AEM Accepted Manuscript Posted Online 28 August 2015 … › content › aem › early › 2015 ›...

YjeH is a novel L-methionine and branched chain amino acids 1

exporter in Escherichia coli 2

3

Running title: An amino acid exporter in E. coli 4

5

Qian Liu1, 2, Yong Liang2, Yun Zhang2, Xiuling Shang2, Shuwen Liu2, Jifu Wen2, 3, 6

Tingyi Wen1, 2* 7

8

1School of Life Sciences, University of Science and Technology of China, Hefei, 9

Anhui 230026, China 10

2CAS Key Laboratory of Microbial Physiological and Metabolic Engineering, 11

Institute of Microbiology, Chinese Academy of Sciences, Beijing, China 12

3University of Chinese Academy of Sciences, Beijing, China 13

14

*Corresponding author. CAS Key Laboratory of Microbial Physiological and 15

Metabolic Engineering, Institute of Microbiology, Chinese Academy of Sciences, 1 16

West Beichen Road, Chaoyang District, Beijing 100101, China. 17

Phone: (86) 10-64806119, Fax: (86) 10-64806157, E-mail: [email protected] 18

19

20

21

22

AEM Accepted Manuscript Posted Online 28 August 2015Appl. Environ. Microbiol. doi:10.1128/AEM.02242-15Copyright © 2015, American Society for Microbiology. All Rights Reserved.

on July 11, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

http://aem.asm.org/

Abstract 23

Amino acid efflux transport systems have important physiological functions and 24

play vital roles in the fermentative production of amino acids. However, no 25

methionine exporter has yet been identified in Escherichia coli. In this study, we 26

identified a novel amino acid exporter YjeH in E. coli. The yjeH overexpression strain 27

exhibited high tolerance to the structural analogues of L-methionine and branched 28

chain amino acids, decreased intracellular amino acids levels and enhanced export 29

rates in the presence of a Met-Met, Leu-Leu, Ile-Ile or Val-Val dipeptide, suggesting 30

that YjeH functions as an L-methionine and the three branched chain amino acids 31

exporter. The export of the four amino acids in the yjeH overexpression strain was 32

competitively inhibited to each other. The expression of yjeH was strongly induced by 33

increasing cytoplasmic concentrations of substrate amino acids. GFP-tagged YjeH 34

was visualized by total internal reflection fluorescence microscopy to confirm the 35

plasma membrane localization of YjeH. Phylogenetic analysis of transporters 36

indicated that YjeH belongs to amino acid efflux family of amino acid / polyamine 37

/organocation (APC) superfamily. Structural modeling revealed that YjeH has the 38

typical 5+5 transmembrane α-helical segments (TMSs) inverted repeat fold of APC 39

superfamily transporters, and its binding sites are strictly conserved. The enhanced 40

capacity of L-methionine export by the overexpression of yjeH in an 41

L-methionine-producing strain resulted in a 70% improvement in titer. This study 42

supplements the transporter classification and provides a substantial basis for the 43

application of the methionine exporter in metabolic engineering. 44


.asm.org/

Dow

nloaded from

http://aem.asm.org/

Introduction 45

Membrane transport mediates the exchange of materials and energy with the 46

surroundings to facilitate cell viability (1). Amino acids play central roles both as the 47

building blocks of proteins and as intermediates in metabolism. Amino acid transport 48

processes, including uptake and efflux, exist widely in bacteria. Amino acids in the 49

surrounding environment can be imported into cells directly to participate in protein 50

synthesis or carbon and nitrogen metabolism without spending energy for anabolism 51

(2). The export process, however, is essential to maintain the intracellular amino acid 52

pool and exhibits significant applications for amino acid over-production. 53

Amino acid transport processes are mostly transporter-mediated in prokaryotes. In 54

E. coli, the L-methionine uptake system MetNIQ is a typical primary transporter 55

which utilizes the energy of ATP binding and hydrolysis to transport substrates(3). 56

While amino acid / polyamine / organocation (APC) superfamily is one of the largest 57

superfamilies with nearly 250 secondary transporters. The amino acid residue 58

numbers of these transporters vary in length from 350 to 850 (4). Many amino acids 59

are transported through APC carriers that function as solute-cation symporters and 60

solute-solute antiporters, such as the lysine importer LysP in E. coli (5) and the 61

aromatic amino acid and histidine importer AroP in Corynebacterium glutamicum (6). 62

Crystal structures of transporters provide insights into substrate binding modes and 63

transport mechanisms. However, only four APC carrier crystal structures have been 64

resolved, including the leucine transporter LeuT from Aquifex aeolicus (7, 8); the 65

Glu-GABA antiporter GadC from E. coli (9); the Arg-Agm antiporter AdiC from 66


.asm.org/

Dow

nloaded from

http://aem.asm.org/

Salmonella enterica (10) and E. coli (11-13); and the proton-coupled transporter ApcT 67

from Methanocaldococcus jannaschii (14). Based on the reported structures, the 68

homology models of the APC superfamily members including the lysine-cadaverine 69

antiporter CadB and the putrescine-ornithine antiporter PotE were analyzed (15). All 70

of these proteins have the typical APC transporter structure with 12 transmembrane 71

α-helical segments (TMSs) and play the same role of importing amino acids into the 72

intracellular space. 73

Amino acid efflux transporters are attracting more attention in systems metabolic 74

engineering for amino acid production. Because efflux processes play important roles 75

in the extracellular accumulation of amino acids. In the last 20 years, more than 10 76

amino acid efflux systems have been identified in C. glutamicum and E. coli, 77

including the lysine exporter LysE (16, 17), the isoleucine and methionine export 78

system BrnFE (18, 19), the threonine exporter ThrE (20), the glutamine acid exporter 79

NCgl1221 (21), the threonine exporters RhtA and RhtC (22, 23), the valine export 80

system YgaZH (24), and the aromatic amino acid exporter YddG (25-27). 81

Applications of amino acid exporters in engineered strains effectively improve amino 82

acid production (28). However, due to the challenges of membrane protein 83

crystallography, structural information for many amino acid exporters is unavailable. 84

Therefore, the detailed mechanisms of substrate recognition and transport are 85

unknown. 86

L-Methionine is the only sulfur-containing essential amino acid. It is the precursor 87

of the important methyl donor S-adenosyl-L-methionine (SAM) and participates in 88


.asm.org/

Dow

nloaded from

http://aem.asm.org/

many transmethylation reactions during the metabolism and activation of vital 89

macromolecules such as nucleic acids, proteins and phospholipids (29). Being widely 90

used in feed, medicine and food industries, the L-methionine is one of the most 91

important bulk products in biotechnology with the global annual production of 92

approximately 1 million tons. Until now, the main production method of methionine is 93

chemical synthesis(30). Due to the increasing demand in the international market and 94

the pollution caused by chemical synthesis, an environmentally friendly fermentation 95

method is urgently required. Currently, much research focuses on the complicated 96

process of methionine biosynthesis and regulation. But the reports of L-methionine 97

efflux systems have been comparatively rare. In C. glutamicum, BrnFE was identified 98

as the methionine efflux system (18). However, methionine export systems in E. coli 99

have not been reported. 100

The yjeH gene encodes a putative membrane protein in E. coli. According to the 101

Transporter Classification Database (TCDB), YjeH belongs to Amino Acid Efflux 102

(AAE) family (TC#2.A.3.13) of the APC superfamily (TC#2.A.3), while it has also 103

been classified into the basic amino acid / polyamine antiporter (APA) family (4), 104

which indicated that YjeH may involove in amino acid transport in E.coli. In this 105

study, the function, localization and gene expression of YjeH were investigated, 106

which confirmed that YjeH is an L-methionine and branched chain amino acids 107

(BCAAs) exporter. Furthermore, the structure and substrates binding mode were 108

identified and illustrated by homologous modelling and docking. 109

MATERIALS AND METHODS 110


.asm.org/

Dow

nloaded from

http://aem.asm.org/

Bacterial strains, plasmids and growth conditions. The bacterial strains and 111

plasmids used in this study are listed in Table 1. The E. coli strain EC135 (31) was 112

used as a cloning host. Cells were grown at 37 ºC in lysogeny broth (LB) medium (32) 113

or minimal medium (MM) (33). When required, L-methionine (100 μg/mL), L-leucine 114

(100 μg/mL), L-isoleucine (100 μg/mL), L-valine (100 μg/mL), chloramphenicol (34 115

μg/mL), ampicillin (100 μg/mL), or cumate (50 μmol/L) was added. When needed, 116

10mM different kinds of amino acid structural analogues such as DL-ehtionine, 117

DL-norleucine, DL-norvaline, DL-2-Amino-3-hydroxyvaleric acid, 118

S-(2-Aminoethyl)-L-cysteine hydrochloride, sulfaguanidine monohydrate, L 119

-azetidine-2-carboxylic acid or L-N-Boc-5-fluorotryptophan was added for growth 120

inhibition test. 121

Construction of recombinant plasmids and strains. The genes and homologous 122

arm fragments for gene deletion were amplified using the corresponding primers 123

listed in Table 2. Correct mutation and in-frame gene deletion were verified by PCR 124

and sequencing. The up- and downstream homologous arm fragments of yjeH (metJ, 125

metA or atpIBEFHAGDC) and the three mutated metA fragments were amplified 126

respectively Then the two fragments of each gene (three fragments of mutated metA) 127

were annealed to a single fragment by overlap extension PCR. The Not I/Xba I 128

-digested fragments were ligated to the Not I/Xba I-digested pKOV to construct 129

pWYE184 (or pWYE185, pWYE186, pWYE188) and pWYE187. Gene knockout 130

was introduced into E. coli W3110 using the homologous recombination system 131

mediated by pKOV (34). The metA site directed mutagenesis was constructed by two 132


