50% reduction of Snca mRNA indicating that only

a partial reduction of SNCA will be needed for therapeutic benefit, as mentioned above.


https://doi.org/10.1101/830554

14

aSyn protein exhibits a profile desirable for a pharmacodynamic biomarker as reduction in

aSyn protein in the CSF correlated with aSyn protein reduction in the frontal cortex in the NHP.

aSyn protein is measurable in human CSF, has been shown in patients to not correlate with clinical

progression, and levels are relatively stable over 24 months, thus suggesting aSyn levels in the

CSF may potentially be used in clinical trials as a pharmacodynamic marker to support

demonstration of efficacy of aSyn modulating therapies (Dolatshahi et al., 2018; Mollenhauer,

2014; Mollenhauer et al., 2017; Parnetti et al., 2016; Zhou et al., 2015). Continued evaluation and

improved methods for detecting aSyn in the CSF and other fluids are warranted, such as

electrochemiluminescense-based detection (Kruse and Mollenhauer, 2019).

ASOs represent a therapeutic approach for directly lowering SNCA production because

ASOs are sequence-specific and can reach central nervous system targets by intrathecal delivery.

The ASO platform is quickly becoming a realistic therapeutic strategy for the treatment of central

nervous system (CNS) diseases due partly to recent advances in ASO design which have improved

stability, affinity, and potency, as well as improved tolerability (Bennett and Swayze, 2010; Rigo

et al., 2014). ASOs have also been shown to distribute widely within the brain and spinal cord in

the NHP shown here and elsewhere (Kordasiewicz et al., 2012; Lagier-Tourenne et al., 2013;

Passini et al., 2011) in addition to exhibiting a long duration of effect shown here and elsewhere

(Friedrich et al., 2018; Hagemann et al., 2018; McLoughlin et al., 2018; Scoles et al., 2017; Zhao

et al., 2017). Feasibility of the approach is supported by FDA approval of Spinraza© for the

treatment of spinal muscular atrophy (Chiriboga et al., 2016; Finkel et al., 2016), the recently

completed clinical trial with an ASO for Huntingtin’s (Htt) disease (Rodrigues and Wild, 2018;

Tabrizi et al., 2019), and ongoing trials for a SOD1-targeted ASO for amyotrophic lateral sclerosis

(NCT02623699), a C9ORF72 ASO for ALS (NCT03626012), a LRRK2-targeted ASO for


https://doi.org/10.1101/830554

15

Parkinson’s disease (NCT03976349), and a MAPT targeting ASO therapy for Alzheimer’s disease

(NCT03186989). To explore the translational potential of an SNCA ASO therapy, we examined

target engagement of human SNCA targeting ASOs in a human cell line, a human aSyn transgenic

mouse model and NHPs. The SNCA targeting molecules described here have sufficient potency

and duration of action for use in human patients. Thus, ASOs designed against human SNCA

have the potential to be a disease-modifying therapeutic for PD patients.

Materials and Methods

Oligonucleotide synthesis

The synthesis and purification of all lyophilized ASOs was formulated in PBS without Ca/Mg

(Gibco: 14190) as previously described and stored at -20oC (Ostergaard et al., 2013; Seth et al.,

2010). Sequences and chemistries used are listed (fig. S1A and B).

Cell culture PFF experiments

Timed-pregnant CD1 mice (Charles River Laboratories) were utilized for primary neuronal

cultures. Hippocampal neurons were prepared from embryos (E16-18) as previously described

(Volpicelli-Daley et al., 2014). All other methods including PFF generation, PFF treatment, and

ASO addition to cultures were performed as previously described (Luna et al., 2018).

PSer129+ pathology and double strand DNA breaks by γH2AX Ser139 were quantified as

previously described (Tapias et al., 2017).

Rats

Adult male Sprague Dawley rats (200-225g; Harlan Laboratory, Indianapolis, IN) were utilized in rat

experiments. Rat PFF studies were conducted at Michigan State University (MSU) and rat and mouse

studies were conducted at Ionis pharmaceuticals. Rats at MSU were housed in the Van Andel

Research Institute vivarium and mice and rats at Ionis pharmaceuticals were housed in the


https://doi.org/10.1101/830554

16

vivarium. Both animal facilities are accredited by the Association for the Assessment and

Accreditation of Laboratory Animal Care and complied with all Federal animal care and use

guidelines for both institutions. The Institutional Animal Care and Use Committee approved all

protocols for both institutions.

Intrastriatal PFF injections in rats

Purification of recombinant in vitro fibril assembly was performed as previously described

(Paumier et al., 2015). Animals were monitored weekly following surgery and sacrificed at various

time points.

ICV injection in rats

Rats were injected into the right cerebroventricle (ICV) using a stereotactic device. For ICV bolus

injections the coordinates were -1.0 mm anterior/posterior and 1.5 mm to the right medial/lateral

are used. The needle is lowered -3.7mm dorsal/ventral. The proper amount of injection solution

(30 μL) was injected by hand at injection rates of approximately 1 μL/second with a 5-minute wait

following completion of injection. The incision was sutured closed using one horizontal mattress

stitch with 3-O Ethilon suture. The animals were then allowed to recover from the anesthesia in

their home cage.

Tissue processing in rats

Following in-life completion rats were euthanized by CO2 asphyxiation. 2 mm sections of spinal

cord and different brain regions were collected for mRNA analysis. Brains perfused with

physiological saline were cooled in iced saline and cut coronally in a 2 mm thick slab immediately

rostral to the hypothalamus. The section was placed onto a petri dish on ice and further dissected

into 3 pieces each for striatum and overlying cortex. For striatum: dorsal lateral striatum for HPLC,

dorsal intermediate striatum for mRNA, and dorsal medial striatum for protein. For cortex: medial


https://doi.org/10.1101/830554

17

for HPLC, intermediate for mRNA, lateral for protein. Dissections were optimized for HPLC

analysis corresponding to the pattern of dopamine innervation. Each dissected region was frozen

at -80 until analysis. Immunohistochemistry/ immunofluorescence/ pSer129+ aggregate counts

(total enumeration)/stereology were performed as previously described (Paumier et al., 2015).

Immunohistochemistry in rats

Used primary mouse anti-pSyn (81a-1:10,000 (Luk et al., 2012)), mouse-anti-TH (1:8000;

Immunostar, Hudson, WI), antibodies overnight at 4C. Then, sections were incubated in

biotinylated secondary antisera against either mouse (1:400, Millipore, Temecula, CA) or rabbit

IgG (1:400, Millipore, Temecula, CA) followed by Vector ABC detection kit (Vector Labs,

Burlingame, CA). Antibody labeling was visualized by exposure to 0.5 mg/ml 3,3'

diaminobenzidine (DAB) and 0.03% H2O2 in Tris buffer. Sections were mounted on subbed slides,

dehydrated to xylene and coverslipped with Cytoseal (Richard-Allan Scientific, Waltham, MA).

Immunofluorescence in rats

For DAPI staining, an additional three-minute incubation in Tris buffer with DAPI (1:500;

Invitrogen, Carlsbad, CA) was performed. Primary antibodies used include rabbit anti-TH

(1:4000; Millipore, Temecula, CA), mouse anti-pSyn (81a-1:15,000),. Secondary antibodies used

include Alexa Fluor 568 goat anti-mouse IgG (1:500; Invitrogen, Carlsbad, CA) and Alexa Fluor

488 goat anti-rabbit IgG (1:500; Invitrogen, Carlsbad, CA).

Medial Terminal Nucleus (MTN) counts of TH neurons in the SN in rats

TH neurons from three sections of the SN, easily identified by proximity to the medial terminal

nucleus of the accessory optic tract (−5.04 mm, −5.28 mm and −5.52 mm relative to bregma), were

quantified as previously described (Gombash et al., 2014). MicroBrightfield stereological

software (MBF Bioscience, Williston, VT) was used to assess the total number of aggregates


https://doi.org/10.1101/830554

18

(defined as dense, darkly stained cores of phosphorylated aSyn staining) within the SN at various

time points. Using a Nikon Eclipse 80i microscope, Retiga 4000R (QImaging, Surrey, BC,

Canada) and the Microbrightfield StereoInvestigator software (Microbrightfield Bioscience,

Burlingame, Virginia, USA), MTN neuron quantification was completed by drawing a contour

around the SN borders using a 4X objective. Virtual markers were then placed on TH+ neurons at

a 20X objective and quantified. Total TH neuron numbers in both the ipsilateral and contralateral

SN were averaged for the three medial terminal nucleus sections counted. MTN counts were used

for fig. S2, C. Differences in n’s within an experiment are due to technical reasons.

