Agenda Item G.6.c Supplemental Public Comment 2 Comprehensive

3
Comprehensive Conservation Proposal Oceana, Natural Resources Defense Council, and Ocean Conservancy July 31, 2013 26 Agenda Item G.6.c Supplemental Public Comment 2 September 2013

Transcript of Agenda Item G.6.c Supplemental Public Comment 2 Comprehensive

Page 1: Agenda Item G.6.c Supplemental Public Comment 2 Comprehensive

Comprehensive Conservation Proposal Oceana, Natural Resources Defense Council, and Ocean Conservancy July 31, 2013

26

Agenda Item G.6.c Supplemental Public Comment 2

September 2013

Page 2: Agenda Item G.6.c Supplemental Public Comment 2 Comprehensive

Comprehensive Conservation Proposal Oceana, Natural Resources Defense Council, and Ocean Conservancy July 31, 2013

27

Page 3: Agenda Item G.6.c Supplemental Public Comment 2 Comprehensive

Comprehensive Conservation Proposal Oceana, Natural Resources Defense Council, and Ocean Conservancy July 31, 2013

28

Figure 5.


Choi et al. Supplemental Information SUPPLEMENTAL ...€¦ · Choi et al. Supplemental Information 1 SUPPLEMENTAL INFORMATION SUPPLEMENTAL METHODS Isolation of Mouse Embryonic Dermal

Choi et al. Supplemental Information SUPPLEMENTAL ...€¦ · Choi et al. Supplemental Information 1 SUPPLEMENTAL INFORMATION SUPPLEMENTAL METHODS Isolation of Mouse Embryonic Dermal

On Time Public Comment List Statewide Finfish and ... · On Time Public Comment List Statewide Finfish and Supplemental Issues Meeting March 19- 24, 2013 Alaska Seine Boat Owners

On Time Public Comment List Statewide Finfish and ... · On Time Public Comment List Statewide Finfish and Supplemental Issues Meeting March 19- 24, 2013 Alaska Seine Boat Owners

Supplemental Data Supplemental Figures Legends …dm5migu4zj3pb.cloudfront.net/manuscripts/42000/42127/JCI42127sd.pdf · Supplemental Data Supplemental Figures Legends Suppl. Figure

Supplemental Data Supplemental Figures Legends …dm5migu4zj3pb.cloudfront.net/manuscripts/42000/42127/JCI42127sd.pdf · Supplemental Data Supplemental Figures Legends Suppl. Figure

A Part of the Comprehensive and Fully Integrated Framework ...info.marshall.usc.edu/faculty/critthink/Supplemental Material... · Concisely, and Persuasively USC Marshall Critical

A Part of the Comprehensive and Fully Integrated Framework ...info.marshall.usc.edu/faculty/critthink/Supplemental Material... · Concisely, and Persuasively USC Marshall Critical

SUPPLEMENTAL GUIDELINES FOR MENTAL HEALTH … · comprehensive individual assessment, including the evaluation of possible substance abuse. For children and adolescents, treatment

SUPPLEMENTAL GUIDELINES FOR MENTAL HEALTH … · comprehensive individual assessment, including the evaluation of possible substance abuse. For children and adolescents, treatment

Supplemental Figure 1. Supplemental Figure 2 Supplemental Figure 3 A B.

Supplemental Figure 1. Supplemental Figure 2 Supplemental Figure 3 A B.

Case 1:83-cv-03882-WGY Document 2619-2 Filed …...(accessed on April 17, 2013). Notice of Extension to Public Comment Period for Supplemental Consent Decree Lodged Under the Comprehensive

Case 1:83-cv-03882-WGY Document 2619-2 Filed …...(accessed on April 17, 2013). Notice of Extension to Public Comment Period for Supplemental Consent Decree Lodged Under the Comprehensive

180016 Osg Supplemental Comment

180016 Osg Supplemental Comment

Collected Supplemental Figures Marginsgenesdev.cshlp.org/content/suppl/2007/10/01/21.19.2448.DC1/... · Supplemental Figure 2 Supplemental Figure 4 Supplemental Figure 5 Supplemental