.asm.org/

Dow

nloaded from

http://aem.asm.org/

rounds of pKOV-mediated genetic modification. The first round modification 133

constructed the metA knockout mutant using pWYE186, and then the second round 134

modification inserted the mutated metA fragment into the original position with 135

pWYE187. The yjeH fragment was amplified, digested and ligated to the digested 136

pACYC184 by EcoN I/Sal I to construct pWYE2123. The yjeH-gfp (or yddG-gfp) 137

fusion was amplified using pWYE2132 (pWYE2132 for PBB (35) and E. coli W3110 138

genomic DNA for yddG) and pAD43-25 (for GFP) as templates using the primers 139

listed in Table 2 to construct pWYE2133 (or pWYE2134). The cym and cmt operons 140

from Pseudomonas putida F1 were used to tightly regulate amino acid exporter gene 141

expression using cumate as the inducer, which is water soluble, nontoxic to culture, 142

and inexpensive (36). The cymR gene was cloned to pACYC184 under the weak 143

promoter PKM. The yjeH and ygaZH was cloned under the control of PT5Ocmt to 144

construct the plasmids pWYE2135 and pWYE2136, respectively. Other strains 145

harboring plasmids were constructed by electroporation with the corresponding 146

plasmids. 147

Amino acid uptake assay. A modified amino acid uptake assay was performed 148

according to the previously reported methods (37-39). Strains H2 and H3 were grown 149

respectively in LB medium and inoculated into the minimal medium for overnight 150

cultivation and then the overnight cultures were inoculated again into the minimal 151

medium. Cells were collected at the mid-log phase, washed three times with ice-cold 152

minimal medium and suspended in pre-warmed C-N-minimal medium (minimal 153

medium without carbon or nitrogen, 37 ºC) to the original cell density and incubated 154


.asm.org/

Dow

nloaded from

http://aem.asm.org/

with aeration at 37 ºC for 18h, cells were then harvested, washed once and 155

resuspended in the C-N- minimal medium to an OD600 of 2.0 (0.84 mg cell dry weight 156

mL-1) and then 20 kinds of amino acids were added in the medium, and the 157

extracellular amino acid concentration was measured. There was no protein synthesis 158

during the whole process in the C-N- minimal medium. 159

Amino acid export assay. A dipeptide addition assay was conducted to determine 160

the amino acid export rate(18, 19, 33, 40). Cells were grown in LB medium for 8h and 161

then transferred into minimal medium for overnight cultivation. The overnight culture 162

was inoculated again into minimal medium. Cells were collected at the mid-log phase, 163

washed three times with ice-cold minimal medium and suspended in pre-warmed 164

minimal medium (37 ºC) to an OD600 of 2.0 (0.84 mg cell dry weight mL-1) as the 165

method of amino acid uptake assay. Phe-Ala, His-Asn, Ile-Met, Asp-Cys, Trp-Gly, 166

Leu-Val, Gln-Arg, Tyr-Ser, Pro-Thr, Glu-Lys, Met-Met, Leu-Leu, Ile-Ile or Val-Val 167

dipeptide (Scilight-Peptide) was added to initiate the reactions after 10 min 168

pre-incubation at 37 ºC, and the cultures were stirred by magnetic stirrers at 750 rpm. 169

Samples were collected and separated by the silicone oil method with modification 170

(41-43). The cells were placed upon the silicone oil AR200 and AR20 (Sigma-Aldrich) 171

mixture in the ratio 3:2, with 35% (wt/wt) perchloric acid in the bottom of the pipe. 172

The intracellular and extracellular fractions were separated by centrifugation 173

(20,000×g, 4 ºC, 90 s). The extracellular fractions were recovered from the cell 174

suspension remaining above the silicon layer. The cell pellets were sonicated and 175

centrifuged, and the intracellular fractions were neutralized with 3 M Na2CO3. Amino 176


.asm.org/

Dow

nloaded from

http://aem.asm.org/

acids in the extracellular and intracellular fractions were quantified as their 177

2,4-dinitrofluorobenzene (DNFB) derivatives by high-performance liquid 178

chromatography (HPLC), as reported previously(44). 179

Shake flask fermentation. For shake flask cultivation, seed cultures were prepared 180

by transferring the overnight cultures of strain H11 or H12 prepared in LB medium 181

into 500 mL baffled flasks containing 20 mL seed medium. At an OD600 of 10, 1 mL 182

of seed culture was inoculated in a 500 mL baffled shake flask with 30 mL 183

fermentation medium. The cells were grown in triplicate at 37 ºC and shaken at 220 184

rpm. Cumate was added at 4 h. The pH was adjusted by supplementation with 185

ammonia. The seed medium contained 25 g/L glucose, 10 g/L (NH4)2SO4, 1 g/L 186

KH2PO4, 0.5 g/L MgSO4·7H2O, 2 g/L yeast extract, 10 g/L CaCO3, and 5 mL/L trace 187

element solution (44). The fermentation medium contained 40 g/L glucose, 15 g/L 188

(NH4)2SO4, 2.3 g/L KH2PO4, 0.8 g/L MgSO4·7H2O, 2 g/L yeast extract, 10 g/L 189

CaCO3, and 5 mL/L trace element solution. The fermentation lasted for 48 h. 190

Total internal reflection fluorescence microscopy study of GFP-tagged YjeH. 191

The YjeH-GFP fusion protein was constructed as above. The cells were harvested in 192

the stable phase. Images were acquired on a custom-built total internal reflection 193

fluorescence (TIRF) microscope based on an Olympus IX71 inverted microscope 194

frame fitted with a 100×1.49 NA oil-immersion objective. Excitation light at 488 nm 195

from a solid-state laser (Coherent Inc.) was used to excite GFP, the YjeH-GFP and 196

YddG-GFP fusion in TIRF mode. 197

RNA preparation and real-time quantitative RT-PCR. The target strains were 198


.asm.org/

Dow

nloaded from

http://aem.asm.org/

cultured to the mid-log phase and 100 mM methionine or branch chain amino acids 199

(BCAAs) was added. Total RNA was isolated using the RNAprep pure Bacteria Kit of 200

Tiangen, China. The reverse transcription (RT) of approximately 500 ng of RNA was 201

performed with the specific primers listed in Table 2 for yjeH and gapA (used as the 202

reference gene to normalize the yjeH mRNA levels) and FastQuant RT Kit of Tiangen. 203

Quantitative PCR was performed with BRYT Green from the GoTaq qPCR master 204

mix (Promega, USA) and the Rotor-Gene Q Real-Time PCR Detection System 205

(Qiagen, Germany). The quantitative-PCR (qPCR) products were verified with a 206

melting curve analysis. Data collection and analysis were facilitated by the RotorGene 207

Q Series software, version 2.0.3, according to the 2–ΔΔCT method (45). 208

Western Blotting. Peptide synthesis of the sequence HLASEFKNPERDFP and the 209

corresponding rabbit polyclonal antibody were prepared by ComWin Biotech of 210

Beijing. Cells were cultured as described above. Membrane proteins were extracted as 211

in the method reported previously (6). The total protein concentration in the 212

membrane fraction was analyzed by BCA assay according to the manufacturer’s 213

instructions (Solarbio). Samples from different culture conditions were analyzed by 214

SDS-polyacrylamide gel electrophoresis and the protein was electrotransferred to a 215

polyvinylidene difluoride (PVDF) membrane and probed with the antibody. The blots 216

were visualized with a peroxidase-coupled goat anti-rabbit secondary antibody and an 217

enhanced chemiluminescence (ECL) color development reagent (GE, USA). 218

Sequence analysis and homology modeling. Sequence BLAST was achieved by 219

the UniProt program (http://www.uniprot.org). The alignment of sequences and the 220


.asm.org/

Dow

nloaded from

http://aem.asm.org/

secondary structure analysis of YjeH (P39277), AdiC (P60061), PotE (P0AAF1) and 221

CadB (P0AAE8) from E. coli were performed using ESPript 3.0 222

(http://espript.ibcp.fr/ESPrint/ESPript/). YjeH and AdiC share moderate sequence 223

similarity (21.23% identity in 97% coverage), which is adequate for sustaining a 224

theoretical model for YjeH. Based on the AdiC structure 3NCY (without arginine 225

bound) (10) and 3L1L (with arginine bound) (12), YjeH models were generated by the 226

automated comparative protein structure homology-modeling server SWISS-MODEL 227

(http://swissmodel.expasy.org). The global model quality estimation (GMQE) scores 228

were 0.61 and 0.62, respectively (46-48). 229

Docking analysis. Molecular docking was carried out with the AutoDock tools 230

(ADT) v1.5.6 and AutoDock v4.2 program from the Scripps Research Institute 231

(http://www.scripps.edu/mb/olson/doc/autodock). Methionine and BCAAs were 232

docked to the structure model of YjeH based on 3L1L. The three-dimensional grids 233

were created with a 60-Å grid size (x, y and z) with a spacing of 0.375 Å. The grid 234

maps that represent the ligand in the docking target site were calculated with 235

