About Us - Amazon S3 › howdens-howden-prod › ...over 400,000 kitchens, 2.5 million doors and...

The Joinery Collection

About Us

Howdens Joinery is the UK’s largest manufacturer and supplier of fitted kitchens, appliances and joinery products.

We are a trusted, trade-only business that has been selling to trade professionals since 1995. Last year we supplied

over 400,000 kitchens, 2.5 million doors and 770,000 appliances to UK homes.

Our products are available from stock in over 650 depots throughout the UK, and in each depot, trained designers

are on hand to support you and your builder.

We do not endorse trade professionals directly, but to find a builder near you, talk to your local Howdens Joinery

depot or visit www.howdens.com/about-us/find-a-local-builder

Our product range

We have over 75 door styles to choose from including internal, sliding wardrobe, external, French and garage doors.

We also offer quality joinery products, from hardware and stair parts, to skirting and timber or laminate flooring - plus

the tools, fixings and accessories that you need to install them. There is an enormous choice of joinery products for

all kinds of renovation, refurbishment and new build projects.

To find out more about Howdens Joinery, contact your local builder or visit www.howdens.com

Pricing and Aftersales

To see our Pricing and Aftersales policy, please visit:

www.howdens.com/about-us/howdens-pricing-and-aftersales-policy

Copyright © 2018 Howden Joinery Ltd. All rights reserved.

|01

ContentsFlooring 144

Flooring accessories 165

Hardware 171

Door handles 172

Door furniture 195

Commercial door furniture 205

Door security 211

Fire rated hardware 222

Fixings 227

Tools & accessories 238

Kitchen overview 246

Door regulations 250

Standards & accreditations 252

Doors, hardware & flooring overview 254

Joinery door finishes matrix 266

Fire rated matrix 267

Handles & door furniture matrix 270

Matching Flooring accessories matrix 272

A truly local business 02

Howdens & the history of doors 03

Howdens door visualiser 04

The Burford joinery collection 07

Internal doors 08

Internal moulded panel doors 08

Internal softwood doors 31

Internal primed stile & rail doors 39

Internal hardwood doors 47

Internal flush doors 74

Sliding wardrobe doors 95

Internal storage solutions 100

External doors 102

External hardwood doors 102

External softwood doors 116

External flush doors 120

Garage doors 124

Joinery 130

External door frames 131

Door linings & casings 132

Joinery accessories 134

Stair parts 137

Mouldings 141

Contents

02|

Royal Marines Corporal Phil Eaglesham

Returning to Taunton after six months in Afghanistan with the Royal Marines,

Corporal Phil Eaglesham was diagnosed with Q fever, a rare bacterial infection.

Confined to a wheelchair, he struggled with many practicalities at home -

until three Marines charities teamed up with a construction firm to design

and build him a new home. Local Howdens staff were keen to contribute:

the depot donated a kitchen adapted for wheelchair access, giving Phil the

independence to prepare his own meals.

A truly local businessHowdens Joinery is a local business. We run local customer accounts, not national ones; employees

are engaged locally and our trade account holders rely on our products and services to ensure the

growth and prosperity of their own local businesses.

As a locally driven business, we encourage staff at each of our sites to support and engage with

community activities. They have been responsible for over 3,700 donations to local good causes,

amounting to £1.5m - supporting schools, village halls, care homes, hospices, sports clubs, youth

groups and other community activities. We are proud that our staff take such an active part in giving

something back to their local communities.

To learn more about the relationships that make Howdens Joinery a part of local life all around

Great Britain, visit www.howdens.com/about-us/a-truly-local-business

The team at Howdens’ Rochdale depot

On World Homeless Day, staff from Howdens’ Rochdale depot hosted a

sponsored sleep out. Joined by colleagues from the Manchester depot, they

raised money for local charity, Petrus, which provides residential and day

support services for homeless people. They also asked staff and customers to

donate food and other items - and encouraged local branches of businesses

to get involved: Go Outdoors provided sleeping bags, and Morrisons and Tesco

donated gift cards, to buy more food and toiletries.

