1

Supplementary information

Agmatine-conjugated cytidine in tRNA anticodon

essential for AUA decoding in archaea

Yoshiho Ikeuchi1, Satoshi Kimura1, Tomoyuki Numata2,3, Daigo Nakamura4,

Takashi Yokogawa4, Toshihiko Ogata5, Takeshi Wada5, Takeo Suzuki1 and

Tsutomu Suzuki1,*

1Department of Chemistry and Biotechnology, Graduate School of Engineering, University of Tokyo,

7-3-1 Hongo, Bunkyo-ku, Tokyo 113-8656, Japan. 2Institute for Biological Resources and Functions, National Institute of Advanced Industrial Science

and Technology (AIST), Ibaraki 305-8566, Japan 3PRESTO, JST, Honcho, Kawaguchi-shi, Saitama 332-0012, Japan 4Department of Biomolecular Science, Faculty of Engineering, Gifu University, Gifu 501-1193,

Japan. 5Department of Medical Genome Sciences, Graduate School of Frontier Sciences, Universitiy of

Tokyo, Kashiwa, Chiba 277-8562, Japan.

Nature Chemical Biology: doi:10.1038/nchembio.323

2

Supplementary materials and methods

Isolation of tRNAIle2 and N355 (agm2C) from archaeal cells

H. marismortui cells (50 g) were suspended in a buffer (1.08 L) consisting of 0.2 M KOAc (pH

4.75) and 0.15 M KCl, mixed with water-saturated phenol (500 mL), and shaken vigorously

overnight to extract total RNAs. The ethanol-precipitated RNAs were dissolved in a buffer (400 mL)

consisting of 20 mM Tris-HCl (pH 7.6), 10 mM MgCl2, 0.2 M NaCl and 1 mM DTT, and then

charged on a column with Q-Sepharose Fast Flow (GE Healthcare). The tRNA fraction was eluted

from the column with an elution buffer [20 mM Tris-HCl (pH 7.6), 10 mM MgCl2, 0.7 M NaCl and

1 mM DTT]. 1,400 A260unit (70 mg) of crude tRNA was obtained. The individual tRNAIle2 was

purified by an optimized solid-phase DNA probe method1.

Total RNA from S. tokodaii was extracted by the method of acid guanidinium

thiocyanate-phenol-chloroform extraction2. S. tokodaii cells (105 g) were suspended in a buffer (900

mL) consisting of 4 M guanidium thiocyanate, 25 mM sodium citrate, 0.5% N-Lauroylsarcosine

sodium salt and 0.1 M � -mercaptoethanol, and then mixed with 90 mL of 2 M sodium acetate (pH 4.0)

and 900 mL of phenol (pH 4.8). The solution was shaken overnight. Four-hundred-and-eighty

milliliters of chloroform:isoamylalcohol (49:1) was added to the solution and centrifuged. The

aqueous phase was collected, and the RNAs were ethanol precipitated. The RNAs (1500 mg) were

dissolved in 70 mL of water. The RNAs were loaded on a DEAE Sepharose Fast Flow column (350

mL beads) and fractionated with a gradient of sodium chloride from 250 to 500 mM in 20 mM

Hepes-KOH (pH 7.6) and 8 mM magnesium chloride. The fractions digested into nucleosides were

analyzed by LC/MS, and the fractions enriched with N355 were pooled (36 mg). The RNAs recovered

from the pooled fractions were digested into nucleosides with nuclease P and bacterial alkaline

phosphatase, and nucleosides were fractionated on an ODS-3 reversed-phase column (GL Sciences,

Japan) to obtain N355.

Expression and purification of recombinant TiaS

A gene encoding Archaeoglobus fulgidus TiaS (AfTiaS) was PCR-amplified from genomic DNA of

A. fulgidus DSM 4304 with a set of primers,

AfTiaS-5’;5’-cccgccatatgagagtctgggtgggaattgacgacacgg-3’ and AfTiaS-3’;

5’-ccccgggatccttatctgaaaatgtgcctgccttccacgttc-3’. The product was cloned into pET-15b (Novagen).