AutoGrid 4.2, and automated dockings were subsequently performed with AutoDock 236

4.2. 237

Phylogenetic analysis. Sequence alignment was generated by Clustal X2. The 238

phylogenetic tree was constructed with TreeView 1.6.6 according to the 239

neighbor-joining method with 1000 steps. 240

RESULTS 241

YjeH functions as the L-methionine and BCAAs efflux transporter. The E. coli 242


.asm.org/

Dow

nloaded from

http://aem.asm.org/

yjeH gene encodes a putative membrane protein belonging to the APC superfamily (4). 243

As YjeH is predicted to export L-methionine and other neutral, hydrophobic amino 244

acids according to the Transporter Classification Database (TCDB), and the efflux of 245

methionine and BCAAs were shown to be carried out by the same exporter, BrnFE, in 246

C. glutamicum (18, 19), we examined whether YjeH functions as an L-methionine and 247

BCAAs exporter in E. coli. We performed a growth test using structural analoues of 248

L-methionine and BCAAs. Incorporation of structural analogues of amino acids into 249

proteins contributes to the formation of partially active or inactive enzymes and leads 250

to growth inhibition or even lethality to microorganisms (49). Strains H2 and H3 were 251

cultured in parallel in the minimal medium (MM) plate containing 10 mM 252

DL-ethionine, 10 mM DL-norleucine, or 10 mM DL-norvaline. Both of the two strains 253

grew well on the MM plate (Fig. 1A), but on the MM plates containing analogues, the 254

yjeH deletion mutant did not grow compared to normal growth of yjeH 255

overexpression strain (Fig. 1A). These results showed that yjeH overexpression 256

improved the tolerance of strain to the structural analogues. 257

To further analyze whether YjeH could export L-methionine and BCAAs, amino 258

acid export assay was carried out with the dipeptides Met-Met, Leu-Leu, Ile-Ile and 259

Val-Val. As shown in Fig. 1B, when cells were incubated in medium with 5 mM 260

Met-Met, the intracellular methionine level in the yjeH deletion strain H2 261

(approximately 120 mM) was much higher than that in strain H4 (approximately 80 262

mM). In contrast, the yjeH overexpression strain H5 accumulated the lowest 263

intracellular methionine level (approximately 30 mM). Correspondingly, the 264


.asm.org/

Dow

nloaded from

http://aem.asm.org/

methionine export rates of strains were determined in the presence of the Met-Met 265

dipeptide (Table 3). The extracellular methionine level of strain H5 increased 266

dramatically, at a high export rate of 173.0 ± 1.38 nmol/min/mg (dry weight) 267

compared to 105.6 ± 1.41 nmol/min/mg (dry weight) of strain H2 and 127.6 ± 1.21 268

nmol/min/mg (dry weight) of strain H4. Based on these results, it was concluded that 269

YjeH is a functional L-methionine exporter. Similarly, when incubated with the 270

dipeptides Leu-Leu, Ile-Ile or Val-Val, strain H5 showed much higher branched chain 271

amino acids export rate than strains H4 and H2 did (Fig. 1C-1E and Table 3). Taken 272

together, these results indicated that YjeH functions as an exporter of methionine and 273

branched chain amino acids. 274

In addition, substrate competition experiments were performed using the yjeH 275

overexpression strain in the simultaneous presence of Met-Met Leu-Leu, Ile-Ile, and 276

Val-Val. As shown in Fig. S2, the export activity of the indicated amino acid substrate 277

decreased when other substrates were added. These results proved that substrates of 278

the four amino acids competed with each other in the efflux transport process. To 279

investigate the substrate specificity of the YjeH, the export of other 16 amino acids as 280

well as the uptake transport of 20 natural amino acids by YjeH were also examined by 281

strains H2 and H3, the results shown in Fig. 2A and Fig. S1 indicated that YjeH could 282

only export L-methionine and BCAAs and could not function as the amino acid 283

importer. 284

To verify the classification of YjeH, the phylogenetic tree which consisted of 14 285

other APC transporters derived from four different families was constructed (Fig. 2B). 286


.asm.org/

Dow

nloaded from

http://aem.asm.org/

Although the stem of AdiC, PotE and CadB and the stem of AsoB and YjeH share a 287

short root at the beginning of the evolution, while they divided soon to form two 288

branches. Together with the function analysis above, we confirm that YjeH and AsoB 289

belong to the independent Amino Acid Efflux (AAE) family as there is no evidence to 290

support that these proteins can import amino acids or transport other metabolites. 291

YjeH is induced by the intracellular amino acids. It was reported that preloading 292

C. glutamicum cells could lead to a much higher intracellular concentration of 293

L-isoleucine by uptake of L-isoleucine rather than by uptake of Ile-Ile dipeptide (40). 294

This finding is similar to the uptake of L-methionine and BCAAs in E. coli in our 295

previous experiments (data not shown). With the addition of extracellular amino acids, 296

the effects of the substrate amino acids on yjeH expression were investigated by 297

RT-qPCR and Western blotting. As expected, the yjeH gene exhibited a low 298

expression level in the minimal medium and was significantly upregulated 12-fold 299

with the addition of L-methionine. Similarly, elevated transcription levels of yjeH 300

were observed in the presence of L-leucine and L-isoleucine, which is consistent with 301

as results by Western blot. This result indicated that yjeH expression was induced by 302

the three amino acids (Fig. 3). 303

The transcriptional levels of several genes involved in methionine metabolism in E. 304

coli are commonly controlled by the MetJ repressor (50). To examine whether MetJ 305

regulates yjeH expression, the metJ deletion mutant was constructed and the yjeH 306

mRNA and protein levels in response to metJ deletion were analyzed. Surprisingly, 307

the expression level of yjeH in the mutant was similar to that in the parent strain (Fig. 308


.asm.org/

Dow

nloaded from

http://aem.asm.org/

3), suggesting that yjeH expression was not repressed by MetJ. 309

YjeH activity is dependent on electrochemical ion potentials To investigate 310

whether the ATP or electrochemical potential was the driving force, methionine export 311

of the yjeH overexpression strain was examined in the presence of carbonyl cyanide 312

m-chlorophenylhydrazone (CCCP), a molecule commonly used for depolarization of 313

the membrane ion gradient. The results showed that the presence of CCCP completely 314

inhibited the efflux of L-methionine in the yjeH overexpression (Fig. 4A) and deletion 315

(Fig. 4B) strains. This result suggests that YjeH depends on electrochemical potential 316

for L-methionine efflux and does not rely on ATP molecules in E. coli. Furthermore, 317

the transmembrane electrochemical gradient of protons is coupled to ATP synthesis , 318

which can give rise to the proton motive force (PMF) (38). The operon 319

atpIBEFHAGDC encoding ATPase in E. coli W3110 was deleted to block the 320

interconversion of two cellular forms of energy (PMF and ATP) and the methionine 321

export assay was repeated in this deletion strain (H8) with strain H5 as the control. 322

When the two cellular forms of energy (PMF and ATP) cannot be interconverted, 323

neither the uptake of Met-Met dipeptide nor the export of methionine was affected 324

(Fig. 4C). 325

Localization of YjeH. YjeH was predicted to be a membrane protein with more 326

than 10 transmembrane helices by UniProt topological analysis. To identify the 327

localization of YjeH, YjeH-GFP fusion and YddG-GFP fusion (a positive control) 328

were constructed and total internal reflection fluorescence microscopy (TIRFM) 329

analysis showed that strains containing YjeH-GFP or YddG-GFP had much stronger 330


.asm.org/

Dow

nloaded from

http://aem.asm.org/

fluorescence signals than the strain containing intracellular expressed GFP (H14) (Fig. 331

5B, 5E, 5H, 5K), which indicated that YjeH may be localized at the cellular 332

membrane. In order to further confirm the localization of YjeH, cells were disrupted 333

by ultrasonication, cell debris and supernatant were detected by TIRFM after 334

disrupting the cells by ultrasonication.. YjeH-GFP and YddG-GFP could only be 335

detected in the cell debris (Fig. 5I, 5L) , confirming that YjeH existed at the plasma 336

membrane part in E. coli. 337

Homology modeling and docking with Met and BCAAs. Sequence alignments of 338

YjeH (P39277), AdiC (P60061), PotE (P0AAF1), CadB (P0AAE8) showed that YjeH 339

was arranged in 12 TMSs in which many residues are highly conserved, such as 340

Gly23, Gly25, Gly199 and Glu201, the corresponding residues of which in AdiC are 341

responsible for binding substrate (12); Phe92, Trp195, Tyr286 and Tyr355, the 342

corresponding residues of which in AdiC function as gates (12); and Glu201, the 343

corresponding residue of which in AdiC controls the allosteric switch of TM6 (Fig. 6). 344

Two homology models of YjeH based on the arginine::agmatine antiporter AdiC 345

(3NCY.1.A and 3L1L.1.A) were constructed to obtain structural information 346

concerning substrate binding. The structure of the YjeH protein exhibited a structural 347

core of 10 TMSs that were arranged into “5+5” inverse repeats and two extra helices 348

(TM11 and TM12) in the C-terminal domain, which is a basic topology of APC 349

superfamily. TM1 and TM6, adjacent to each other in an anti-parallel manner, 350

together with TM3, TM8 and TM10 surrounded a central cavity for substrate binding 351

