Aleksandra Zoń-Giebel 1 , Danuta Kapołka 1 , Piotr Sikora 1 ,

Click here to load reader

download Aleksandra Zoń-Giebel 1 ,  Danuta Kapołka 1 , Piotr Sikora 1 ,

of 16

  • date post

    20-Mar-2016
  • Category

    Documents

  • view

    65
  • download

    4

Embed Size (px)

description

Związek genotypu receptorów immunoglobulinopodobnych komórek NK (KIR) z występowaniem i przebiegiem klinicznym zesztywniającego zapalenia stawów kręgosłupa. Aleksandra Zoń-Giebel 1 , Danuta Kapołka 1 , Piotr Sikora 1 , Marcin Stajszczyk 1 , Eugeniusz Zielonka 1 , Edyta Majorczyk 2 , - PowerPoint PPT Presentation

Transcript of Aleksandra Zoń-Giebel 1 , Danuta Kapołka 1 , Piotr Sikora 1 ,

  • Zwizek genotypu receptorw immunoglobulinopodobnych komrek NK (KIR) z wystpowaniem i przebiegiem klinicznym zesztywniajcego zapalenia staww krgosupaAleksandra Zo-Giebel1, Danuta Kapoka1, Piotr Sikora1, Marcin Stajszczyk1, Eugeniusz Zielonka1, Edyta Majorczyk2, Piotr Kusnierczyk2, Sebastian Giebel3, Piotr Wiland4

    1lski Szpital Reumatologiczno-Rehabilitacyjny im. Gen. J. Zitka, Ustro2Instytut Immunologii i Terapii Dowiadczalnej im. L.Hirszfeda, Wrocaw3Centrum Onkologii Instytut im. M. Skodowskiej-Curie Oddzia w Gliwicach4Klinika Reumatologii i Chorb Wewntrznych AM we Wrocawiu

  • KIR receptory immunoglobulinopodobne komrek zabjcw killer immunoglobulin-like receptorsEkspresja:Komrki NK (CD3-CD56+)Limfocyty T (CD3+CD56-)Komrki NKT (CD3+CD56+)

  • Genotyp KIRChromosom 19q13.4

    14 genw i 2 pseudogeny

    Niektre geny wystpuj w rnych wariantach allelicznych

    4 geny ramowe (zacienione) wystpuj u wszystkich osobnikw, pozostae zmiennie

  • KIR struktura czsteczkowaFarag, Blood 2002CYTOPLAZMA

  • Ligandy receptorw KIR

  • Funkcje KIRNK:KIR- podstawowy mechanizm regulacjiInterakcja HLA-hamujce KIR chroni prawidowe komrki organizmu przed atakiem ze strony komrek NKUtrata HLA klasy I lub zwiznie z okrelonymi antygenami czyni komrki docelowe wraliwymi na atak komrek NK (przewaga sygnaw aktywujcych)

    T:Interakcja HLA-hamujce KIR ma dziaanie immunomodulujce, zmniejsza produkcj cytokin i proliferacj, nie wpywajc na cytotoksycznoInterakcja HLA-ag-aktywujce KIR by moe obnia prg aktywacji limfocytw T

    NKT (?)

  • Zwizek genotypu KIR z wystpowaniem chorb reumatycznych

    GenChorobaRef.KIR2DS1+uszczycowe zapalenie stawwWilliams, Hum Immunol 2005KIR2DS2+KIR2DL2-Twardzina ukadowaMomot, Arthritis Rheum 2004KIR2DS2+Reumatoidalne zapalenie staww z zapaleniem naczyYen, J Exp Med 2001KIR3DS1+Zesztywniajce zapalenie staww krgosupaLopez-Arrea, Arthritis Res Ther 2006Brak zalenoci genotypu KIR i ZZSKHarvey, Ann Rheum Dis 2009

  • Cele: Porwnanie czstoci wystpowania poszczeglnych genw KIR u chorych na zzsk i w populacji zdrowej.Ustalenie zwizku wystpowania poszczeglnych genw z przebiegiem klinicznym.

    Pacjenci:58 chorych na zzsk leczonych w Szpitalu Reumatologiczno-Rehabilitacyjnym w Ustroniu

    Kontrola:243 zdrowe osoby z populacji polskiej

  • Metody: 11 genw KIR oznaczano w grupie badanej i kontrolnej metod PCR z wykorzytaniem specyficznych dla sekwencji primer-w.

    KIR locusSense (5 3)(Stenie w reakcji)Antisense (5 3) (Stenie w reakcji)Rozmiar amplifikacji (bp)KIR2DL1ccatcagtcgcatgacg (0,5 M)ccactcgtatggagagtcat (0,1 M)1903aatgttccgttggaccttggt (0,2 M)1818KIR2DL2acttccttctgcacagagaa (1 M)gccctgcagagaacctaca (1 M)1868KIR2DL3ccttcatcgctggtgctg (0,3 M)caggagacaactttggatca (0,3 M)812KIR2DS1cttctccatcagtcgcatgaa (0,4 M) agagggtcactgggagctgac (0,4 M)102cttctccatcagtcgcatgag (0,4 M)KIR2DS2tgcacagagaggggaagta (1 M)cacgctctctcctgccaa (1 M)1775KIR2DS3tcactccccctatcagttt (2,5 M)gcatctgtaggttcctcct (2,5 M)1800KIR2DS4atcctgcaatgttggtcg (0,4 M)ctggatagatggtacatgtc (0,4 M)1902KIR1Datcctgcaatgttggtcg (0,4 M)ctggatagatggagctgca (0,4 M)1885KIR2DS5agagaggggacgtttaacc (1 M)ggaaagagccgaagcatc (1 M)1952KIR3DL1ccatyggtcccatgatgct (1 M)agagag aaggtttctcatatg (1 M)1690KIR3DS1ggcagaatattccaggagg (1 M)aggggtccttagagatcca (1 M)1765