Stereology in rats

MicroBrightfield stereological software (MBF Bioscience, Williston, VT) was used to assess total

population cell counts in the substantia nigra pars compacta (SNpc). The total number of stained

neurons was calculated using optical fractionator estimations and the variability within animals

was assessed via the Gundersen Coefficient of Error (< 0.1) (Gundersen et al., 1999).

High performance liquid chromatography (HPLC) in rats

A dorsolateral striatal tissue punch was taken from both hemispheres. Frozen punches were placed

individually in vials supercooled on dry ice and stored at −80 °C until analysis. Tissue was

homogenized and analyzed as described previously (Koprich et al., 2003a; Koprich et al., 2003b).

The Pierce BCA Protein Kit (Rockford, IL) was utilized for protein determination. Samples were

separated on a Microsorb MV C-18 column (5 Am, 4.6–250 mm, Varian, Palo Alto, CA) and

simultaneously examined for norepinephrine, serotonin, dopamine, 3,4-dihydroxyphenylacetic

acid (DOPAC) and homovanillic acid (HVA). Compounds were detected using a 12-channel

coulometric array detector (CoulArray 5200, ESA, Chelmsford, MA) attached to a Waters 2695

Solvent Delivery System (Waters, Milford, MA) under the following conditions: flow rate of 1


https://doi.org/10.1101/830554

19

ml/min; detection potentials of 50, 175, 350, 400 and 525 mV; and scrubbing potential of 650 mV.

The mobile phase consisted of a 10% methanol solution in distilled H2O containing 21 g/l (0.1 M)

citric acid, 10.65 g/l (0.075 M) Na2HPO4, 176 mg/l (0.8 M) heptanesulfonic acid and 36 mg/l

(0.097 mM) EDTA at a pH of 4.1.

Mice

Adult male and female mice (20-32 g;Taconic Biosciences, Hudson, NY) were utilized in all

experiments. All mouse studies using either C57/Bl6 or human wild type SNCA-PAC (Licensed from

Mayo Foundation for Medical Education and Research) mice were conducted at Ionis pharmaceuticals.

The Institutional Animal Care and Use Committee approved all protocols.

Intrastriatal PFF injections in mice

Mouse PFF studies were performed as described previously including pSer129+ aggregate counts,

dopaminergic cell counts, and wire hang task in mice (Zhao et al., 2017). Purification of

recombinant in vitro fibril assembly was performed as previously described (Luk et al., 2012;

Volpicelli-Daley et al., 2014; Zhao et al., 2017). Mice were injected in the striatum with 5 µg of

aSyn PFFs in 2 µL of dosing solution.

ICV ASO injection in mice

Mice were injected into the right cerebroventricle (ICV) using a stereotactic device as previously

described (Zhao et al., 2017). For ICV bolus injections the coordinates 0.3 mm anterior to bregma,

1.0 mm right lateral, and -3.0 mm ventral were used. 10μL of injection solution was injected by

hand at injection rates of approximately 1 μL/second with a 5-minute wait following completion

of injection. The incision was sutured closed using one horizontal mattress stitch with 5-O Ethilon

suture. The animals were then allowed to recover from the anesthesia in their home cage.

Non-human primates


https://doi.org/10.1101/830554

20

The non-human primate (cynomolgus) study was performed at Covance laboratories GmbH.

Covance Laboratories GmbH test facility is fully accredited by the AAALAC. All procedures in

this study plan are in compliance with the German Animal Welfare Act and are approved by the

local IACUC, and performed as described previously (DeVos et al., 2017). NHPs (n=4) were

administered, by intrathecal bolus injection, 5 doses of ASO or aCSF on Day 1, 14, 28, 56, and 84

with 1.0 mL dosing volume using a 35 mg/mL dosing solution and euthanized on day 91.

aSyn enzyme-linked immunosorbent assay (ELISA)

Roughly 50 mg of NHP brain tissue was added to 1 ml of RIPA buffer (Boston Bioproducts) with

protease and phosphatase inhibitor tablets (Sigma-Aldritch) in a 2 ml Lysing Matrix D tube (MP

Biomedicals). The samples were homogenized using an MP Fastprep-24 (MP Biomedicals), and

total protein was quantified using the Pierce BCA Protein Assay kit (Thermo Fisher) and

normalized to 1 mg/ml. Tissue samples were diluted either 1:100 (spinal cord), 1:2000 (brain

tissue) or 1:10 (CSF) prior to alpha synuclein protein determination. Alpha synuclein protein

concentrations were measured using the LEGENDMAX Human Alpha Synuclein ELISA Kit

(Biolegend) following the manufacturer’s protocol. CSF hemoglobin levels were also analyzed

using the human hemoglobin ELISA kit (Bethyl Laboratories). This was done to assess the impact

of blood contamination on the alpha synuclein levels detected in CSF due to the high levels of

alpha synuclein contained in red blood cells. Samples with greater than 1000 ng/ml HgB were

excluded from the CSF analysis.

Antisense oligonucleotide immunohistochemistry in NHP tissue

Immunohistochemical staining was performed on a Ventana DISCOVERY ULTRA autostainer

(Ventana). Staining was done according to the manufacturer's instructions. Briefly, five

micrometer thick sections were deparaffinized and rehydrated then subjected to antigen retrieval


https://doi.org/10.1101/830554

21

using Proteinase K (Dako) for 4 minutes, followed by incubation with a Rabbit polyclonal anti-

ASO antibody at 1: 10,000 dilution (Ionis, #ASO 6651) for 60 minutes. The signal was detected

with polymer-based secondary antibody -Discovery OmniMap anti-Rb HRP and Discovery

ChromoMap DAB kits (Ventana). Control samples were also stained with rabbit IgG (Cell

signaling Technologies, #2792) as isotype controls. All slides were scanned on a 3DHISTECH

Panoramic P250 Slide Scanner. ASO images were scanned at 20X magnification. All images

were taken as screen shots from virtual slides. All images were analyzed with custom image

analysis algorithms performed on the VisioPharm software platform. Target brain regions on each

slide were manually outlined in Visiopharm to designate areas for algorithm analysis. In the

VisioPharm analysis algorithm, ASO staining was assessed as positively stained region area

broken down into three levels of intensity. A minimum threshold for ASO staining was

determined by assessing background levels of DAB (brown) staining. A maximum threshold of

100% intensity of DAB staining was used. ASO staining ranges were determined independently

per stain. This range was evenly divided into low, medium, and high intensity bins, each area of

staining was calculated as a percentage of the total outlined tissue area (brain region).

SNCA-RNA in situ hybridization (ISH) staining in NHP tissue

ISH staining was performed on a Leica Biosystems' BOND RX Autostainer (Leica Biosystems)

using mRNAscope® 2.5 LS Reagent Kit—RED (Advanced Cell Diagnostics). Staining was done

according to the manufacturer's instructions. Briefly, five micrometer thick sections were

deparaffinized and rehydrated then subjected to pretreatment, followed by specific probe-SNCA

(ACD, #421318) hybridized to target mRNA. The signal was amplified using multiple steps,

followed by hybridization to alkaline phosphatase (AP)-labeled probes and detection using Fast

Red (ACD, #322150). The tissue quality was examined by positive control probe-PPIB (ACD,


https://doi.org/10.1101/830554

22

#424148), and background staining was assessed by negative control probe-dapB (ACD,

#312038). All slides were scanned on a 3DHISTECH Panoramic P250 Slide Scanner. ISH images

were scanned at 40X magnification. All images were taken as screen shots from virtual slides.