The N-terminal histidine-tagged AfTiaS was over-produced in the E. coli strain BL21-CodonPlus

(DE3)-RIL (Stratagene). The harvested E. coli cells were lysed by sonication in lysis buffer

consisting of 20 mM Tris-HCl (pH 8.0), 300 mM NaCl, 10 mM imidazole, 7 mM � -mercaptoethanol,

1 mM PMSF and 1 mM benzamidine. After the cell debris was removed by centrifugation at 8,000

rpm for 30 min, the recombinant AfTiaS was purified on Ni-NTA agarose (Qiagen) according to the

manufacturer’s instructions. The pooled fraction containing AfTiaS was dialyzed against 20 mM

Tris-HCl (pH 8.0), 200 mM NaCl, and 1 mM DTT, and was concentrated with a 30,000 MWCO

Nature Chemical Biology: doi:10.1038/nchembio.323

3

centrifugal filter device (Amicon). The protein concentration of AfTiaS was determined by the

Bradford method, with bovine serum albumin as a standard protein.

Mutagenesis of TiaS

Site-directed mutagenesis of AfTiaS was carried out on the plasmid pET-AfTiaS by QuikChangeTM

Site-Directed Mutagenesis (Stratagene) according to the manufacturer’s instructions. The pairs of

oligonucleotide primers used to create mutations are listed below. The mutant proteins were produced

and purified using the same procedure as for wild-type AfTiaS.

5’-ggcacaaaaagggagctgctctcatcggagcccttgc-3’ and 5’-gcaagggctccgatgagagcagctccctttttgtgcc-3’ for

M1(R140A/G141A), 5’-ggagcttgaagactttacgttggctctaatagcctacaggtatcc-3’ and

5’-ggatacctgtaggctattagagccaacgtaaagtcttcaagctcc-3’ for M2(E159A),

5’-cgttggagctaatagccgctgcttatccagagagattcggg-3’ and 5’-cccgaatctctctggataagcagcggctattagctccaacg-3’

for M3(Y163A/R164A), 5’-ccccagaccttcgacaacgttgcttggtgcaatgatgttgtagtc-3’ and

5’-gactacaacatcattgcaccaagcaacgttgtcgaaggtctgggg-3’ for M4(D196A),

5’-ggtgctttacggaatcgctgctgagagtgtcgaggctc-3’ and 5’-gagcctcgacactctcagcagcgattccgtaaagcacc-3’ for

M5(R217A/G218A), 5’-cgttactaaccacgcagctgctatgcaccttattggggagg-3’ and

5’-cctccccaataaggtgcatagcagctgcgtggttagtaacg-3’ for M6(T248A/D249A),

5’-gataaggctgctcagaaagggggctgttgttgaagtttacggc-3’ and

5’-gccgtaaacttcaacaacagccccctttctgagcagccttatc-3’ for M7(D318A),

5’-gaaaaaagacacgataaaccttgctgctatacaaatcgttgagctcgcg-3’ and

5’-cgcgagctcaacgatttgtatagcagcaaggtttatcgtgtcttttttc-3’ for M8(E334A/K335A), and

5’-gagaagaatccaatcgctccgagcgctgggaggagaatggag-3’ and

5’-ctccattctcctcccagcgctcggagcgattggattcttctc-3’ for M9(C352A/C355A).

Preparation of tRNA transcripts

A series of tRNAIle2 molecules were transcribed in vitro using T7 RNA polymerase as described3.

Templates for in vitro transcription were constructed by PCR using synthetic DNA oligonucleotides

carrying the tRNA gene under the T7 promoter sequence4. The oligo-DNAs ST15-5’

(gctaatacgactcactatagggcccgtagcttagcccggt), ST15-body

(cccgtagcttagcccggtagagcgcccggctcataaccgggtggtccggg) and ST15-3’

(tgggcccgcggggacttgaaccccggaccacccggtta) were used to construct the template for S. tokodaii

tRNAIle2. AF_Met_3-5’ (gctaatacgactcactatagggcccgtagcttagcca), AF_Met_3-body

(gggcccgtagcttagccaggtcagagcgcccggctcataaccgggcggtc) and AF_Met_3-3’