(Fig. 6A). Two variable loops in the interior of the TM1 and TM6 helices were the 352


.asm.org/

Dow

nloaded from

http://aem.asm.org/

recognition sites for substrates. A comparison of two YjeH models with and without 353

substrates revealed that the two short helices of TM1 and TM6 were translocated due 354

to the flexibility of two unwound loops in response to substrate binding, which 355

enabled conformational changes in YjeH during the transport process, such as the 356

allosteric regulation of AdiC (Fig. 6B). 357

Methionine, leucine, isoleucine and valine were docked to the model of YjeH using 358

AutoDock calculations with the Lamarckian Genetic Algorithm to investigate 359

substrate recognition sites. The binding free energies (∆Gb) determined by docking 360

were -7.019 Kcal/mol for methionine, -7.238 Kcal/mol for leucine, -5.309 Kcal/mol 361

for isoleucine and -5.181 Kcal/mol for valine, which indicated that YjeH shows 362

higher affinity for methionine and leucine than isoleucine and valine. For the docking 363

details, the α-amino group of the four substrates forms three hydrogen bonds with the 364

carboxyl group of Leu21 in TM1 and Trp195 and Val198 in TM6. The α-carboxyl 365

group of the four substrates accepts two hydrogen bonds from the amide nitrogens of 366

Thr24 and Gly25 (Fig. 7), which is highly conserved, as shown in the sequence 367

alignments (Fig. S3). To identify the roles of substrate binding sites, several models of 368

YjeH mutation docking calculations were performed to investigate the effect of the 369

mutation on the binding modes between four substrates and YjeH. As mutations were 370

presented at Thr24, Gly25 and Trp195, weaker interactions were observed due to the 371

reduced strength of hydrogen bonds between these amino acids and YjeH. To validate 372

the predictions, Thr24Tyr, Gly25Phe and Trp195Ala were introduced into the YjeH 373

protein, and the impacts on efflux capacity were evaluated by amino acid assay of 374


.asm.org/

Dow

nloaded from

http://aem.asm.org/

strains H19, H20 and H21. The results showed that the each of the mutants’ 375

methionine efflux activity decreased by 65~78%, suggesting that Thr24, Gly25 and 376

Trp195 play important roles in substrate binding (Fig. 7E). 377

Overexpression of yjeH improves production in an L-methionine-producing 378

strain. Modification of transport systems usually improves extracellular amino acid 379

accumulation in the producing strains. To generate an L-methionine producer from E. 380

coli and to evaluate the impact of yjeH overexpression on L-methionine production, a 381

methionine-producing strain (H10) was constructed by deleting the metJ gene 382

encoding the transcriptional repressor of the methionine biosynthesis genes and 383

removing the feedback inhibition of homoserine O-succinyltransferase (encoded by 384

metA) (45) in the E. coli W3110 strain. Plasmid pWYE2134 containing the yjeH gene 385

was transformed into strain H10 to construct strain H12. At 48 h of fermentation, the 386

methionine production was increased from 1.0 g/L (strain H11) to 1.7 g/L (strain H12) 387

with similar growth (Fig. 8). These results indicate that the enhancement of 388

methionine export by YjeH promotes methionine production in the producing strain. 389

DISCUSSION 390

The characterization of new exporters of amino acids and other important metabolites 391

is currently a hot field of research. However, to date, no methionine exporter in E. coli 392

has been identified. Here, we identified YjeH as the L-methionine and branched chain 393

amino acids exporter in E. coli based on the following evidence: (i) the fusion protein 394

YjeH-GFP was visualized by TIRFM to confirm the plasma membrane localization of 395

YjeH, which also provides a cytological basis for proving its function as a transporter; 396


.asm.org/

Dow

nloaded from

http://aem.asm.org/

(ii) the deletion of yjeH increased the susceptibility of the cells to DL-ethionine, 397

DL-norleucine, DL-norvaline and yjeH overexpression improved the cells’ resistance to 398

the analogues; (iii) YjeH overexpression resulted in the lowest intracellular level and 399

the highest export rate of methionine and branched chain amino acids, and the yjeH 400

deletion strain resulted in intracellular accumulation and a reduced export rate of 401

methionine in the presence of extracellular dipeptide; (iv) the transcription of the yjeH 402

gene was significantly induced by the increased intracellular level of substrates. 403

Furthermore, overexpression of yjeH in a methionine-producing strain enhanced 404

methionine production, which proved the function from the view of application. In 405

order to evaluate the effect of the deletion or overexpression of yjeH on the relative 406

abundance of other membrane proteins, the expression levels of 8 genes encoding 407

different kinds of membrane proteins were tested by qRT-PCR. Results showed that 408

deletion or overexpression of yjeH has no effect on the expression levels of genes, 409

such as the amino acid exporter genes ygaW, yddG, the other APC transporter genes 410

adiC, cadB, potE, and the methionine uptake transporter gene metN (data not shown). 411

Methionine uptake transport and its regulation have been extensively studied in 412

both E. coli and C. glutamicum (51, 52). However, reports about methionine export 413

are rare. Our resulted proved that YjeH functions as an L-methionine exporter. In 414

addition, we found that the yjeH deletion strain can also efflux methionine confirming 415

that other efflux systems are responsible for the L-methionine export process in the 416

yjeH deletion strain. This finding is analogous to evidence for at least one further 417

methionine excretion system in C. glutamicum besides BrnFE (18, 19). It is a general 418


.asm.org/

Dow

nloaded from

http://aem.asm.org/

phenomenon that multiple transport systems share responsibility for the same 419

substrate. For instance, in C. glutamicum, both PheP and AroP are responsible for 420

L-phenylalanine uptake (6, 53). In E. coli, YdeD, YfiK, CydDC and Bcr are involved 421

in L-cysteine efflux (54-57). In C. glutamicum, BrnFE was shown to efficiently export 422

L-methionine (18). The E. coli genes homologous to brnFE were suggested to be the 423

ygaZH genes. While our preliminary results proved that the overexpression of YgaZH 424

can also increase the extracellular accumulation of L-methionine (Fig. S5). This result 425

indicates that YgaZH might be involved in methionine export. Of course, we cannot 426

also rule out the possibility of the existence of other methionine exporters besides 427

YjeH and YgaZH. On the other hand, amino acid transporters such as AroP (6), 428

BrnFE (18, 19) and ApcT (14) have broad substrate specificities. We found that YjeH 429

as the L-methionine efflux transporter can also export L-leucine, L-isoleucine and 430

L-valine at different rates. Among the BCAAs, L-leucine is the most competitive 431

substrate of L-methionine in the efflux process mediated by YjeH. The mechanism of 432

broad substrate specificities is possibly due to substrates with similar structures or 433

properties, which can bind the transporters in similar ways. 434

The exporters of amino acids and other metabolites play pivotal roles in bacterial 435

physiology, including the maintenance of a balanced intracellular pool and the 436

prevention of intracellular amino acid concentrations at toxic levels under certain 437

conditions, such as peptide-rich conditions (17). Generally, the expression of amino 438

acid exporters is strictly regulated by the intracellular concentration of amino acids 439

and/or transcription regulators. For instance, LysG is the positive regulator of lysine 440


.asm.org/

Dow

nloaded from

http://aem.asm.org/

exporter LysE expression in the presence of intracellular lysine or arginine (16). The 441

strict regulation of amino acid exporters effectively prevents the loss and unwanted 442

futile cycles of export and re-uptake of amino acids. We found in this study that yjeH 443

expression is induced by multiple intracellular amino acids, including L-methionine, 444

L-leucine and L-isoleucine rather than L-valine. It may result from the possibility that 445

threshold for inducing yjeH expression differs from four substrates. Furthermore, the 446

result showed that yjeH expression is not regulated by the methionine repressor MetJ. 447

In E. coli, the transcriptional repressor MetJ controls the expression of the Met 448

regulon, specifically binding to the consensus sequence AGACGTCT, which is called 449

the met box (50). The yjeH promoter was analyzed and contained no MetJ binding 450

site, suggesting that MetJ is not directly engaged in regulating yjeH expression. 451

Trotschel et al. reported that the RNA of brnF in C. glutamicum could only be 452

detected by a dot blot assay in the presence of dipeptides (18). However, in the wild 453

type E. coli W3110, our results showed that yjeH expression could be detected at a 454

low level in the absence of substrates, and the expression of yjeH was upregulated to a 455

higher level by substrates. There is a constitutive promoter recognized by RNA 456

polymerase RpoD upstream of yjeH using sequence analysis by Shimada et al. (58). 457

Taken together, these results indicate that there must be at least two promoters 458

responsible for the transcription of yjeH. The BrnFE transport system responsible for 459

L-methionine efflux in C. glutamicum belongs to the LIV-E family, according to 460

phylogenetic analysis (19). Together with other amino acid exporters mentioned 461

above, they contain fewer than 300 amino acid residues. However, YjeH contains 418 462