All images were analyzed with custom image analysis algorithms performed on the VisioPharm

software platform. Target brain regions on each slide were manually outlined in Visiopharm to

designate areas for algorithm analysis. In the VisioPharm analysis algorithm, aSyn mRNA counts

were determined by detecting and counting SNCA ISH labeled dots within each region. These

counts were normalized by the total outlined tissue area (brain region) in mm2.

aSyn immunohistochemistry in NHP tissue

Immunohistochemical staining was performed on a Ventana DISCOVERY ULTRA autostainer

(Ventana). Staining was done according to the manufacturer's instructions. Briefly, five

micrometer thick sections were deparaffinized and rehydrated then subjected to antigen retrieval

using Ventana CC1 (EDTA pH 8) for 64 minutes, followed by incubation with a Mouse

monoclonal antibody aSyn211 (Santa Cruz, #SC-12767) at 0.25 μg/ml for 60 minutes. The signal

was detected with polymer-based secondary antibody -Discovery OmniMap anti-Ms HRP for 16

minutes. Control samples were also stained with mouse IgG (Cell signaling Technologies) as

isotype controls. All slides were scanned on a 3DHISTECH Panoramic P250 Slide Scanner. aSyn

protein images were scanned at 20X magnification. All images were taken as screen shots from

virtual slides. All images were analyzed with custom image analysis algorithms performed on the

VisioPharm software platform. Target brain regions on each slide were manually outlined in

Visiopharm to designate areas for algorithm analysis. In the VisioPharm analysis algorithm, aSyn

Protein staining was assessed as positively stained region area broken down into three levels of

intensity. A minimum threshold for aSyn protein was determined by assessing background levels


https://doi.org/10.1101/830554

23

of DAB (brown) staining. A maximum threshold of 100% intensity of DAB staining was

used. aSyn Protein ranges were determined independently per stain. This range was evenly

divided into low, medium, and high intensity bins, each area of staining was calculated as a

percentage of the total outlined tissue area (brain region).

mRNA purification and analysis for mice, rats, and non-human primates

Approximately 10 mg of tissue per sample was homogenized in guanidinium isothiocynate. Total

mRNA was purified further using a mini-mRNA purification kit (Qiagen, Valencia, CA). After

quantitation, the tissues were subjected to real time PCR analysis. The Life Technologies ABI

StepOne Plus Sequence Detection System was employed. Briefly, 20 µl RT-PCR reactions

containing 5µl of mRNA were run with the RNeasy 96 kit reagents and the primer probe sets listed

in the materials section optimized from manufacturer’s instructions. The following sequences of

primers and probes were used: mouse Snca 5’-GTCATTGCACCCAATCTCCTAAG-3’

(forward), 5’-GACTGGGCACATTGGAACTGA-3’ (reverse), and 5’-FAM-

CGGCTGCTCTTCCATGGCGTACAAX- TAMRA-3’ (probe); rat Snca 5’-

GATGGGCAAGGGTGAAGAAG-3’ (forward), 5’-GCTAGGGTCCACAGGCATGT-3’

(reverse), and 5’-FAM-TACCCACAAGAGGGAAT-MGB-3’ (probe) human SNCA 5’-

TGGCAGAAGCAGCAGGAAA-3’ (forward), 5’-TCCTTGGTTTTGGAGCCTACA-3’

(reverse), and 5’-FAM-CAAAAGAGGGTGTTCTC-TAMRA-3’ (probe); mouse cyclophilin A

5’-TCGCCGCTTGCTGCA-3’ (forward), 5’-ATCGGCCGTGATGTCGA-3’ (reverse), and 5’-

FAM-CCATGGTCAACCCCACCGTGTTCX-TAMRA-3’; Target SNCA mRNA was then

normalized to Cyclophilin A mRNA levels from the same mRNA sample. SNCA mRNA from

ASO treated animals was further normalized to the group mean of PBS treated animals, and


https://doi.org/10.1101/830554

24

expressed as percent control. All qPCR reactions were run in triplicate. Data were analyzed using

Microsoft Excel (v14.4).

SH-SY5Y Cell Culture Assay:

SH-SY5Y cells (CRL-2266, ATCC) were cultured in growth medium at 37° C and 10% CO2.

ASO was electroporated into cells, by pulsing once at 160V for 6mS with the ECM 830 instrument

(Harvard Apparatus). After 24 hr, the cells were washed 1X with PBS before lysing for mRNA

isolation and analysis. For each treatment condition quadruplicate wells were tested.

RNA purification and analysis for cell culture

The mRNA was purified with a glass fiber filter plate (Pall # 5072) and chaotropic salts. The

human SNCA message level was quantitated with RT-qPCR on the QS7 instrument (Applied

Biosystems). Total mRNA levels were measured with the Quant-iT™ RiboGreen® mRNA reagent

and used to normalize the SNCA data. Data were analyzed using Microsoft Excel (v14.4) and

GraphPad Prism (v6).

Statistical Analysis

Statistical tests were completed using either GraphPad Prism software (version 6, GraphPad, La

Jolla, CA) or Microsoft excel (v14.4). Data are expressed as mean +/- s.e.m., unless otherwise

noted. For two group comparisons t-tests were used. For more than two group comparisons, one-

way ANOVAs were used. Comparisons of multiple groups made across time points were analyzed

using a two-way ANOVA. When appropriate, post-hoc comparisons were made between groups using

Tukey or Bonferonni post hoc tests. A ROUT analysis was performed to determine outliers using

(Q=1%). The level of significance was set at P ≤ 0.05. Tests used are reported in the figure

legends.

Summary of supplemental material


https://doi.org/10.1101/830554

25

Supplemental material consists of ASO sequences, confirmation of POC results with an additional

Snca ASO, non-critical RNA results, additional characterization of human SNCA ASOs in

transgenic mice, and supporting histological evidence from NHP study.

Author contributions: The study was conceived by T.A.C. and H.B.K. Experiments were

designed by T.A.C., H.B.K., H.Z, and K.L.P. ASOs were designed by T.A.C, H.B.K, and E.E.S.

Experiments were performed and analyzed by K.L.P, T.J.C., H.Z., A.B., A.M., C. S., E.S., E.L.,

A.C-S., M.W., M.B., L.J, and J.L. Animal work was carried out by K.L.P, H.Z., T.J.C., B.F.D,

I.S., C.E.S., K.S-C, and A.B. ELISA/Immunohistochemistry was carried out by K.L.P, M.W.,

M.B., T.J.C., H.Z., D.Q., and B.F.D. HPLC was performed by J.L. Fibrils were obtained from

A.W. and K.C.L. E. E. S., C.F.B., K.L.P, T.J.C, D.G. A.W. and K.C.L. gave conceptual advice.

T.A.C. and H.B.K. wrote the manuscript. Competing interests: T.A.C., H.Z., A.M., C.F.B., D.Q.,

E.E.S., and H.B.K. are paid employees and stockholders of Ionis Pharmaceuticals Inc. (Carlsbad,

CA). D.G., M.W., M.B., L.J., A.W., are paid employees and stock holders of Biogen (Cambridge,

MA). T.J.C., I.S., C.E.S., K.S-C., B.F.D., A.B., J.L., C.S., E.S., A.C-s., K.C.L., and K.L.P. have

no conflicts of interest. Data and materials availability: No large scale data sets were generated

in this study. All ASO sequences and chemistries, as well as references to the synthesis are

included in the methods to allow for generation of these compounds. SNCA-PAC mice were

licensed from Mayo Foundation for Medical Education and Research.

Acknowledgements: We thank Donna Sipe, Johnnatan Tamayo and Gemma Ebeling for vivarium

assistance. Tracy Reigle for figure design and assembly. We also would like to thank the oligo

screening group (RTS), the preclinical development team, the oligo synthesis group, vivarium staff


https://doi.org/10.1101/830554

26

and histology core staff at Ionis Pharmaceuticals. We would also like to acknowledge the

translational pathology laboratory at Biogen for staining IHC/ISH for the NHP study. We want to

acknowledge Mian Horvath, a wonderful technician in the Luk laboratory at UPenn.

References:

Abeliovich, A., Y. Schmitz, I. Farinas, D. Choi-Lundberg, W.H. Ho, P.E. Castillo, N. Shinsky, J.M. Verdugo, M.

Armanini, A. Ryan, M. Hynes, H. Phillips, D. Sulzer, and A. Rosenthal. 2000. Mice lacking alpha-

synuclein display functional deficits in the nigrostriatal dopamine system. Neuron 25:239-252.

Aflaki, E., W. Westbroek, and E. Sidransky. 2017. The Complicated Relationship between Gaucher Disease and

Parkinsonism: Insights from a Rare Disease. Neuron 93:737-746.

Alarcon-Aris, D., A. Recasens, M. Galofre, I. Carballo-Carbajal, N. Zacchi, E. Ruiz-Bronchal, R. Pavia-Collado, R.

Chica, A. Ferres-Coy, M. Santos, R. Revilla, A. Montefeltro, I. Farinas, F. Artigas, M. Vila, and A.

Bortolozzi. 2018. Selective alpha-Synuclein Knockdown in Monoamine Neurons by Intranasal

Oligonucleotide Delivery: Potential Therapy for Parkinson's Disease. Mol Ther 26:550-567.

Arai, K., N. Kato, K. Kashiwado, and T. Hattori. 2000. Pure autonomic failure in association with human alpha-

synucleinopathy. Neuroscience letters 296:171-173.

Bennett, C.F., and E.E. Swayze. 2010. RNA targeting therapeutics: molecular mechanisms of antisense

oligonucleotides as a therapeutic platform. Annual review of pharmacology and toxicology 50:259-293.