(tggtgggcccggagggattcgaaccctcgaccgcccggttatgagc) were used to construct the template for A. fulgidus

tRNAIle2. PH33-5’; gctaatacgactcactatagggcccgtagctcagcct, PH33-body;

gggcccgtagctcagcctggtcagagcgcgcggctcataaccgcgtggtc, PH33-3’;

tggtgggcccgcggggatttgaaccccggaccacgcggttatgagc were used for the construction of the template for P.

horikoshii tRNAIle2. The transcribed tRNAs were separated on 10% polyacrylamide gel containing 7

M urea, cut out of the gel and eluted.

Nature Chemical Biology: doi:10.1038/nchembio.323

4

Figure S1. Mass spectrometric analysis of N355 from H. marismortui tRNAIle2.

(a) LC/MS analysis of nucleosides from H. marismortui tRNAIle2. UV trace (top), mass

chromatograms for nucleoside proton adducts [N355 + H]+ (m/z 356, middle) and base-related ion

BH2+ (m/z 224, lower panel) are shown.

(b) RNase T1 fragment analysis of H. marismortui tRNAIle2 by total ion chromatogram (top) and

mass chromatogram of m/z 1719 (bottom), which is a doubly-charged negative ion of

CUN355AUt6AACCGp (MW 3440), as shown in Figure 1a.

Nature Chemical Biology: doi:10.1038/nchembio.323

5

c

Figure S2. Mass spectrometric analysis of N355 from Sulfolobus tokodaii. (a) UV trace (top), mass chromatograms for nucleoside proton adduct [N355 +H]+ (m/z 356, middle)

and base-related ion BH2+ (m/z 224, lower).

(b) Mass spectrum of N355. The base-related ion of N355 was observed. N6, N6-dimethyladenosine

observed in the same spectrum is asterisked.

(c) FTMS spectrum of BH2+ ion of N355. The atomic composition C9H18N7

+ was deduced from the

observed m/z 224.16176 with low error value of 0.27ppm.

Nature Chemical Biology: doi:10.1038/nchembio.323

6

Figure S3. Structural analysis of N355 by deuterium exchange

(a) Mass spectra of N355 in solvent with H2O (blue) or D2O (red). Isotopic ions are observed from

m/z 361 to 366 in D2O solvent.

(b) MS/MS spectra of N355 in solvent with H2O (blue) or D2O (red). Precursor ions m/z 356 in H2O

and m/z 365 (+9) in D2O were chosen for CID. Product ions at m/z 224, 207, 182 and 165 in H2O

solvent were shifted to m/z 231-232 (+7-8), 212-213 (+5-6), 187-188 (+5-6) and 168-169 (+3-4) in

D2O, respectively.

(c) Chemical structure of agm2C with product ions assigned based on the CID spectrum. The number

of solvent-exchangeable protons is indicated in red.

Nature Chemical Biology: doi:10.1038/nchembio.323

7

Figure S4. Chemical synthesis of agm2C.

(a) Synthesis scheme for agm2C. A detailed description is presented in the Methods section.

(b) 1H-COSY spectrum of purified agm2C in D2O. The x- and y-axes represent chemical shift ppm

values. All the ribose protons (H1’, H2’, H3’, H4’, H5’ and H5’) and their cross peaks are assigned.

In the base, H5 and H6 protons with cross peaks are observed. All alkyl protons in the agmatine side

Nature Chemical Biology: doi:10.1038/nchembio.323

8

chain and their cross peaks are shown.

Nature Chemical Biology: doi:10.1038/nchembio.323

9

Figure S5. Characterization of agm2C.

(a) MS/MS spectra of natural (left) and synthesized (right) agm2C.

(b) UV spectrum of synthesized agm2C.

Nature Chemical Biology: doi:10.1038/nchembio.323

10

Figure S6. In vivo stable isotope labeling of agm2C in M. acetivorans. (a) Chemical structure of stable isotopic [13C, 15N] agmatine and [13C, 15N] arginine. 13C and 15N are

indicated by asterisks.