.asm.org/

Dow

nloaded from

http://aem.asm.org/

amino acids and has the typical 5+5 TMSs inverted repeat fold of APC superfamily 463

transporters, suggesting that YjeH has a different transport mechanism compared to 464

the amino acid exporters reported previously. While the topological analysis of YjeH 465

using UniProt (http://www.uniprot.org/uniprot/P39277) showed that the N-terminus 466

of YjeH is located in the periplasm, indicating that YjeH embeds in the membrane in 467

the reverse direction compared to AdiC. Together with the function identification and 468

the cladogram, YjeH was temporarily classified into the AAE family, while YjeH may 469

also be a solute/solute antiporter, with the substrate coming into the cell remaining 470

unidentified. APC transporter belongs to the secondary transporters, which means the 471

transport process does not need ATP as the energy source. In this study, ATPase 472

deletion neither effected the dipeptide uptake nor the methionine export, Surprisingly, 473

the extracellular methionine concentrations of strain H8 were a little higher than that 474

of strain H5. Considering the dynamic of amino acids transport which includes the 475

uptake and export, the uptake of exported extracellular methionine which is mediated 476

by ATP-dependent MetNIQ might be inhibited due to the ATPase deletion, resulting in 477

the increase of extracellular methionine of strain H8. Furthermore, structural 478

information of AdiC showed that the two substrates share the same binding pocket 479

during the transport process by the exchanger (13). Among the four substrates, the 480

binding free energy of methionine and leucine is much lower than that of isoleucine 481

and valine, and the efflux activity of methionine and leucine is much higher than that 482

of valine and isoleucine. As shown in Fig. S4, the surface of binding sites located in 483

TM1 and TM6 exhibits the relatively lower strength hydrophobic force, while the 484


.asm.org/

Dow

nloaded from

http://aem.asm.org/

surface of methionine has the most similar hydrophobic surface to the binding sites of 485

YjeH. Taken together, L-methionine is hypothesized to be the native substrate of 486

YjeH. 487

488

ACKNOWLEDGMENTS 489

This work was supported by grants from Science and Technology Service Network 490

Initiative (KFJ-EW-STS-078) and the Chinese Academy of Sciences 491

(XBXA-2011-009). 492

We are grateful to Dr. Yu Fu and Yuanyuan Bei for the exellent technical 493

assistance on TIRFM. 494

495

FIGURE LEGENDS 496

FIG 1 Growth inhibition and amino acids export assays. Strains H2 and H3 were 497

incubated parallelly on the minimal medium (MM) plates containing 10 mM 498

DL-ethionine, 10 mM DL-norleucine and 10 mM DL-norvaline at 37 ºC for 24 h , the 499

MM plate was used as the control (A). Time course of intracellular (open symbols) 500

and extracellular (solid symbols) concentrations of amino acids were shown. Strains 501

H2 (circles, panels B-E), H4 (triangles, panels B-E) and H5 (squares, panels B-E) 502

were incubated in minimal medium containing 5 mM Met-Met (B), 5 mM Leu-Leu 503

(C), 5 mM Ile-Ile (D), or 5 mM Val-Val (E) dipeptide. The data are the mean values 504

from three replicates with standard deviations. 505

506


.asm.org/

Dow

nloaded from

http://aem.asm.org/

FIG 2 Broad export substrate specificity screen and dendrogram. The broad substrate 507

specificity with the amino acid export activity of YjeH was screened by amino acid 508

export assay using ten different dipeptides containing 20 kinds of amino acids. The 509

extracellular amino acid concentration in each group was measured and the amino 510

acid concentration ratios of strain H3 to H2 with each amino acid were presented (A). 511

Dendrogram of 14 APC transporters is shown in B. The 14 transporters were 512

classified into 4 different families, which are Cationic amino Acid Transporter (CATs), 513

Amino Acid Transporter (AATs), basic Amino acid/Polyamine Antiporter (APAs), and 514

the amino acid efflux transporter (AAEs). GenBank accession numbers of the 515

transporters to generate the Dendrogram are as follows: ApcT gi|1591319, PotE 516

gi|77416694, AdiC gi|38605621, LysP gi|34395946, GabP gi|120778, AroP 517

gi|32172425, PheP gi|130068, AsoB gi|984560, YjeH gi|12933203, SLC7A1 518

gi|4507047, SLC7A2 gi|85397783, SLC7A3 gi|57162668, SLC7A4 gi|47678691. 519

520

FIG 3 The mRNA and protein expression levels of yjeH. The relative fold changes in 521

the transcriptional levels of yjeH were analyzed by quantitative real-time RT-PCR 522

upon cultivation in minimal medium with or without methionine, leucine, isoleucine 523

or valine, as well as with or without the metJ deletion. The data shown are the mean 524

values from three biological replicates and three technical replicates with standard 525

deviations. The expression levels of YjeH were analyzed by Western blotting. Strain 526

H1 was used as a control (CK). 527

528


.asm.org/

Dow

nloaded from

http://aem.asm.org/

FIG 4 Effects of CCCP or ATPase deletion on methionine efflux in E. coli. Strains H3 529

(A) and H2 (B) were incubated in MM containing 5mM Met-Met dipeptide. After the 530

start of the experiment, CCCP was added at 1 min (open triangles) and 8 min (open 531

circles), the group with no CCCP adding (open squares) was used as the control. YjeH 532

overexpressed strain with the ATPase deletion (strain H8, open diamond) and the 533

wildtype strain with YjeH overexpressed (strain H5, open down triangle) were used to 534

repeat the assay (C). Extracellular methionine level was measured. The data shown 535

are the mean values from three replicates with standard deviations. 536

537

FIG 5 Localization of YjeH-GFP. YjeH-GFP fusion protein was constructed and 538

expressed in strain H15. Strain H16 containing the aromatic amino acids exporter 539

YddG-GFP was used as a positive control, and strain H14 containing an intracellular 540

expression GFP was used as a negative control. Strain H13 without GFP expression 541

was used to eliminate the possibility of spontaneous fluorescence in E. coli. Strain 542

H13 (A, B and C), H14 (D, E and F), H15 (G, H and I), or H16 (J,K and L) was 543

monitored under visible light (A, D, G and J) and 488 nm laser illumination in TIRF 544

mode. Scale bar, 1 μm. Cellular debris was monitored using 488 nm laser illumination 545

in TIRF mode (C, F and I). All of the images were generated under the same 546

intensities of excitation. 547

548

549

FIG 6 Homology structural model of YjeH and the allosteric effect of substrate 550


.asm.org/

Dow

nloaded from

http://aem.asm.org/

binding cavity. (A) Side view (left) and bottom view (middle) of the model with the 551

transmembrane helices in different colors. The central pocket surrounded by TM1, 552

TM3, TM6, TM8 and TM10 is displayed separately with a red circle (right). (B) 553

Structures composed of TM1 (blue), TM6 (green) and TM10 (orange-yellow) without 554

substrates of AdiC (left) and YjeH (right) were compared with the structures with 555

substrates (white). The allosteric angles were highlighted in red. 556

557

FIG 7 Prediction of binding modes between YjeH and substrates. The docking results 558

were shown between YjeH and Met (A), Leu (B), Ile (C), Val (D), and each binding 559

site was between the loop of TM1 and TM6. Relative proportion of efflux activity 560

with Met of strains H19, H20 and H21were determined (E). 561

562

FIG 8 Effect of yjeH overexpression on L-methionine production. Strain H11 (open 563

symbols) or H12 (solid symbols) was grown in fermentation medium. The growth 564

(squares), residual sugar (RG, circles) and methionine titer (triangles) are indicated. 565

The data are the mean results from three replicate values with standard deviations. 566

567

References 568

1. Kay M RK. 2007. Amino acid transport systems in biotechnologically relevant 569

bacteria. Microbiol Monogr 5:289-325. 570

2. Burkovski A, Kramer R. 2002. Bacterial amino acid transport proteins: 571

occurrence, functions, and significance for biotechnological applications. Appl 572


.asm.org/

Dow

nloaded from

http://aem.asm.org/

Microbiol Biotechnol 58:265-274. 573

3. Johnson E, Nguyen PT, Yeates TO, Rees DC. 2012. Inward facing conformations 574

of the MetNI methionine ABC transporter: implications for the mechanism of 575

transinhibition. Protein Sci 21:84-96. 576

4. Jack DL, Paulsen IT, Saier MH. 2000. The amino acid/polyamine/organocation 577

(APC) superfamily of transporters specific for amino acids, polyamines and 578

organocations. Microbiology 146 (8): 1797-1814. 579

5. Ellis J, Carlin A, Steffes C, Wu JH, Liu JY, Rosen BP. 1995. Topological 580

analysis of the lysine specific permease of Escherichia coli. Microbiology UK 581

141:1927-1935. 582

6. Shang X, Zhang Y, Zhang G, Chai X, Deng A, Liang Y, Wen T. 2013. 583

Characterization and molecular mechanism of AroP as an aromatic amino acid and 584

histidine transporter in Corynebacterium glutamicum. J Bacteriol 195:5334-5342. 585

7. Singh SK, Piscitelli CL, Yamashita A, Gouaux E. 2008. A competitive inhibitor 586

traps LeuT in an open-to-out conformation. Science 322:1655-1661. 587

8. Yamashita A, Singh SK, Kawate T, Jin Y, Gouaux E. 2005. Crystal structure of a 588

bacterial homologue of Na+/Cl--dependent neurotransmitter transporters. Nature 589

437:215-223. 590

9. Ma D, Lu P, Yan C, Fan C, Yin P, Wang J, Shi Y. 2012. Structure and mechanism 591

of a glutamate-GABA antiporter. Nature 483:632-636. 592

10. Fang Y, Jayaram H, Shane T, Kolmakova-Partensky L, Wu F, Williams C, 593

Xiong Y, Miller C. 2009. Structure of a prokaryotic virtual proton pump at 3.2 A 594