A truly local business

|03

Howdens and the history of doors Over the centuries, the way doors are made has developed quite gradually and many classic designs

are still reflected in the Howdens range today.

The door’s role of insulating between a building and the outside world - or between rooms - has given

it great significance in the history of architecture. Front doors in particular have always been seen to

deserve high quality workmanship and attention to detail.

17th century

Doors of all types were usually made from vertical timber

planks held together by horizontal ledges. On higher quality

doors these were concealed by a second layer of planks.

18th century

Panelled doors were more popular, with designs

influenced by architecture of the time, often featuring

many different combinations of mouldings.

19th century

The 6 panel design became standard during the Georgian

period and mouldings became more elaborate. The 4

panel door was introduced and the distinctive Victorian

innovation was glazed panels, often with cut, stained or

acid-etched glass.

21st century

In 2011 Howdens was awarded the John Hedgecock

memorial award for the Burford collection of internal

doors, recognising the very best in design application or

ability in joinery manufacture.

Thanks to this long history, Howdens now offers a wealth

of door designs.

We are constantly developing new products to keep

pace with changing tastes and meet ever more

demanding building regulations. See pages 08 to 129

for our full range of doors.

20th century & beyond

By the 1930s, a modern functional look was becoming

fashionable – facing panelled doors with hardboard to

create a flush door. More recent developments have

focused on creating doors that combine the look of a

traditional panelled timber door with the affordability of

a flush door. The result is today's moulded door.

Howdens & the history of doors

04|

Create different looks with the Howdens door visualiser

Complete the look of your room with the perfect internal door

Make a bold statement with our choice of external doors

The door visualiser on the Howdens website is designed to help you choose your perfect door and

visualise how it will look in your home. Either upload a photo of your home or choose from our gallery

of images.

Make your door truly unique through your choice of paint, lacquer or stain. Colour and finish can

transform the look and feel of a door. Gloss, satin or matt; contemporary or traditional colours;

or natural shades. There are many options to make your door individual to you.

Darker tones of red, blue and green are an established

choice for exterior doors on older properties. Traditional

interiors lend themselves to more muted beige

internal doors.

Doors painted or stained in natural shades work

beautifully as part of a co-ordinated design scheme.

This may be in a rustic cottage, modern family house

or chic loft apartment.

Traditional Natural

Bold and fresh colours characterise contemporary

design. A room may be mainly white, with an ‘accent’

wall or door in a rich, striking shade to create contrast.

There has been a great revival of this colour palette in

recent years. Some shades may appear to be strong

but when used in the right combination, can add

authenticity to a home.

Contemporary Heritage

You can find the door visualiser at www.howdens.com/advice-inspiration/door-visualiser

Or contact your local depot for more information.

Howdens door visualiser

06|

How to get the best out of your doorOur range of joinery products have been carefully selected, offering a comprehensive choice of quality

products at unbeatable prices.

Although the information below has been written specifically for the handling, installation and

decorating of internal and external doors, the general principles of handling apply to all joinery

products and cabinetry.

Our range of doors, joinery and flooring use real timber and veneers. Wood is a naturally grown

material, meaning it is subject to variance in colour and grain.

Storage and handlingOnce purchased, all doors should be handled and stored with care. Doors should never be stored in

an area which is subjected to extremes in temperature or direct sunlight. The building should be well

ventilated and not recently plastered. Care should be taken in a centrally heated or air-conditioned

building where moisture content could build up. When stacking doors, they should be kept flat, on

at least three load bearers in order to distribute weight and remain in their packaging to prevent

damage.

InstallationIt is essential that doors, both internal and external, are fully sealed and any air gaps plugged

immediately after delivery. Doors should be sealed and primed on both faces and all four leading

edges. Refer to pages 92, 93, 127, 128 and 129 for full finishing instructions.

Any surface that has been cut should be sealed prior to hanging (e.g. drilled, cut for letterboxes,

hinges, locks, etc.). This is particularly important when the end grain is exposed. If the door has been

preservative treated, any newly exposed wood must be re-treated.

When trimming a door to size it is important that equal amounts are removed from both edges.