Collected Supplemental Figures Marginsgenesdev.cshlp.org/content/suppl/2007/10/01/21.19.2448.DC1/... · Supplemental Figure 2 Supplemental Figure 4 Supplemental Figure 5 Supplemental

SUPPLEMENTAL COMMENT REPORT - BPA.gov...SUPPLEMENTAL COMMENT REPORT I-5 Corridor Reinforcement Project Prepared for: Bonneville Power Administration P.O. Box 3621 Portland, OR 97208-3621

SUPPLEMENTAL COMMENT REPORT - BPA.gov...SUPPLEMENTAL COMMENT REPORT I-5 Corridor Reinforcement Project Prepared for: Bonneville Power Administration P.O. Box 3621 Portland, OR 97208-3621

STORMWATER COMPREHENSIVE PLAN 2020 · (Nov. 2018 to June 2019) Inform the public that the Stormwater Comprehensive Plan is being updated and invite them to comment Interview neighboring

STORMWATER COMPREHENSIVE PLAN 2020 · (Nov. 2018 to June 2019) Inform the public that the Stormwater Comprehensive Plan is being updated and invite them to comment Interview neighboring

Internal Medicine Supplemental Guide Draft Supplemental ... › ... › InternalMedicineSupplementalGuideDraf… · Internal Medicine Supplemental Guide Draft . 1 . Supplemental Guide:

Internal Medicine Supplemental Guide Draft Supplemental ... › ... › InternalMedicineSupplementalGuideDraf… · Internal Medicine Supplemental Guide Draft . 1 . Supplemental Guide:

COMMENTS AND RESPONSES TO THE DRAFT SUPPLEMENTAL … · EIR NO. 391-84-CUZ (ZV/Supplemental) Page F-16 Comment 1.3 The project applicant should construct the necessary curb ramps

COMMENTS AND RESPONSES TO THE DRAFT SUPPLEMENTAL … · EIR NO. 391-84-CUZ (ZV/Supplemental) Page F-16 Comment 1.3 The project applicant should construct the necessary curb ramps

Supplemental Materials Guide to Illinois’ 2020 Annual ......2020 Illinois Annual Comprehensive Housing Plan Supplemental Materials Guide 6 Focus Area #1: Revitalizing Communities

Supplemental Materials Guide to Illinois’ 2020 Annual ......2020 Illinois Annual Comprehensive Housing Plan Supplemental Materials Guide 6 Focus Area #1: Revitalizing Communities

Supplemental Fig.1 SUPPLEMENTAL FIGURES

Supplemental Fig.1 SUPPLEMENTAL FIGURES

SUPPLEMENTAL DATA Supplemental figures · SUPPLEMENTAL DATA Supplemental figures Supplemental Figure 1. ... 28 Rhodanese/Cell cycle control phosphatase superfamily protein At2g40760

SUPPLEMENTAL DATA Supplemental figures · SUPPLEMENTAL DATA Supplemental figures Supplemental Figure 1. ... 28 Rhodanese/Cell cycle control phosphatase superfamily protein At2g40760

for · SEOA Civil Engineering Comment Responses to Preliminary Draft Supplemental Environmental Impact Statement Dated March 1997 for Lakepointe Development

for · SEOA Civil Engineering Comment Responses to Preliminary Draft Supplemental Environmental Impact Statement Dated March 1997 for Lakepointe Development

SUPPLEMENTAL INFORMATION SUPPLEMENTAL EXPERIMENTAL PROCEDURES · supplemental information supplemental experimental procedures ... (ch001/ch005) g cccaagctttcatcagcaccacattgatctgac

SUPPLEMENTAL INFORMATION SUPPLEMENTAL EXPERIMENTAL PROCEDURES · supplemental information supplemental experimental procedures ... (ch001/ch005) g cccaagctttcatcagcaccacattgatctgac

RCA Comment on Latest Draft Reston Areawide Comprehensive Plan Language

RCA Comment on Latest Draft Reston Areawide Comprehensive Plan Language

Supplemental Material Supplemental Experimental Procedures ...

Supplemental Material Supplemental Experimental Procedures ...