.asm.org/

Dow

nloaded from

http://aem.asm.org/

resolution. Nature 460:1040-1043. 595

11. Kowalczyk L, Ratera M, Paladino A, Bartoccioni P, Errasti-Murugarren E, 596

Valencia E, Portella G, Bial S, Zorzano A, Fita I, Orozco M, Carpena X, 597

Vazquez-Ibar JL, Palacin M. 2011. Molecular basis of substrate-induced permeation 598

by an amino acid antiporter. Proc Natl Acad Sci U S A 108:3935-3940. 599

12. Gao X, Zhou L, Jiao X, Lu F, Yan C, Zeng X, Wang J, Shi Y. 2010. Mechanism 600

of substrate recognition and transport by an amino acid antiporter. Nature 601

463:828-832. 602

13. Gao X, Lu F, Zhou L, Dang S, Sun L, Li X, Wang J, Shi Y. 2009. Structure and 603

mechanism of an amino acid antiporter. Science 324:1565-1568. 604

14. Shaffer PL, Goehring A, Shankaranarayanan A, Gouaux E. 2009. Structure 605

and mechanism of a Na+-independent amino acid transporter. Science 325:1010-1014. 606

15. Tomitori H, Kashiwagi K, Igarashi K. 2012. Structure and function of 607

polyamine-amino acid antiporters CadB and PotE in Escherichia coli. Amino Acids 608

42:733-740. 609

16. Bellmann A, Vrljic M, Patek M, Sahm H, Kramer R, Eggeling L. 2001. 610

Expression control and specificity of the basic amino acid exporter LysE of 611

Corynebacterium glutamicum. Microbiology-Sgm 147:1765-1774. 612

17. Vrljic M, Sahm H, Eggeling L. 1996. A new type of transporter with a new type 613

of cellular function: L-lysine export from Corynebacterium glutamicum. Mol 614

Microbiol 22:815-826. 615

18. Trotschel C, Deutenberg D, Bathe B, Burkovski A, Kramer R. 2005. 616


.asm.org/

Dow

nloaded from

http://aem.asm.org/

Characterization of methionine export in Corynebacterium glutamicum. J Bacteriol 617

187:3786-3794. 618

19. Kennerknecht N, Sahm H, Yen MR, Patek M, Saier Jr MH, Jr., Eggeling L. 619

2002. Export of L-isoleucine from Corynebacterium glutamicum: a two-gene-encoded 620

member of a new translocator family. J Bacteriol 184:3947-3956. 621

20. Yen MR, Tseng YH, Simic P, Sahm H, Eggeling L, Saier MH, Jr. 2002. The 622

ubiquitous ThrE family of putative transmembrane amino acid efflux transporters. Res 623

Microbiol 153:19-25. 624

21. Nakamura J, Hirano S, Ito H, Wachi M. 2007. Mutations of the 625

Corynebacterium glutamicum NCgl1221 gene, encoding a mechanosensitive channel 626

homolog, induce L-glutamic acid production. Appl Environ Microbiol 73:4491-4498. 627

22. Livshits VA, Zakataeva NP, Aleshin VV, Vitushkina MV. 2003. Identification 628

and characterization of the new gene rhtA involved in threonine and homoserine 629

efflux in Escherichia coli. Res Microbiol 154:123-135. 630

23. Zakataeva NP, Aleshin VV, Tokmakova IL, Troshin PV, Livshits VA. 1999. 631

The novel transmembrane Escherichia coli proteins involved in the amino acid efflux. 632

FEBS Lett 452:228-232. 633

24. Park JH, Lee KH, Kim TY, Lee SY. 2007. Metabolic engineering of 634

Escherichia coli for the production of L-valine based on transcriptome analysis and in 635

silico gene knockout simulation. Proc Natl Acad Sci U S A 104:7797-7802. 636

25. Airich LG, Tsyrenzhapova IS, Vorontsova OV, Feofanov AV, Doroshenko VG, 637

Mashko SV. 2010. Membrane topology analysis of the Escherichia coli aromatic 638


.asm.org/

Dow

nloaded from

http://aem.asm.org/

amino acid efflux protein YddG. J Mol Microbiol Biotechnol 19:189-197. 639

26. Tsyrenzhapova IS, Doroshenko VG, Airikh LG, Mironov AS, Mashko SV. 640

2009. Gene yddG of Escherichia coli encoding the putative exporter of aromatic 641

amino acids: constitutive transcription and dependence of the expression level on the 642

cell growth rate. Genetika 45:601-609. 643

27. Doroshenko V, Airich L, Vitushkina M, Kolokolova A, Livshits V, Mashko S. 644

2007. YddG from Escherichia coli promotes export of aromatic amino acids. FEMS 645

Microbiol Lett 275:312-318. 646

28. Lee KH, Park JH, Kim TY, Kim HU, Lee SY. 2007. Systems metabolic 647

engineering of Escherichia coli for L-threonine production. Mol Syst Biol 3:149. 648

29. Friedel HA, Goa KL, Benfield P. 1989. S-Adenosyl- L-Methionine.A review of 649

its pharmacological properties and therapeutic potential in liver dysfunction and 650

affective-disorders in relation to its physiological role in cell metabolism. Drugs 651

38:389-416. 652

30. Willke T. 2014. Methionine production-a critical review. Appl Microbiol and 653

Biotechnol 98:9893-9914. 654

31. Zhang G, Wang W, Deng A, Sun Z, Zhang Y, Liang Y, Che Y, Wen T. 2012. A 655

mimicking-of-DNA-methylation-patterns pipeline for overcoming the restriction 656

barrier of bacteria. PLoS Genet 8:e1002987. 657

32. Bertani G. 2004. Lysogeny at mid-twentieth century: P1, P2, and other 658

experimental systems. J Bacteriol 186:595-600. 659

33. Hori H, Yoneyama H, Tobe R, Ando T, Isogai E, Katsumata R. 2011. 660


.asm.org/

Dow

nloaded from

http://aem.asm.org/

Inducible L-alanine exporter encoded by the novel gene ygaW (alaE) in Escherichia 661

coli. Appl Environ Microbiol 77:4027-4034. 662

34. Link AJ, Phillips D, Church GM. 1997. Methods for generating precise 663

deletions and insertions in the genome of wild-type Escherichia coli: application to 664

open reading frame characterization. J Bacteriol 179:6228-6237. 665

35. Alper H, Fischer C, Nevoigt E, Stephanopoulos G. 2006. Tuning genetic 666

control through promoter engineering. Proc Natl Acad Sci U S A 102:12678-12683. 667

36. Choi YJ, Morel L, Le Francois T, Bourque D, Bourget L, Groleau D, Massie 668

B, Miguez CB. 2010. Novel, versatile, and tightly regulated expression system for 669

Escherichia coli strains. Appl Environ Microbiol 76:5058-5066. 670

37. Kashket ER. 1985. The protein motive force in bacteria: a critical assessment of 671

methods. Ann Rev Micro 39:219-242. 672

38. Anil K. Joshi SA, and Giovanna Ferro-Luzzi Ames. 1988. Energy coupling in 673

bacterial periplasmic transport systems. J Biol Chem. 264:2126-2133. 674

39. Joshi AK, Ahmed S, Ames GFL. 1989. Energy coupling in bacterial periplasmic 675

transport-systems-studies in intact Escherichia coli cells. J Biol Chem. 676

264:2126-2133. 677

40. Hermann T, Kramer R. 1996. Mechanism and regulation of isoleucine excretion 678

in Corynebacterium glutamicum. Appl Environ Microbiol 62:3238-3244. 679

41. Ayaaki I, Koh Y, Yoshifumi F. 1995. A new method for the accurate and rapid 680

determination of the concentrations of intracellular metabolites in cells during 681

fermentation. Biotechnol Techniques 9:409-412. 682


.asm.org/

Dow

nloaded from

http://aem.asm.org/

42. Andreasen PA, Schaumburg BP, Osterline K, Vinten J, Gammeltoft S, 683

Gliemann J. 1974. A rapid technique for separation of thymocytes from suspensions 684

by centrifugation through silicone oil. Anal Biochem 59:610-616. 685

43. Hagai R. 1972. The measurement of membrane potential and pH in cells, 686

organelles, and vesicles. Method Enzymol 64:547-569. 687

44. Liu S, Liang Y, Liu Q, Tao T, Lai S, Chen N, Wen T. 2013. Development of a 688

two-stage feeding strategy based on the kind and level of feeding nutrients for 689

improving fed-batch production of L-threonine by Escherichia coli. Appl Microbiol 690

Biotechnol 97:573-583. 691

45. Schmittgen TD, Livak KJ. 2008. Analyzing real-time PCR data by the 692

comparative C(T) method. Nat Protoc 3:1101-1108. 693

46. Biasini M, Bienert S, Waterhouse A, Arnold K, Studer G, Schmidt T, Kiefer 694

F, Cassarino TG, Bertoni M, Bordoli L, Schwede T. 2014. SWISS-MODEL: 695

modelling protein tertiary and quaternary structure using evolutionary information. 696