  • Czynniki brane pod uwag przy analizie obrazu klinicznego:

    1. Przy rozpoznaniu:Wskaniki aktywnoci choroby: OB, CRPPosta zzskRuchomo krgosupaZajcie narzdu wzrokuZajcie stawu biodrowegoWiek zachorowaniaNasilenie blu: nocnego, spoczynkowego, zwizanego z ruchem

    2. Przebieg chorobyPosta zzskZmiany ruchomoci krgosupaZmiany nasilenia blu

  • KIR ZZSK

    Wyniki:

    LocusPacjenci (%)Kontrola (%)PKIR2DL189,795,9NSKIR2DL251,755,1NSKIR2DL386,292,2NSKIR2DS137,940,3NSKIR2DS256,956,0NSKIR2DS331,028,4NSKIR2DS425,927,8NSKIR1D81,080,2NSKIR2DS513,827,80,03KIR3DL194,895,9NSKIR3DS125,935,4NS

  • P=0,02P=0,03P=0,02

  • WNIOSKI1. Obecno KIR2DS5 chroni przed wystpowaniem ZZSK.

    2. Obecno poszczeglnych aktywujcych KIR wie si z:- mniejsz aktywnoci choroby przy rozpoznaniu,- stabilnym przebiegiem .

    Powysze obserwacje wskazuj na konieczno przeprowadzenia bada podstawowych ukierunkowanych na ustalenie znaczenia limfocytw wykazujcych ekspresj poszczeglnych aktywujcych KIR w patogenezie ZZSK.

    Ladies and gentlemen, its my pleasure ..*Akronim KIR oznacza receptory immunoglobulinopodobne komrek zabjcw. Wystpuj one na komrkach NK, niektrych subpopulacjach limfocytw T oraz na komrkach NKT*Geny dla KIR s zlokalizowane na chromosomie 19. Genotyp KIR jest ukadem zoonym i wysoce polimorficznym. Obejmuje 14 genw i 2 pseudogeny, przy czym niektre geny mog wystpowa w rnych formach allelicznych. 4 geny ramowe wystpuj u wszystkich osobnikw, pozostae natomiast ze zmienn czstoci.*Wyrnia si KIR hamujce i aktywujce, rnice si przede wszystkim dugoci acucha wewntrzcytoplazmatycznego*Ligandami dla KIR hamujcych s czsteczki HLA klasy I. W przypadku KIR aktywujcych nie zostay one dobrze zdefiniowane, jakkolwiek ze wzgldu na podobiestwo struktury zewntrzcytoplazmatycznej uwaa si, e mog to by te same czsteczki, przy czym o ile z HLA nie jest zwizany antygen powinowactwo do KIR hamujcych jest wiksze*jw*Zwizek poszczeglnych genw KIR z wystpowaniem chorb reumatycznych by przedmiotem kilku opracowa. Stwierdzono m.in., e obeco KIR2DS1 sprzyja ZS, obecno KIR2DS2 przy braku jego hamujcego odpowiednika ma zwizek z wystpowaniem twardziny ukadowej. Obecno KIR2DS2 wykazuje zwizek z RZS z zapaleniem naczy. W odniesieni do ZZSK przeprowadzono do tej pory dwie analizy. W pracy Lopez-Area stwierdzono czstsze wystpowanie KIR3DS1 u pacjentw w porwnaniu z osobami zdrowymi.Z drugiej stromy w badaniu HArvey i wsppracownikw nie wykazano adnego zwizku pomidzy genotypem KIR i wystepowaniem ZZSK. W adnej z dotychczasowych prac nie analizowano zaleznoci pomidzy genami KIR i przebiegiem klinicznym choroby.*Celem obecnej pracy bya poszerzona analiza oebejmujca *jw*jw*Porwnujc czsto wystpowania poszczeglnych genw KIR w grupie osb zdrowych i u pacjentw z ZZSK stwierdzlimy znamienn rnic w odniesieniu do KIR2DS5. Gen ten w populacji zdrowej wystpowa z czstoci 13,8% wobec 27,8% w grupie z ZZSK. W przypadku pozostaych genw nie stwierdzilimy znamiennych rnic.*Obecno poszczeglnych genw dla aktywujcych KIR wykazywaa zwizek z aktywnoci choroby w momencie rozpoznania. W pacjentw z obecnocia KIR2DS5, KIR2DS1 i KIR3DS1 wyjciowe wartoci OB. Byy znamiennie mniejsze w porwnaniu z chorymi nie posiadajcymi genw dla tych receptorw*Analogicznie, obecno KIR2DS5, KIR2DS1 i KIR3DS1 wizaa si z mniejszym nasileniem blu nocnego.*U chorych z obecnoci genu dla KIR2DS5 stwierdzano znamiennie mniejszy ubytek wzrowsu w porwnaniu z chorymi nieposiadajcymi tego genu*Podobnie, wystpowanie KIR2DS1, KIR2DS3 i KIR3DS1 wizao si z mniejsz zmian KRC*Podsumowujc, *