(b) Mass chromatograms of proton-adduct of agm2C (m/z 356, black) or stable isotope labeled agm2C

(m/z 365, red). LC/MS analyses of total RNAs from M. acetivorans grown in medium supplemented

with [13C, 15N] agmatine.

(c) Mass spectra of proton-adduct of agm2C (m/z 356, black) or stable isotope-labeled agm2C (m/z

365, red). The m/z shift due to the stable isotope is indicated in parentheses.

(d) CID spectrum of stable isotopic agm2C (precursor ion m/z 365) labeled by [13C, 15N] agmatine.

BH2+ of agm2C is detected with m/z 233.

Nature Chemical Biology: doi:10.1038/nchembio.323

11

Figure S7. CID spectrum of the anticodon-containing fragment bearing in vitro reconstituted

agm2C34.

The [M-3H]3- ion (m/z 1097.5) was employed as a precursor ion for CID. The sequence of the

anticodon-containing fragment with agm2C was confirmed by assignment of the product ions. The

nomenclatures for product ions of nucleic acids were as previously described5.

Nature Chemical Biology: doi:10.1038/nchembio.323

12

Retentiontime (min)

ModifiedCUagm2CAUAACCGp

MW3294.5(m/z1646.3)

UnmodifiedCUCAUAACCGpMW3182.4(m/z1590.2)

-TiaS+ATP+agmatine

+TiaS+ATP+agmatine

agm2C34

20 3025

agm2C34C34

20 30

C34

25

Figure S8. In vitro reconstitution of agm2C by Pyrococcus horikoshii TiaS.

RNase T1 fragment analyses of P. horikoshii tRNAIle2 presented as mass chromatograms of the

anticodon-containing fragments with (right) or without (left) agm2C; doubly-charged ions of

CUCAUAACCGp (m/z 1590.2, MW 3182.4) and CUagm2CAUAACCGp (m/z 1646.3, MW

3294.5). In vitro reconstitution of agm2C was carried out without (top) or with (bottom) TiaS in the

presence of ATP and agmatine.

Nature Chemical Biology: doi:10.1038/nchembio.323

13

OB -fol d

Figure S9. Sequence alignment of TiaS from various archaeal species.

Aligned are AF2259 (Archaeoglobus fulgidus), PH1812 (Pyrococcus horikoshii), ST0312

(Sulfolobus tokodaii), MJ1095 (Methanococcus jannaschii), MTH966 (Methanothermobacter

thermautotrophicus), Ta0545 (Thermoplasma acidophilum), TVN0599 (Thermoplasma volcanium),

PAB0247 (Pyrococcus abyssi) and VNG2110C (Halobacterium sp. NRC-1). The mutagenized

positions and the three conserved domains, DUF1743, OB-fold and the zinc finger-like motif, are

indicated.

Nature Chemical Biology: doi:10.1038/nchembio.323

14

Supplementary references

1. Yokogawa, T., Kitamura, Y., Nakamura, D., Ohno, S. & Nishikawa, K. Optimization of the

hybridization-based method for purification of thermostable tRNAs in the presence of

tetraalkylammonium salts. Nucleic Acids Res in press (2009).

2. Chomczynski, P. & Sacchi, N. The single-step method of RNA isolation by acid guanidinium

thiocyanate-phenol-chloroform extraction: twenty-something years on. Nat Protoc 1, 581-585

(2006).

3. Ikeuchi, Y., Kitahara, K. & Suzuki, T. The RNA acetyltransferase driven by ATP hydrolysis

synthesizes N4-acetylcytidine of tRNA anticodon. EMBO J 27, 2194-2203 (2008).

4. Sampson, J. R. & Uhlenbeck, O. C. Biochemical and physical characterization of an

unmodified yeast phenylalanine transfer RNA transcribed in vitro. Proc Natl Acad Sci U S A

85, 1033-1037 (1988).

5. Mcluckey, S. A., Vanberkel, G. J. & Glish, G. L. Tandem Mass-Spectrometry of Small,

Multiply Charged Oligonucleotides. J Am Soc Mass Spectrom 3, 60-70 (1992).

Nature Chemical Biology: doi:10.1038/nchembio.323