Benskey, M.J., R.C. Sellnow, I.M. Sandoval, C.E. Sortwell, J.W. Lipton, and F.P. Manfredsson. 2018. Silencing

Alpha Synuclein in Mature Nigral Neurons Results in Rapid Neuroinflammation and Subsequent Toxicity.

Front Mol Neurosci 11:36.

Brys, M., L. Fanning, S. Hung, A. Ellenbogen, N. Penner, M. Yang, M. Welch, E. Koenig, E. David, T. Fox, S.

Makh, J. Aldred, I. Goodman, B. Pepinsky, Y. Liu, D. Graham, A. Weihofen, and J.M. Cedarbaum. 2019.

Randomized phase I clinical trial of anti-alpha-synuclein antibody BIIB054. Movement disorders : official

journal of the Movement Disorder Society 34:1154-1163.

Cabin, D.E., K. Shimazu, D. Murphy, N.B. Cole, W. Gottschalk, K.L. McIlwain, B. Orrison, A. Chen, C.E. Ellis, R.

Paylor, B. Lu, and R.L. Nussbaum. 2002. Synaptic vesicle depletion correlates with attenuated synaptic

responses to prolonged repetitive stimulation in mice lacking alpha-synuclein. J Neurosci 22:8797-8807.

Chandra, S., F. Fornai, H.B. Kwon, U. Yazdani, D. Atasoy, X. Liu, R.E. Hammer, G. Battaglia, D.C. German, P.E.

Castillo, and T.C. Sudhof. 2004. Double-knockout mice for alpha- and beta-synucleins: effect on synaptic

functions. Proc Natl Acad Sci U S A 101:14966-14971.

Chartier-Harlin, M.C., J. Kachergus, C. Roumier, V. Mouroux, X. Douay, S. Lincoln, C. Levecque, L. Larvor, J.

Andrieux, M. Hulihan, N. Waucquier, L. Defebvre, P. Amouyel, M. Farrer, and A. Destee. 2004. Alpha-

synuclein locus duplication as a cause of familial Parkinson's disease. Lancet 364:1167-1169.

Chiriboga, C.A., K.J. Swoboda, B.T. Darras, S.T. Iannaccone, J. Montes, D.C. De Vivo, D.A. Norris, C.F. Bennett,

and K.M. Bishop. 2016. Results from a phase 1 study of nusinersen (ISIS-SMN(Rx)) in children with

spinal muscular atrophy. Neurology 86:890-897.

Collier, T.J., D.E. Redmond, Jr., K. Steece-Collier, J.W. Lipton, and F.P. Manfredsson. 2016. Is Alpha-Synuclein

Loss-of-Function a Contributor to Parkinsonian Pathology? Evidence from Non-human Primates. Front

Neurosci 10:12.

Cronin, K.D., D. Ge, P. Manninger, C. Linnertz, A. Rossoshek, B.M. Orrison, D.J. Bernard, O.M. El-Agnaf, M.G.

Schlossmacher, R.L. Nussbaum, and O. Chiba-Falek. 2009. Expansion of the Parkinson disease-associated

SNCA-Rep1 allele upregulates human alpha-synuclein in transgenic mouse brain. Hum Mol Genet

18:3274-3285.

Dehay, B., M. Bourdenx, P. Gorry, S. Przedborski, M. Vila, S. Hunot, A. Singleton, C.W. Olanow, K.M. Merchant,

E. Bezard, G.A. Petsko, and W.G. Meissner. 2015. Targeting alpha-synuclein for treatment of Parkinson's

disease: mechanistic and therapeutic considerations. The Lancet. Neurology 14:855-866.


https://doi.org/10.1101/830554

27

Devine, M.J., K. Gwinn, A. Singleton, and J. Hardy. 2011. Parkinson's disease and alpha-synuclein expression.

Movement disorders : official journal of the Movement Disorder Society 26:2160-2168.

DeVos, S.L., R.L. Miller, K.M. Schoch, B.B. Holmes, C.S. Kebodeaux, A.J. Wegener, G. Chen, T. Shen, H. Tran,

B. Nichols, T.A. Zanardi, H.B. Kordasiewicz, E.E. Swayze, C.F. Bennett, M.I. Diamond, and T.M. Miller.

2017. Tau reduction prevents neuronal loss and reverses pathological tau deposition and seeding in mice

with tauopathy. Sci Transl Med 9:

Di Maio, R., P.J. Barrett, E.K. Hoffman, C.W. Barrett, A. Zharikov, A. Borah, X. Hu, J. McCoy, C.T. Chu, E.A.

Burton, T.G. Hastings, and J.T. Greenamyre. 2016. alpha-Synuclein binds to TOM20 and inhibits

mitochondrial protein import in Parkinson's disease. Sci Transl Med 8:342ra378.

Dolatshahi, M., S. Pourmirbabaei, A. Kamalian, A. Ashraf-Ganjouei, M. Yaseri, and M.H. Aarabi. 2018.

Longitudinal Alterations of Alpha-Synuclein, Amyloid Beta, Total, and Phosphorylated Tau in

Cerebrospinal Fluid and Correlations Between Their Changes in Parkinson's Disease. Front Neurol 9:560.

Duffy, M.F., T.J. Collier, J.R. Patterson, C.J. Kemp, D.L. Fischer, A.C. Stoll, and C.E. Sortwell. 2018. Quality Over

Quantity: Advantages of Using Alpha-Synuclein Preformed Fibril Triggered Synucleinopathy to Model

Idiopathic Parkinson's Disease. Front Neurosci 12:621.

Farrer, M., J. Kachergus, L. Forno, S. Lincoln, D.S. Wang, M. Hulihan, D. Maraganore, K. Gwinn-Hardy, Z.

Wszolek, D. Dickson, and J.W. Langston. 2004. Comparison of kindreds with parkinsonism and alpha-

synuclein genomic multiplications. Annals of neurology 55:174-179.

Finkel, R.S., C.A. Chiriboga, J. Vajsar, J.W. Day, J. Montes, D.C. De Vivo, M. Yamashita, F. Rigo, G. Hung, E.

Schneider, D.A. Norris, S. Xia, C.F. Bennett, and K.M. Bishop. 2016. Treatment of infantile-onset spinal

muscular atrophy with nusinersen: a phase 2, open-label, dose-escalation study. Lancet 388:3017-3026.

Friedrich, J., H.B. Kordasiewicz, B. O'Callaghan, H.P. Handler, C. Wagener, L. Duvick, E.E. Swayze, O.

Rainwater, B. Hofstra, M. Benneyworth, T. Nichols-Meade, P. Yang, Z. Chen, J.P. Ortiz, H.B. Clark, G.

Oz, S. Larson, H.Y. Zoghbi, C. Henzler, and H.T. Orr. 2018. Antisense oligonucleotide-mediated ataxin-1

reduction prolongs survival in SCA1 mice and reveals disease-associated transcriptome profiles. JCI

Insight 3:

Fuchs, J., C. Nilsson, J. Kachergus, M. Munz, E.M. Larsson, B. Schule, J.W. Langston, F.A. Middleton, O.A. Ross,

M. Hulihan, T. Gasser, and M.J. Farrer. 2007. Phenotypic variation in a large Swedish pedigree due to

SNCA duplication and triplication. Neurology 68:916-922.

Fuchs, J., A. Tichopad, Y. Golub, M. Munz, K.J. Schweitzer, B. Wolf, D. Berg, J.C. Mueller, and T. Gasser. 2008.

Genetic variability in the SNCA gene influences alpha-synuclein levels in the blood and brain. FASEB J

22:1327-1334.

Games, D., E. Valera, B. Spencer, E. Rockenstein, M. Mante, A. Adame, C. Patrick, K. Ubhi, S. Nuber, P. Sacayon,

W. Zago, P. Seubert, R. Barbour, D. Schenk, and E. Masliah. 2014. Reducing C-terminal-truncated alpha-

synuclein by immunotherapy attenuates neurodegeneration and propagation in Parkinson's disease-like

models. J Neurosci 34:9441-9454.

Giasson, B.I., J.E. Duda, S.M. Quinn, B. Zhang, J.Q. Trojanowski, and V.M. Lee. 2002. Neuronal alpha-

synucleinopathy with severe movement disorder in mice expressing A53T human alpha-synuclein. Neuron

34:521-533.

Goedert, M. 2015. NEURODEGENERATION. Alzheimer's and Parkinson's diseases: The prion concept in relation

to assembled Abeta, tau, and alpha-synuclein. Science 349:1255555.

Goedert, M., M.G. Spillantini, K. Del Tredici, and H. Braak. 2013. 100 years of Lewy pathology. Nature reviews.

Neurology 9:13-24.