Nucleic Acids Res 42:W252-W258. 697

47. Benkert P, Biasini M, Schwede T. 2011. Toward the estimation of the absolute 698

quality of individual protein structure models. Bioinformatics 27:343-350. 699

48. Arnold K, Bordoli L, Kopp J, Schwede T. 2006. The SWISS-MODEL 700

workspace: a web-based environment for protein structure homology modelling. 701

Bioinformatics 22:195-201. 702

49. Rabinovi.M, Finklema.A, Reagan RL, Breitman TR. 1969. Amino acid 703

antagonist death in Escherichia coli. J Bacteriol 99:336-338. 704


.asm.org/

Dow

nloaded from

http://aem.asm.org/

50. Augustus AM, Reardon PN, Spicer LD. 2009. MetJ repressor interactions with 705

DNA probed by in-cell NMR. Proc Natl Acad Sci U S A 106:5065-5069. 706

51. Trotschel C, Follmann M, Nettekoven JA, Mohrbach T, Forrest LR, 707

Burkovski A, Marin K, Kramer R. 2008. Methionine uptake in Corynebacterium 708

glutamicum by MetQNI and by MetPS, a novel methionine and alanine importer of 709

the NSS neurotransmitter transporter family. Biochemistry 47:12698-12709. 710

52. Zhang ZG, Feige JN, Chang AB, Anderson IJ, Brodianski VM, Vitreschak 711

AG, Gelfand MS, Saier MH. 2003. A transporter of Escherichia coli specific for 712

L-methionine and D-methionine is the prototype for a new family within the ABC 713

superfamily. Arch Microbiol 180:88-100. 714

53. Zhao Z, Ding JY, Li T, Zhou NY, Liu SJ. 2011. The ncgl1108 (PheP (Cg)) gene 715

encodes a new L-Phe transporter in Corynebacterium glutamicum. Appl Microbiol 716

Biotechnol 90:2005-2013. 717

54. Yamada S, Awano N, Inubushi K, Maeda E, Nakamori S, Nishino K, 718

Yamaguchi A, Takagi H. 2006. Effect of drug transporter genes on cysteine export 719

and overproduction in Escherichia coli. Appl Environ Microbiol 72:4735-4742. 720

55. Franke I, Resch A, Dassler T, Maier T, Bock A. 2003. YfiK from Escherichia 721

coli promotes export of O-acetylserine and cysteine. J Bacteriol 185:1161-1166. 722

56. Pittman MS, Corker H, Wu GH, Binet MB, Moir AJG, Poole RK. 2002. 723

Cysteine is exported from the Escherichia coli cytoplasm by CydDC, an ATP-binding 724

cassette-type transporter required for cytochrome assembly. J Biol Chem 725

277:49841-49849. 726


.asm.org/

Dow

nloaded from

http://aem.asm.org/

57. Dassler T, Maier T, Winterhalter C, Bock A. 2000. Identification of a major 727

facilitator protein from Escherichia coli involved in efflux of metabolites of the 728

cysteine pathway. Mol Microbiol 36:1101-1112. 729

58. Shimada T, Yamazaki Y, Tanaka K, Ishihama A. 2014. The whole set of 730

constitutive promoters recognized by RNA polymerase RpoD holoenzyme of 731

Escherichia coli. PLoS One 9:e90447. 732


.asm.org/

Dow

nloaded from

http://aem.asm.org/

Table 1 Bacterial strains and plasmids used in this study.

Strain or plasmid Relevant characteristicsa Reference or source

Strains E. coli W3110 Wild type Laboratory

strain EC135 E. coli TOP10∆dcm::FRT recA+ ∆dam::FRT,

genotype of R-M systems: mcrA∆(mrr-hsdRMS-mcrBC) ∆dcm::FRT ∆dam::FRT

(1)

H1 W3110∆yjeH This study H2 W3110∆yjeH harboring the plasmid pACYC184,

CmR This study

H3 W3110∆yjeH harboring the plasmid pWYE2132, CmR

This study

H4 W3110 harboring the plasmid pACYC184, CmR This study H5 W3110 harboring the plasmid pWYE2132, CmR This study H6 W3110∆atpIBEFHAGDC This study H7 W3110∆atpIBEFHAGDC pACYC184, CmR This study H8 W3110∆atpIBEFHAGDC pWYE2132, CmR This study H9 W3110∆metJ This study H10 W3110∆metJ metAT887G;C893T;C79T This study H11 W3110∆metJ metAT887G;C893T;C79T harboring the

plasmid pACYC184, CmR This study

H12 W3110∆metJ metAT887G;C893T;C79T harboring the plasmid pWYE2135, CmR

This study

H13 W3110 harboring the plasmid pMD19-T, AmpR This study H14 W3110 harboring the plasmid, pAD43-25 AmpR This study H15 W3110 harboring the plasmid pWYE2133, CmR This study H16 W3110 harboring the plasmid pWYE2134, AmpR This study H17 W3110 harboring the plasmid pWYE2135, AmpR This study H18 W3110 harboring the plasmid pWYE2136, AmpR This study H19 W3110∆yjeH harboring the plasmid pWYE2137,

CmR This study


This study


This study

Plasmids pKOV repA101(ts) sacB CmR (2) pACYC184 TetR, CmR New England

Biolabs pAD43-25 pAD123 derivative, gfpmut3a controlled by upp

promoter, AmpR BGSC

pMD19-T AmpR Takara


.asm.org/

Dow

nloaded from

http://aem.asm.org/

aAbbreviations: Amp, ampicillin; Cm, chloramphenicol; R, resistance.

pWYE184 pKOV carrying a 1.1 kb PCR fragment of the up- and downstream homologous fragments of the yjeH gene for yjeH deletion

This study

pWYE185 pKOV carrying a 1.0 kb PCR fragment of the up- and downstream homologous fragment of the metJ gene for metJ deletion

This study

pWYE186 pKOV carrying a 1.0 kb PCR fragment of the up- and downstream homologous fragment of the metA gene for metA deletion

This study

pWYE187 pKOV carrying a 2.1 kb PCR fragment of the mutated metA gene for metA three sites-directed mutation

This study

pWYE188 pKOV carrying a 2.1 kb PCR fragment of the mutated metA gene for metA three sites-directed mutation

This study

pWYE2132 pACYC184 carrying a 1.7 kb PCR fragment of the PBB-yjeH gene promoted by the PBB, CmR

This study

pWYE2133 pMD19T carrying a 2.4 kb PCR fragment of the PBB-yjeH-GFP fusion gene promoted by the PBB, AmpR

This study

pWYE2134 pMD19T carrying a 1.9 kb PCR fragment of the PBB-yddG-GFP fusion gene promoted by the PBB, AmpR

This study

pWYE2135 pACYC184 carrying a 1.8 kb PCR fragment of the PT5-Ocmt-yjeH under the cumate regulated gene expression system, CmR

This study

pWYE2136 pACYC184 carrying a 1.5kb PCR fragment of the PT5-Ocmt-ygaZH under the cumate regulated gene expression system , Cm R

This study

pWYE2137 pACYC184 carrying a 1.7 kb PCR fragment of the PBB-yjeHT24F gene promoted by the PBB, CmR

This study

pWYE2138 pACYC184 carrying a 1.7 kb PCR fragment of the PBB-yjeHT25W gene promoted by the PBB, CmR

This study

pWYE2139 pACYC184 carrying a 1.7 kb PCR fragment of the PBB-yjeHW195A gene promoted by the PBB, CmR

This study


.asm.org/

Dow

nloaded from

http://aem.asm.org/

Table 2 Primers used in this study Primer Sequence(5’--3’) Definition

P1 ATTTGCGGCCGCTATGTTCAGTGTCGTGCG (Not I)

P1-P4: Primers for yjeH deletion

P2 GCCGGATTATGTGGTTATGGTAGATTTTCGATGGTAGC

P3 GCTACCATCGAAAATCTACCATAACCACATAATCCGGC

P4 CGCGGATCCCTTGAAATTTTGCTAATGACC (Xba I)

P5 CTGCATCTGCCAGTACG P5&P6: primers for yjeH deletion identification

P6 CTGCATCGACCGAATAC

P7 ATTTGCGGCCGCGTAATTAGCCGCGCTTTTGCCTC

P7-P10:primers for atpIBEFHAGDC

deletion P8 CTTTTGTGCTTTTCAAGCCGGTGCAATAAGTA

GCCAAAAGGTGAATAAATG P9 CATTTATTCACCTTTTGGCTACTTATTGCACCG

GCTTGAAAAGCACAAAAG P10 TGGTCTAGACATTATTGTTGGTCAGCTTCGCC

AG P11 CTCTCTATCGTGCGTCCTGAAGCCC P10&P11: primers

for atpIBEFHAGDC

deletion identification

P12 GCTTCCTAATGCAGGCAATTCCGACGTCTAAGAG (Eco NI) P12&P13: Primers

for PBB P13 GGGTTGATGTCCGATTGCGGTCAGTGCGTCCTGCTGAT

P14 ATCAGCAGGACGCACTGACCGCAATCGGACATCAACCC P14&P15: Primers

for yjeH P15 ACGCGTCGACCGACTTCCTCGGTCTTCTA (Sal I)