Please refer to individual door fitting instructions for further information.

DecorationProducts should be clean and dry. The instructions of the paint or stain manufacturer must be

adhered to. Please refer to pages 243 and 244 for stains and varnishes.

Failure to carry out the recommended instructions for decoration and sealing can seriously affect the

performance of the door. With a little care and by using good quality decorative products, Howdens

doors will serve well for years to come.

Care and maintenanceRegular maintenance of Howdens doors should be made in accordance with the stain/paint

manufacturer's instructions, to prevent breakdown of the wood finish and to protect the timber from

deterioration. Dusting the door (without polish) and cleaning any dirty marks with a damp cloth

(not wet) will be enough to keep the door looking fresh in the interim period. Harsh chemicals or

abrasive substances should not be used to clean the door.

Some of our glazed doors have glass that is covered in a

protective film which can be removed after the finishing process.

How to get the best out of your door

|07

The Burford joinery collectionFollowing the popularity of our range of Burford kitchens, we offer a collection of doors, joinery and

hardware that is specifically designed to match your Burford kitchen.

The Burford collection of internal doors is exclusive to Howdens and includes 4 panel moulded and

4 panel oak doors. Glazed doors are available in 4 panel oak and moulded.

Howdens’ Burford doors were awarded the Technical Excellence and Innovation Award

(John Hedgecock Memorial Award) in 2011. This award recognises the very best in design,

application or ability in joinery manufacture. The award was set up in memory of John Hedgecock,

the former Technical Director at the BWF, and recognises innovative products or projects and rewards

excellence in our industry.

Designed to match your Burford door is an exclusive range of contemporary and traditional

Burford skirting and architrave, available in primed and oak veneered finishes.

You can complete the look with hardware that has been chosen to match your Burford

kitchen handles.

The Burford joinery collection

Burford 4 Panel Oak Burford 4 Panel Burford 4 Panel Oak glazed

Burford Traditional skirting

and architraveBurford Brushed Stainless Steel

square rose handle

Burford primed contemporary skirting

and architrave

Internal moulded doors

We offer a variety of panel

configurations, designed for

traditional or contemporary interiors,

with either smooth or textured

surfaces.

These doors are made from

hardwearing, one-piece moulded

facings, bonded to a timber frame

and painted with a white base coat.

Bi-fold versions are ideal for small

areas and wardrobes, and we also

offer mobility sizes.

Within the 6 Panel grained door

range we have every door size and

style available.

Internal moulded doors

Fire Regulations:

FD Fire doorsFH Essential fire door hardwareFH Non-essential fire door hardware

Building Regulations:

E Part E doors - sound reducingL Part L doors - warmth and insulation suitable for new buildL Part L doors - warmth and insulation suitable for refurbishment projectsM Part M doors - mobility and access

08|

Internal moulded panel doors

Pre-finished Dordogne smoothThe superior finish on this door saves on finishing time and is perfect

for both classic and modern homes.

• Constructed using softwood timber stile and rail frame

• Fully finished on all surfacesVictorian

Budget Satin Nickel LatchDFU0641

Featured

hardware

H1981mm x W457mm (6’6” x 1’6”)

F Standard DIM1610

H1981mm x W533mm (6’6” x 1’9”)

F Standard DIM1620

H1981mm x W610mm (6’6” x 2’0”)

F Standard DIM1630

H1981mm x W686mm (6’6” x 2’3”)

F Standard DIM1640

P FD E FD30 DFM1640

H1981mm x W711mm (6’6” x 2’4”)

F Standard DIM1650

H1981mm x W762mm (6’6” x 2’6”)

F Standard DIM1660

P FD E FD30 DFM1660

H2032mm x W813mm (6’8” x 2’8”)

F M Standard DIM1680

H1981mm x W838mm (6’6” x 2’9”)


P FD E FD30 DFM1670

H2040mm x W626mm

F Standard DIM1730

H2040mm x W726mm

F Standard DIM1740

H2040mm x W826mm


H2040mm x W926mm


|09

Pre-finished Dordogne smooth glazedThe glazing on this door allows as much light as possible into the

room whilst having a finish which is smoother than can be achieved

by hand.