Goldberg, M.S., and P.T. Lansbury, Jr. 2000. Is there a cause-and-effect relationship between alpha-synuclein

fibrillization and Parkinson's disease? Nat Cell Biol 2:E115-119.

Gombash, S.E., F.P. Manfredsson, R.J. Mandel, T.J. Collier, D.L. Fischer, C.J. Kemp, N.M. Kuhn, S.L.

Wohlgenant, S.M. Fleming, and C.E. Sortwell. 2014. Neuroprotective potential of pleiotrophin

overexpression in the striatonigral pathway compared with overexpression in both the striatonigral and

nigrostriatal pathways. Gene Ther 21:682-693.

Greten-Harrison, B., M. Polydoro, M. Morimoto-Tomita, L. Diao, A.M. Williams, E.H. Nie, S. Makani, N. Tian,

P.E. Castillo, V.L. Buchman, and S.S. Chandra. 2010. alphabetagamma-Synuclein triple knockout mice

reveal age-dependent neuronal dysfunction. Proc Natl Acad Sci U S A 107:19573-19578.

Gundersen, H.J., E.B. Jensen, K. Kieu, and J. Nielsen. 1999. The efficiency of systematic sampling in stereology--

reconsidered. J Microsc 193:199-211.


https://doi.org/10.1101/830554

28

Hagemann, T.L., B. Powers, C. Mazur, A. Kim, S. Wheeler, G. Hung, E. Swayze, and A. Messing. 2018. Antisense

suppression of glial fibrillary acidic protein as a treatment for Alexander disease. Annals of neurology

83:27-39.

Hayashita-Kinoh, H., M. Yamada, T. Yokota, Y. Mizuno, and H. Mochizuki. 2006. Down-regulation of alpha-

synuclein expression can rescue dopaminergic cells from cell death in the substantia nigra of Parkinson's

disease rat model. Biochem Biophys Res Commun 341:1088-1095.

Ibanez, P., S. Lesage, S. Janin, E. Lohmann, F. Durif, A. Destee, A.M. Bonnet, C. Brefel-Courbon, S. Heath, D.

Zelenika, Y. Agid, A. Durr, A. Brice, and G. French Parkinson's Disease Genetics Study. 2009. Alpha-

synuclein gene rearrangements in dominantly inherited parkinsonism: frequency, phenotype, and

mechanisms. Archives of neurology 66:102-108.

Isonaka, R., C. Holmes, G.A. Cook, P. Sullivan, Y. Sharabi, and D.S. Goldstein. 2017. Pure autonomic failure

without synucleinopathy. Clin Auton Res 27:97-101.

Jagmag, S.A., N. Tripathi, S.D. Shukla, S. Maiti, and S. Khurana. 2015. Evaluation of Models of Parkinson's

Disease. Front Neurosci 9:503.

Kingwell, K. 2017. Zeroing in on neurodegenerative alpha-synuclein. Nat Rev Drug Discov 16:371-373.

Klein, R.L., M.A. King, M.E. Hamby, and E.M. Meyer. 2002. Dopaminergic cell loss induced by human A30P

alpha-synuclein gene transfer to the rat substantia nigra. Hum Gene Ther 13:605-612.

Koprich, J.B., N.G. Campbell, and J.W. Lipton. 2003a. Neonatal 3,4-methylenedioxymethamphetamine (ecstasy)

alters dopamine and serotonin neurochemistry and increases brain-derived neurotrophic factor in the

forebrain and brainstem of the rat. Brain Res Dev Brain Res 147:177-182.

Koprich, J.B., E.Y. Chen, N.M. Kanaan, N.G. Campbell, J.H. Kordower, and J.W. Lipton. 2003b. Prenatal 3,4-

methylenedioxymethamphetamine (ecstasy) alters exploratory behavior, reduces monoamine metabolism,

and increases forebrain tyrosine hydroxylase fiber density of juvenile rats. Neurotoxicol Teratol 25:509-

517.

Koprich, J.B., L.V. Kalia, and J.M. Brotchie. 2017. Animal models of alpha-synucleinopathy for Parkinson disease

drug development. Nat Rev Neurosci 18:515-529.

Kordasiewicz, H.B., L.M. Stanek, E.V. Wancewicz, C. Mazur, M.M. McAlonis, K.A. Pytel, J.W. Artates, A. Weiss,

S.H. Cheng, L.S. Shihabuddin, G. Hung, C.F. Bennett, and D.W. Cleveland. 2012. Sustained therapeutic

reversal of Huntington's disease by transient repression of huntingtin synthesis. Neuron 74:1031-1044.

Kruger, R., W. Kuhn, T. Muller, D. Woitalla, M. Graeber, S. Kosel, H. Przuntek, J.T. Epplen, L. Schols, and O.

Riess. 1998. Ala30Pro mutation in the gene encoding alpha-synuclein in Parkinson's disease. Nat Genet

18:106-108.

Kruse, N., and B. Mollenhauer. 2019. Quantification of Alpha-Synuclein in Biological Fluids by

Electrochemiluminescence-Based Detection. Methods Mol Biol 1948:59-68.

Lagier-Tourenne, C., M. Baughn, F. Rigo, S. Sun, P. Liu, H.R. Li, J. Jiang, A.T. Watt, S. Chun, M. Katz, J. Qiu, Y.

Sun, S.C. Ling, Q. Zhu, M. Polymenidou, K. Drenner, J.W. Artates, M. McAlonis-Downes, S. Markmiller,

K.R. Hutt, D.P. Pizzo, J. Cady, M.B. Harms, R.H. Baloh, S.R. Vandenberg, G.W. Yeo, X.D. Fu, C.F.

Bennett, D.W. Cleveland, and J. Ravits. 2013. Targeted degradation of sense and antisense C9orf72 RNA

foci as therapy for ALS and frontotemporal degeneration. Proc Natl Acad Sci U S A 110:E4530-4539.

Lim, Y., V.M. Kehm, E.B. Lee, J.H. Soper, C. Li, J.Q. Trojanowski, and V.M. Lee. 2011. alpha-Syn suppression

reverses synaptic and memory defects in a mouse model of dementia with Lewy bodies. J Neurosci

31:10076-10087.

Ludtmann, M.H.R., P.R. Angelova, M.H. Horrocks, M.L. Choi, M. Rodrigues, A.Y. Baev, A.V. Berezhnov, Z. Yao,

D. Little, B. Banushi, A.S. Al-Menhali, R.T. Ranasinghe, D.R. Whiten, R. Yapom, K.S. Dolt, M.J. Devine,

P. Gissen, T. Kunath, M. Jaganjac, E.V. Pavlov, D. Klenerman, A.Y. Abramov, and S. Gandhi. 2018.

alpha-synuclein oligomers interact with ATP synthase and open the permeability transition pore in

Parkinson's disease. Nat Commun 9:2293.

Luk, K.C., V. Kehm, J. Carroll, B. Zhang, P. O'Brien, J.Q. Trojanowski, and V.M. Lee. 2012. Pathological alpha-

synuclein transmission initiates Parkinson-like neurodegeneration in nontransgenic mice. Science 338:949-

953.

Luna, E., S.C. Decker, D.M. Riddle, A. Caputo, B. Zhang, T. Cole, C. Caswell, S.X. Xie, V.M.Y. Lee, and K.C.

Luk. 2018. Differential alpha-synuclein expression contributes to selective vulnerability of hippocampal

neuron subpopulations to fibril-induced toxicity. Acta Neuropathol 135:855-875.

Martin, L.J., Y. Pan, A.C. Price, W. Sterling, N.G. Copeland, N.A. Jenkins, D.L. Price, and M.K. Lee. 2006.

Parkinson's disease alpha-synuclein transgenic mice develop neuronal mitochondrial degeneration and cell

death. J Neurosci 26:41-50.


https://doi.org/10.1101/830554

29

Masliah, E., E. Rockenstein, A. Adame, M. Alford, L. Crews, M. Hashimoto, P. Seubert, M. Lee, J. Goldstein, T.

Chilcote, D. Games, and D. Schenk. 2005. Effects of alpha-synuclein immunization in a mouse model of

Parkinson's disease. Neuron 46:857-868.

Mata, I.F., M. Shi, P. Agarwal, K.A. Chung, K.L. Edwards, S.A. Factor, D.R. Galasko, C. Ginghina, A. Griffith,

D.S. Higgins, D.M. Kay, H. Kim, J.B. Leverenz, J.F. Quinn, J.W. Roberts, A. Samii, K.W. Snapinn, D.W.