P16 CTCATTGATCCAGAGCCTGAACCTGTGGTTATGCCATTTTC

P12&P16: Primers for PBB yjeH of

yjeH-gfp P16&P17: Primers for gfp of yjeH-gfp

P17 CCACAGGTTCAGGCTCTGGATCAATGAGTAAAGGAGAAGAACTTTTC

P18 GATTAATGTCGAAACGCCGGATTATTTGTATAGTTCATCC

P18&P15: Primers for terminator of

yjeH-gfp P19 CCCAAGCTTCAATTCCGACGTCTAAGAGAC P19&P20:Primers


.asm.org/

Dow

nloaded from

http://aem.asm.org/

(Hind III) for PBB of yddG-gfp P20 CGTGCTCCACAGGACGATGGTCAGTGCGTCC

TGCTG P21 CAGCAGGACGCACTGACCATCGTCCTGTGGA

GCACG P21&P22:Primers

for yddG of yddG-gfp P22 CTTCTCCTTTACTCATGCTACCGCTACCGCTAC

CGCTACCACCACGACGTGTCGCCAG P23 CTGGCGACACGTCGTGGTGGTAGCGGTAGCG

GTAGCGGTAGCATGAGTAAAGGAGAAG P23&P24:Primers

for gfp of yddG-gfp P24 GACCCGGCAGTTATTTTATTTGTATAGTTCATC P25 GATGAACTATACAAATAAAATAACTGCCGGGT

C P25&P26:Primers

for terminor of yddG-gfp P26 TGCTCTAGAGAATGGTGATTAAAAACAATGA

G (Xba I) P27 CGCAGGGGATCAAGATCTGATCAAGAGACAG

GATGAGGATCGTTTCGCAAGATGGTGATCATGAGTCC

P27&P30:Primers for cymR

P28 GCCCTGCAAAGTAAACTGGATGGCTTTCTTGCCGCCAAGGATCTGATGGCGCAGGGGATCAAGATCTG

P28&P31:Primers for cymR and part

of PKM P29 CCGATATCGCGACCGGAATTGCCAGCTGGGG

CGCCCTCTGGTAAGGTTGGGAAGCCCTGCAAAGTAAACTGGAT(Nru I)

P29&P30:Primers for cymR and PKM

P30 GGTGAACCTGAGGCTGGCACGAATAGTCTGAGA(Bsu36 I)

P31 TATCGGCCGAAATCATAAAAAATTTATTTGCTTTGTGAGCGG(Eag I)

P31&p32:Primers

for PT5Ocmt P32 CTTTTTAAGTGAACTTGGGCCCATAATACAAACAGACCAGATTG

P33 CAATCTGGTCTGTTTGTATTATGGGCCCAAGTTCACTTAAAAAG

P33&P34:Primers

for PT5Ocmt-BCD12of

yjeH

P34 CCAGTTCTTGTTTGAGTCCACTCATCATTAGAAACCCTCCGCAGCA

P35 TGTGGAGTAGGGCTTTCCATCATTAGAAACCCTCCGCAGCA

P35&P36:Primers for

PT5Ocmt-BCD12of ygaZH

P36&P37:Primers

for yjeH

P36 TGCTGCGGAGGGTTTCTAATGATGAGTGGACTCAAACAAGAACTGG

P37 GCTCTAGAGCATTTGCGCTTTTCTCGCA (Xba I)

P38 TGCTGCGGAGGGTTTCTAATGATGGAAAGCC P38&P39:Primers


.asm.org/

Dow

nloaded from

http://aem.asm.org/

CTACTCCACA for yjeH P39 GCTCTAGAGACCTCATTAATTTCAGCCGA

(Xba I)

P40 ATTTGCGGCCGCGCGGCGCAACCAGCAGATC (Not I)

P40-P43: Primers for metJ deletion P41 CACTCCGCGCCGCTCTTTTTTGCGAGATACTT

AATCCTCTTCGTC P42 GACGAAGAGGATTAAGTATCTCGCAAAAAAG

AGCGGCGCGGAGTG P43 TGCTCTAGAGGTTTACCGAGATAACGTTTTGC

CG (Xba I) P44 TATGCGGGTTTACGGTCAG P44&P45:

Identification primer for metJ

deletion

P45 CGTGCTCGTTGTTTATGC

P46 ATTTGCGGCCGCCAACCGCCTGCTCATTTTG (Not I)

P46-P48, P53:Primers for metA deletion P47 CGATCGACTATCACAGAAGAACCTGATTACCT

CACTACATAC P48 GTATGTAGTGAGGTAATCAGGTTCTTCTGTGA

TAGTCGATCG P48-P49: Primers for mutated metA

fragment-1 P49 GTGGACGAATTTCCTGACCAGACGCACAAGAAGTTGTCATCACAAAGACG

P50 CGTCTTTGTGATGACAACTTCTTGTGCGTCTGGTCAGGAAATTCGTCCAC P50&P51: Primers

for mutated metA fragment-2 P51 GGATTCATGTGCCGTAGATCGTATAGCGTGCT

CTGGTAGACGTAATAGTTG P52 CAACTATTACGTCTACCAGAGCACGCTATACG

ATCTACGGCACATGAATCC P52&P53: Primers for mutated metA fragment-3 P53 TGCTCTAGATATCTCTACGCGGCGGTCTT (Xba

I) P54 GCATCATCAGGAGTACGG Identification

primer for metA deletion or mutation

P55 GCAGGAACGGCAAACACGCCAAAGCCTAATAATGACGTCG

P12, P15, P55, P56: Primers for T24F

P56 CGACGTCATTATTAGGCTTTGGCGTGTTTGCCGTTCCTGC

P57 GCAGGAACGGCAAACACCCAAGTGCCTAATAATGACGTCG

P12, P15, P57, P58: Primers for T25W

P58 CGACGTCATTATTAGGCACTTGGGTGTTTGCCGTTCCTGC

P59 TCCAGACCGACAAAACAGGCGAACATCACTGATAACGCAGCAAATAACC

P12, P15, P59, P60: Primers for W195A


.asm.org/

Dow

nloaded from

http://aem.asm.org/

P60 GGTTATTTGCTGCGTTATCAGTGATGTTCGCCTGTTTTGTCGGTCTGGA

P61 CAAGAACTGGGGCTGGC P61&P62: Primers for yjeH for

RT-PCR P62 ATTAGCACTGGAACTGGC3’

P63 GGCAAACTGACTGGTATGGC P63&64: Primers for gapA for

RT-PCR P64 GTTTCGTTGTCGTACCAGG

P65 AAAGCCCTACTCCACAGCC P65&P66: Primers for ygaZ for RT-PCR

P66 CGGTAATGACGAACTGGCTC P67 GCTGGAGTGGCGACATTA P67&P68: Primers

for yeaS for RT-PCR

P68 GCTTTCGGATTAGTCAGG P69 CATTTATGGATGGTTGGTGACG P69&P70: Primers

for adiC for RT-PCR

P70 CAGCCAGTAGAGGACGTTGGQ P71 GTATCTTATCTTTCCACCTTCTTC P71&P72: Primers

for cadB for RT-PCR

P72 CATCAAACCAATGCCAGCCAAC P73 GAAACAACGTGTGGCAATTG P73&P74: Primers

for metN for RT-PCR

P74 CAGAATCGTCAACCCCAGAC P75 GATCATCGCTTTCCTGATTATG P75&P76: Primers

for pheP for RT-PCR

P76 GTCAGCTCTG CCATTCCCAC C P77 GTAACTTTATGGCGAACTATAC P77&P78: Primers

for potE for RT-PCR

P78 GTTAGCCACGGTACAAATCCAC P79 CATGTGTATTGAAGTTTTCCTC P79&P80: Primers

for ygaW for RT-PCR

P80 GACGGGCTAACTTTGCGTG P81 CGTCAGTTATCGGTATGTCA P81&P82: Primers

for fxsA for RT-PCRP82 AAGTAGAAGACCGAGGAAGT P83 TGCTGGCGGCATCGTTCT P83&P84: Primers


.asm.org/

Dow

nloaded from

http://aem.asm.org/

for groS for RT-PCR

P84 GATTTCACACCGTAGCCATC P85 CTGAAAGCGCTGTCCGTACCATG P85&P86: Primers

for groL for RT-PCR

P86 GAACTGCATACCTTCAACCACGTCC P87 TGGTCTGAACACGCCGAAAG P87&P88: Primers

for aspA for RT-PCR

P88 TCACAGCCAGGCGTTTCA PBB CAATTCCGACGTCTAAGAGACCATTATTATC

GTGACATTAACCTATAAGAACA GGCGTGTCACGAGGCCCTTTCGTCTTCACCTCGAGTCCCTATCAGTGACAGA GATTGACACCCCTATCAGTGATAGAGATACTGAGCACATCAGCAGGACGCACTGACC

(3)


.asm.org/

Dow

nloaded from

http://aem.asm.org/

Table 3 Amino acid export rate according to the extracellular amino acid concentration

Strains Amino acid export rate (nmol/mg/min)

L-methionine L-leucine L-isoleucine L-valine

H2 105.6±1.41 100.8±2.43 131.9±3.67 74.1±2.04

H4 127.6±1.21 120.2±2.27 122.1±2.71 83.5±2.69

H5 173.0±1.38 175.2±1.87 160.7±2.16 108.4±1.69


.asm.org/

Dow

nloaded from

http://aem.asm.org/


.asm.org/

Dow

nloaded from

http://aem.asm.org/

AEM Accepted Manuscript Posted Online 28 August 2015 … › content › aem › early › 2015 ›...

Documents

Transcript of AEM Accepted Manuscript Posted Online 28 August 2015 … › content › aem › early › 2015 ›...