Tsuang, D. Yearout, J. Zhang, H. Payami, and C.P. Zabetian. 2010. SNCA variant associated with

Parkinson disease and plasma alpha-synuclein level. Archives of neurology 67:1350-1356.

McLoughlin, H.S., L.R. Moore, R. Chopra, R. Komlo, M. McKenzie, K.G. Blumenstein, H. Zhao, H.B.

Kordasiewicz, V.G. Shakkottai, and H.L. Paulson. 2018. Oligonucleotide therapy mitigates disease in

spinocerebellar ataxia type 3 mice. Annals of neurology 84:64-77.

Miller, D.W., S.M. Hague, J. Clarimon, M. Baptista, K. Gwinn-Hardy, M.R. Cookson, and A.B. Singleton. 2004.

Alpha-synuclein in blood and brain from familial Parkinson disease with SNCA locus triplication.

Neurology 62:1835-1838.

Mollenhauer, B. 2014. Quantification of alpha-synuclein in cerebrospinal fluid: how ideal is this biomarker for

Parkinson's disease? Parkinsonism Relat Disord 20 Suppl 1:S76-79.

Mollenhauer, B., R. Batrla, O. El-Agnaf, D.R. Galasko, H.A. Lashuel, K.M. Merchant, L.M. Shaw, D.J. Selkoe, R.

Umek, H. Vanderstichele, H. Zetterberg, J. Zhang, C. Caspell-Garcia, C. Coffey, S.J. Hutten, M. Frasier, P.

Taylor, and J.F.F.f.P.s.R. Investigating Synuclein Consortium of the Michael. 2017. A user's guide for

alpha-synuclein biomarker studies in biological fluids: Perianalytical considerations. Movement disorders :

official journal of the Movement Disorder Society 32:1117-1130.

Muller, S.K., A. Bender, C. Laub, T. Hogen, F. Schlaudraff, B. Liss, T. Klopstock, and M. Elstner. 2013. Lewy

body pathology is associated with mitochondrial DNA damage in Parkinson's disease. Neurobiol Aging

34:2231-2233.

Mutez, E., F. Lepretre, E. Le Rhun, L. Larvor, A. Duflot, V. Mouroux, J.P. Kerckaert, M. Figeac, K. Dujardin, A.

Destee, and M.C. Chartier-Harlin. 2011. SNCA locus duplication carriers: from genetics to Parkinson

disease phenotypes. Hum Mutat 32:E2079-2090.

Nalls, M.A., N. Pankratz, C.M. Lill, C.B. Do, D.G. Hernandez, M. Saad, A.L. DeStefano, E. Kara, J. Bras, M.

Sharma, C. Schulte, M.F. Keller, S. Arepalli, C. Letson, C. Edsall, H. Stefansson, X. Liu, H. Pliner, J.H.

Lee, R. Cheng, C. International Parkinson's Disease Genomics, G.I. Parkinson's Study Group Parkinson's

Research: The Organized, andMe, GenePd, C. NeuroGenetics Research, G. Hussman Institute of Human, I.

Ashkenazi Jewish Dataset, H. Cohorts for, E. Aging Research in Genetic, C. North American Brain

Expression, C. United Kingdom Brain Expression, C. Greek Parkinson's Disease, G. Alzheimer Genetic

Analysis, M.A. Ikram, J.P. Ioannidis, G.M. Hadjigeorgiou, J.C. Bis, M. Martinez, J.S. Perlmutter, A.

Goate, K. Marder, B. Fiske, M. Sutherland, G. Xiromerisiou, R.H. Myers, L.N. Clark, K. Stefansson, J.A.

Hardy, P. Heutink, H. Chen, N.W. Wood, H. Houlden, H. Payami, A. Brice, W.K. Scott, T. Gasser, L.

Bertram, N. Eriksson, T. Foroud, and A.B. Singleton. 2014. Large-scale meta-analysis of genome-wide

association data identifies six new risk loci for Parkinson's disease. Nat Genet 46:989-993.

Nishioka, K., C. Wider, C. Vilarino-Guell, A.I. Soto-Ortolaza, S.J. Lincoln, J.M. Kachergus, B. Jasinska-Myga,

O.A. Ross, A. Rajput, C.A. Robinson, T.J. Ferman, Z.K. Wszolek, D.W. Dickson, and M.J. Farrer. 2010.

Association of alpha-, beta-, and gamma-Synuclein with diffuse lewy body disease. Archives of neurology

67:970-975.

Nussbaum, R.L., and C.E. Ellis. 2003. Alzheimer's disease and Parkinson's disease. N Engl J Med 348:1356-1364.

Ostergaard, M.E., A.L. Southwell, H. Kordasiewicz, A.T. Watt, N.H. Skotte, C.N. Doty, K. Vaid, E.B. Villanueva,

E.E. Swayze, C.F. Bennett, M.R. Hayden, and P.P. Seth. 2013. Rational design of antisense

oligonucleotides targeting single nucleotide polymorphisms for potent and allele selective suppression of

mutant Huntingtin in the CNS. Nucleic Acids Res 41:9634-9650.

Parnetti, L., C. Cicognola, P. Eusebi, and D. Chiasserini. 2016. Value of cerebrospinal fluid alpha-synuclein species

as biomarker in Parkinson's diagnosis and prognosis. Biomark Med 10:35-49.

Passini, M.A., J. Bu, A.M. Richards, C. Kinnecom, S.P. Sardi, L.M. Stanek, Y. Hua, F. Rigo, J. Matson, G. Hung,

E.M. Kaye, L.S. Shihabuddin, A.R. Krainer, C.F. Bennett, and S.H. Cheng. 2011. Antisense

oligonucleotides delivered to the mouse CNS ameliorate symptoms of severe spinal muscular atrophy. Sci

Transl Med 3:72ra18.

Paumier, K.L., K.C. Luk, F.P. Manfredsson, N.M. Kanaan, J.W. Lipton, T.J. Collier, K. Steece-Collier, C.J. Kemp,

S. Celano, E. Schulz, I.M. Sandoval, S. Fleming, E. Dirr, N.K. Polinski, J.Q. Trojanowski, V.M. Lee, and

C.E. Sortwell. 2015. Intrastriatal injection of pre-formed mouse alpha-synuclein fibrils into rats triggers

alpha-synuclein pathology and bilateral nigrostriatal degeneration. Neurobiology of disease 82:185-199.


https://doi.org/10.1101/830554

30

Recasens, A., B. Dehay, J. Bove, I. Carballo-Carbajal, S. Dovero, A. Perez-Villalba, P.O. Fernagut, J. Blesa, A.

Parent, C. Perier, I. Farinas, J.A. Obeso, E. Bezard, and M. Vila. 2014. Lewy body extracts from Parkinson

disease brains trigger alpha-synuclein pathology and neurodegeneration in mice and monkeys. Annals of

neurology 75:351-362.

Rigo, F., P.P. Seth, and C.F. Bennett. 2014. Antisense oligonucleotide-based therapies for diseases caused by pre-

mRNA processing defects. Adv Exp Med Biol 825:303-352.

Rodrigues, F.B., and E.J. Wild. 2018. Huntington's Disease Clinical Trials Corner: February 2018. J Huntingtons

Dis 7:89-98.

Ross, O.A., A.T. Braithwaite, L.M. Skipper, J. Kachergus, M.M. Hulihan, F.A. Middleton, K. Nishioka, J. Fuchs, T.

Gasser, D.M. Maraganore, C.H. Adler, L. Larvor, M.C. Chartier-Harlin, C. Nilsson, J.W. Langston, K.

Gwinn, N. Hattori, and M.J. Farrer. 2008. Genomic investigation of alpha-synuclein multiplication and

parkinsonism. Annals of neurology 63:743-750.

Satake, W., Y. Nakabayashi, I. Mizuta, Y. Hirota, C. Ito, M. Kubo, T. Kawaguchi, T. Tsunoda, M. Watanabe, A.

Takeda, H. Tomiyama, K. Nakashima, K. Hasegawa, F. Obata, T. Yoshikawa, H. Kawakami, S. Sakoda,

M. Yamamoto, N. Hattori, M. Murata, Y. Nakamura, and T. Toda. 2009. Genome-wide association study

identifies common variants at four loci as genetic risk factors for Parkinson's disease. Nat Genet 41:1303-

1307.

Schenk, D.B., M. Koller, D.K. Ness, S.G. Griffith, M. Grundman, W. Zago, J. Soto, G. Atiee, S. Ostrowitzki, and

G.G. Kinney. 2017. First-in-human assessment of PRX002, an anti-alpha-synuclein monoclonal antibody,

in healthy volunteers. Movement disorders : official journal of the Movement Disorder Society 32:211-218.

Scoles, D.R., P. Meera, M.D. Schneider, S. Paul, W. Dansithong, K.P. Figueroa, G. Hung, F. Rigo, C.F. Bennett,

T.S. Otis, and S.M. Pulst. 2017. Antisense oligonucleotide therapy for spinocerebellar ataxia type 2. Nature

544:362-366.

Seth, P.P., G. Vasquez, C.A. Allerson, A. Berdeja, H. Gaus, G.A. Kinberger, T.P. Prakash, M.T. Migawa, B. Bhat,

and E.E. Swayze. 2010. Synthesis and biophysical evaluation of 2',4'-constrained 2'O-methoxyethyl and

2',4'-constrained 2'O-ethyl nucleic acid analogues. J Org Chem 75:1569-1581.

Simon-Sanchez, J., C. Schulte, J.M. Bras, M. Sharma, J.R. Gibbs, D. Berg, C. Paisan-Ruiz, P. Lichtner, S.W.

Scholz, D.G. Hernandez, R. Kruger, M. Federoff, C. Klein, A. Goate, J. Perlmutter, M. Bonin, M.A. Nalls,

T. Illig, C. Gieger, H. Houlden, M. Steffens, M.S. Okun, B.A. Racette, M.R. Cookson, K.D. Foote, H.H.

Fernandez, B.J. Traynor, S. Schreiber, S. Arepalli, R. Zonozi, K. Gwinn, M. van der Brug, G. Lopez, S.J.

Chanock, A. Schatzkin, Y. Park, A. Hollenbeck, J. Gao, X. Huang, N.W. Wood, D. Lorenz, G. Deuschl, H.

Chen, O. Riess, J.A. Hardy, A.B. Singleton, and T. Gasser. 2009. Genome-wide association study reveals

genetic risk underlying Parkinson's disease. Nat Genet 41:1308-1312.

Singleton, A.B., M. Farrer, J. Johnson, A. Singleton, S. Hague, J. Kachergus, M. Hulihan, T. Peuralinna, A. Dutra,

R. Nussbaum, S. Lincoln, A. Crawley, M. Hanson, D. Maraganore, C. Adler, M.R. Cookson, M. Muenter,

M. Baptista, D. Miller, J. Blancato, J. Hardy, and K. Gwinn-Hardy. 2003. alpha-Synuclein locus triplication

causes Parkinson's disease. Science 302:841.

Soldner, F., Y. Stelzer, C.S. Shivalila, B.J. Abraham, J.C. Latourelle, M.I. Barrasa, J. Goldmann, R.H. Myers, R.A.

Young, and R. Jaenisch. 2016. Parkinson-associated risk variant in distal enhancer of alpha-synuclein

modulates target gene expression. Nature 533:95-99.

Spencer, B., E. Valera, E. Rockenstein, C. Overk, M. Mante, A. Adame, W. Zago, P. Seubert, R. Barbour, D.

Schenk, D. Games, R.A. Rissman, and E. Masliah. 2017. Anti-alpha-synuclein immunotherapy reduces

alpha-synuclein propagation in the axon and degeneration in a combined viral vector and transgenic model

of synucleinopathy. Acta Neuropathol Commun 5:7.

Spillantini, M.G., R.A. Crowther, R. Jakes, N.J. Cairns, P.L. Lantos, and M. Goedert. 1998. Filamentous alpha-

synuclein inclusions link multiple system atrophy with Parkinson's disease and dementia with Lewy bodies.

Neuroscience letters 251:205-208.

Spillantini, M.G., M.L. Schmidt, V.M. Lee, J.Q. Trojanowski, R. Jakes, and M. Goedert. 1997. Alpha-synuclein in

Lewy bodies. Nature 388:839-840.

Tabrizi, S.J., B.R. Leavitt, G.B. Landwehrmeyer, E.J. Wild, C. Saft, R.A. Barker, N.F. Blair, D. Craufurd, J. Priller,

H. Rickards, A. Rosser, H.B. Kordasiewicz, C. Czech, E.E. Swayze, D.A. Norris, T. Baumann, I. Gerlach,

S.A. Schobel, E. Paz, A.V. Smith, C.F. Bennett, R.M. Lane, and I.-H.S.S.T. Phase 1-2a. 2019. Targeting

Huntingtin Expression in Patients with Huntington's Disease. The New England journal of medicine

380:2307-2316.


https://doi.org/10.1101/830554

31

Tapias, V., X. Hu, K.C. Luk, L.H. Sanders, V.M. Lee, and J.T. Greenamyre. 2017. Synthetic alpha-synuclein fibrils

cause mitochondrial impairment and selective dopamine neurodegeneration in part via iNOS-mediated

nitric oxide production. Cell Mol Life Sci 74:2851-2874.

Tran, H.T., C.H. Chung, M. Iba, B. Zhang, J.Q. Trojanowski, K.C. Luk, and V.M. Lee. 2014. Alpha-synuclein

immunotherapy blocks uptake and templated propagation of misfolded alpha-synuclein and

neurodegeneration. Cell Rep 7:2054-2065.

Uehara, T., C.J. Choong, M. Nakamori, H. Hayakawa, K. Nishiyama, Y. Kasahara, K. Baba, T. Nagata, T. Yokota,

H. Tsuda, S. Obika, and H. Mochizuki. 2019. Amido-bridged nucleic acid (AmNA)-modified antisense

oligonucleotides targeting alpha-synuclein as a novel therapy for Parkinson's disease. Sci Rep 9:7567.

Volpicelli-Daley, L.A., K.C. Luk, and V.M. Lee. 2014. Addition of exogenous alpha-synuclein preformed fibrils to

primary neuronal cultures to seed recruitment of endogenous alpha-synuclein to Lewy body and Lewy

neurite-like aggregates. Nat Protoc 9:2135-2146.

Zarranz, J.J., J. Alegre, J.C. Gomez-Esteban, E. Lezcano, R. Ros, I. Ampuero, L. Vidal, J. Hoenicka, O. Rodriguez,

B. Atares, V. Llorens, E. Gomez Tortosa, T. del Ser, D.G. Munoz, and J.G. de Yebenes. 2004. The new

mutation, E46K, of alpha-synuclein causes Parkinson and Lewy body dementia. Annals of neurology

55:164-173.

Zhao, H.T., N. John, V. Delic, K. Ikeda-Lee, A. Kim, A. Weihofen, E.E. Swayze, H.B. Kordasiewicz, A.B. West,

and L.A. Volpicelli-Daley. 2017. LRRK2 Antisense Oligonucleotides Ameliorate alpha-Synuclein

Inclusion Formation in a Parkinson's Disease Mouse Model. Molecular therapy. Nucleic acids 8:508-519.

Zharikov, A.D., J.R. Cannon, V. Tapias, Q. Bai, M.P. Horowitz, V. Shah, A. El Ayadi, T.G. Hastings, J.T.

Greenamyre, and E.A. Burton. 2015. shRNA targeting alpha-synuclein prevents neurodegeneration in a

Parkinson's disease model. J Clin Invest 125:2721-2735.

Zhou, B., M. Wen, W.F. Yu, C.L. Zhang, and L. Jiao. 2015. The Diagnostic and Differential Diagnosis Utility of

Cerebrospinal Fluid alpha -Synuclein Levels in Parkinson's Disease: A Meta-Analysis. Parkinsons Dis

2015:567386.

Abbreviations

PD – Parkinson’s disease

CNS – central nervous system

mRNA – mature ribonucleic acid

Snca/SNCA – alpha synuclein rodent/human gene, respectively

aSyn - alpha synuclein protein

LB – Lewy body

LN – Lewy neurite


https://doi.org/10.1101/830554

32

ASO – antisense oligonucleotide

PFF – pre-formed fibril

CSF - cerebrospinal fluid

NHP – non-human primate

MSA - multiple systems atrophy

DLBD - Diffuse Lewy body disease

GD – Gaucher disease

PAF - pure autonomic failure

TH+ – tyrosine hydroxylase positive

DA – dopamine

SN – substantia nigra

IHC – immunohistochemistry

pSer129+ aggregates – phospho serine 129 positive aggregates

Figures:


https://doi.org/10.1101/830554

33

Fig. 1. ASO-mediated reduction of Snca improves cellular function in cells and prevents

pathogenic aSyn aggregate deposition in an in vivo PFF model of PD. (A) Quantification of

pSer129+ area by intensity in mouse primary cortical cultures and (B) cellular function, by

γH2AX Ser139, in mouse primary cortical cultures with either PBS, CTL ASO, or ASO1 30

minutes following PFF addition. Replicated 2 times. (C) Timeline for single 700µg ICV bolus

ASO administration prior to PFF injection paradigm with termination at day 56. (D to E) mRNA

reduction by RT-PCR in striatum and midbrain. (F) Quantification of pSyn+ aggregate reduction

(total enumeration) in the substantia nigra by IHC. (G) Representative images of

immunostaining (IHC) for pSer129+ aggregate counts. (H) Performance on a wire hang task

(n=4, 12 and 11 for naïve, PBS and ASO1, respectively, except wire hang, in which n=12 for


https://doi.org/10.1101/830554

34

naive). Error bars represent ± s.e.m. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001 (Two-way

ANOVA with Tukey post hoc analyses for duration of action with all other analyses using One-

way ANOVA with Tukey post hoc analyses). PFF (pre-formed fibril), TRMT(treatment).

Fig. 2. ASO-mediated reduction of Snca is dose-responsive, exhibits a prolonged duration of

action, and dose-responsively prevents pathogenic aSyn aggregate deposition in an in vivo PFF

model of PD. (A to C) 3 week dose response of rat Snca levels from cortical, striatal, and

midbrain rat samples by RT-qPCR (n=8 per dose). (D) Timeline for ASO dose response

administration prior to PFF injection paradigm. (E) Quantification of immunostaining for

pSer129+ aggregate counts by total enumeration (n=6, 7, 5, 8, 8 for PBS, 100 µg, 300 µg, 1000

µg, and CTL ASO). (F) Representative images of pSer129+ aggregate counts in the substantia

nigra. (Scale bar = 100 μm). Error bars represent ± s.e.m. *P<0.05, **P<0.01, ***P<0.001,


https://doi.org/10.1101/830554

35

****P<0.0001 (Two-way ANOVA with Tukey post hoc analyses for duration of action with all

other analyses using One-way ANOVA with Tukey post hoc analyses). PFF (pre-formed fibril),

TRMT(treatment), CTL ASO (Control ASO)

Fig. 3. ASO-mediated suppression of Snca prevents dopaminergic cell dysfunction in an in

vivo PFF model of PD. (A) Time course of Snca mRNA reduction (the same 1000 µg results for

the three week time point in (Fig. 2 A to C) are included. (B to E) Results from ASO

administration (1000 µg) prior to PFF injection paradigm in rats with study termination at 181

days. (B) Timeline for ASO administration prior to PFF injection paradigm in rats. (C) pSer129+

aggregate counts using total enumeration by IHC (n=13, 13, 15 for PBS, ASO1, and CTL ASO,

respectively) (D) dopaminergic cell counts by IHC (by stereology) (n=13, 13, 12 for PBS,

ASO1, and CTL ASO, respectively), and (E) striatal dopamine levels by HPLC (n=13, 13, 14 for


https://doi.org/10.1101/830554

36

PBS, ASO1, and CTL ASO, respectively) Data are ± s.e.m. *P<0.05, **P<0.001, ***P<0.0001,

****P<0.00001 (one-way ANOVA with Tukey post hoc analyses). PFF(pre-formed fibril),

TRMT(treatment), CTL ASO(Control ASO).


https://doi.org/10.1101/830554

37

Fig. 4. Pathogenic aSyn aggregate deposition is reversible and its amelioration reduces TH loss.

(A) Timeline for ASO administration after PFF injection paradigm in the mouse. (B and C)

mRNA reduction by RT-PCR, (n=12, 10, 10 for naïve, PBS, ASO1) (D) Quantification of

aggregate reduction in the substantia nigra by IHC, (n=4, 10, 10 for naïve, PBS, and ASO1) and

(E) performance on a wire hang task (n= 10, 10, 10 for naïve, PBS, ASO1, respectively). (A and

B) Results from ASO administration after PFF injection with study termination at 60 and 81 days

post PFF injection in the rat. (F) Timeline for ASO administration (1000 µg) for G to I. (G)

Quantification of Snca mRNA reduction in the midbrain at each time point (H) Quantification of

immunostaining for pSer129+ aggregate counts and (I) representative images from the insular

cortex (n=10, 9, 9, 9, 10 for PFF only, PBS 60 days, ASO1 60 days, PBS 81 days, and ASO1 81

days (PBS at 60 days = 8). (J to M) Results from ASO administration (1000 µg) with study

termination at 181 days. (D) Timeline for ASO administration for K to M. (K) TH+ cell counts

by IHC (by stereology, (n=12, 11, 14 for PBS, ASO1, and CTL ASO, respectively) (L)

Quantification of pSer129+ aggregate counts in the substantia nigra by IHC, (n=13, 12, 12 for

PBS, ASO1, and CTL ASO, respectively) and (M) striatal dopamine levels by HPLC (n=13, 12,

14 for PBS, ASO1, and CTL ASO, respectively). Data are ± s.e.m. *P<0.05, **P<0.001,

***P<0.0001, ****P<0.00001. (one-way ANOVA with Tukey post hoc analyses). PFF(pre-

formed fibril), TRMT(treatment), CTL ASO(Control ASO).


https://doi.org/10.1101/830554

38

Fig. 5. Sustained reduction of Snca with ASO administered after aggregates are established

reduces aggregate pathology and prevents TH loss. (A to F) Results from ASO administration

prior to PFF injection paradigm with sustained suppression and study termination at 224 days

post PFF injection in mice. (A) Timeline for ASO administration (700µg) prior to PFF injection

paradigm. (B and C) mRNA reduction in the striatum and midbrain. pSer129+ aggregate counts

quantified by IHC in (D) neurites and (E) cell bodies. (F) Dopaminergic cell counts quantified


https://doi.org/10.1101/830554

39

by IHC. (n=12 for PBS and ASO1) (n=6 for immunohistochemistry endpoints). (G to K)

Results from ASO administration after PFF injection paradigm with sustained suppression and

study termination at 224 days post PFF injection in mice. (700 µg). (G) Timeline for ASO

administration (700µg) after to PFF injection paradigm. (H and I) mRNA reduction in the

striatum and midbrain. pSer129+ aggregate counts quantified by IHC in (J). (K) Dopaminergic

cell counts quantified by IHC. (n=4). Data are ± s.e.m. *P<0.05, **P<0.001, ***P<0.0001,

****P<0.00001. (one-way ANOVA with Tukey post hoc analyses). PFF(pre-formed fibril),

TRMT(treatment), CTL ASO(Control ASO).


https://doi.org/10.1101/830554

40

Fig. 6. Human SNCA ASOs are potent, suppress aSyn broadly in the primate CNS and CSF aSyn

is a suitable pharmacodynamic biomarker. In vitro dose response of human SNCA hASO1 and

hASO2 in (A and C) SHSY5Y cells and (B and D) in vivo dose response in SNCA-PAC mouse

cortex 2 weeks post injection (n=10 except 700 µg n=7 for hASO1) (n=8 for for hASO2 (2 mice

removed with ROUT analysis from 300 µg and 700 µg groups, combination of two studies of


https://doi.org/10.1101/830554

41

n=4 each, n=12 for all PBS groups). (E and F) mRNA by RT-PCR and (G and H) protein by

ELISA throughout the brain and spinal cord of the NHP (n=4 for PBS, hASO1, and hASO2). (I)

Representative images for IHC (ASO and aSyn antibody) or ISH (SNCA mRNA). Scale bar =

600 µm for protein/300 µm for ASO and ISH results. (J) Quantification of aSyn protein by

ELISA in CSF with (K) correlation of aSyn protein levels in the frontal cortex and CSF (n=2, 3,

and 4 for PBS, hASO1, and hASO2). Data are ± s.e.m except for SHSY5Y, which are StDev.

*P<0.05, **P<0.001, ***P<0.0001, ****P<0.00001. (One-way ANOVA with Tukey post hoc

analyses).

Table 1. Table of Snca/SNCA ASOs used for in vivo testing.

Supplementary Material Titles

Fig. S1. ASO1 and ASO2 administration prior to PFF injection result in mRNA reduction and

pSer129+ aggregate reduction in multiple rat studies.

Fig. S2. Snca mRNA reduction and contralateral TH positive cell counts, from single dose rat

ASO administration prior to PFF injection study.

Fig S3. Human SNCA ASOs exhibit concentration dependent reduction and a long duration of

action.


https://doi.org/10.1101/830554

42

Fig. S4. Representative images for IHC (anti-ASO and aSyn antibodies) or ISH (SNCA mRNA)

for motor cortex from NHP (cynomolgus) experiment.


https://doi.org/10.1101/830554

Alpha-synuclein antisense oligonucleotides as a disease ... · the approach through...

Documents

Transcript of Alpha-synuclein antisense oligonucleotides as a disease ... · the approach through...