• Face fully finished

• Supplied with toughened etched glass

Alento Rose Polished /

Satin ChromeDFU1035

Featured

hardware

H1981mm x W686mm (6’6” x 2’3”)

Glazed DGM2040

H1981mm x W762mm (6’6” x 2’6”)

Glazed DGM2060

H1981mm x W838mm (6’6” x 2’9”)

M Glazed DGM2070

Internal moulded panel doors10|

Pre-finished 6 Panel grainedThe popular six panel grained design will suit a variety of interiors.


• Face fully finishedPre-finished

Moulded Door Paint Solution

GAR0541

Associated

product

H1981mm x W457mm (6’6” x 1’6”)

Standard DIM1210

H1981mm x W533mm (6’6” x 1’9”)

Standard DIM1220

H1981mm x W610mm (6’6” x 2’0”)

F Standard DIM1230

H1981mm x W686mm (6’6” x 2’3”)

F Standard DIM1240

P FD E FD30 DIF8140

H1981mm x W711mm (6’6” x 2’4”)

Standard DIM1250

H1981mm x W762mm (6’6” x 2’6”)

F Standard DIM1260

P FD E FD30 DIF8160

H2032mm x W813mm (6’8” x 2’8”)

Standard DIM1280

H1981mm x W838mm (6’6” x 2’9”)


P FD E M FD30 DIF8170

H2040mm x W626mm

Standard DIM1530

H2040mm x W726mm

F Standard DIM1540

H2040mm x W826mm


H2040mm x W926mm

M Standard DIM1570

Internal moulded panel doors |11

Pre-finished 6 Panel grained glazedThe simple grained design of this door will suit many interiors.



• Supplied with toughened glass

H1981mm x W686mm (6’6” x 2’3”)

Glazed DGM1940

H1981mm x W762mm (6’6” x 2’6”)

Glazed DGM1960

H1981mm x W838mm (6’6” x 2’9”)

M Glazed DGM1970


Pre-finished Moulded

Door Paint Solution

GAR0541

Associated

product

12|

Burford 4 PanelAn elegantly simple four panel moulded door with clean lines

is shown with matching Burford Primed MDF traditional skirting,

architrave and hardware.


• Ready for painting

• Matches Burford kitchen ranges

H1981mm x W457mm (6’6” x 1’6”)

F Standard DIC9810

H1981mm x W533mm (6’6” x 1’9”)

F Standard DIC9820

H1981mm x W610mm (6’6” x 2’0”)

F Standard DIC9830

H1981mm x W686mm (6’6” x 2’3”)

F Standard DIC9840

P FD E FD30 DIF2640

H1981mm x W762mm (6’6” x 2’6”)

F Standard DIC9860

P FD E FD30 DIF2660

H1981mm x W838mm (6’6” x 2’9”)

F M Standard DIC9870


H2032mm x W813mm (6’8” x 2’8”)


H2040mm x W626mm

F Standard DIC8530

H2040mm x W726mm

F Standard DIC8540

H2040mm x W826mm


H2040mm x W926mm


Burford Rose Brushed Stainless

SteelDFU0760

Featured

hardware


Burford 4 Panel 2 light glazedA simple four panel design which complements a variety of interiors.

Shown with matching Burford Primed MDF contemporary skirting,

architrave and hardware.



• Supplied with toughened clear glass


H1981mm x W686mm (6’6” x 2’3”)

F Glazed DIC9140

H1981mm x W762mm (6’6” x 2’6”)

F Glazed DIC9160

H1981mm x W838mm (6’6” x 2’9”)

F M Glazed DIC9170


SteelDFU0760

Featured

hardware


4 Panel Shaker smoothWith its simple design this door suits both contemporary and

traditional interiors.



H1981mm x W457mm (6’6” x 1’6”)

F Standard DIM1010

H1981mm x W533mm (6’6” x 1’9”)

F Standard DIM1020

H1981mm x W610mm (6’6” x 2’0”)

F Standard DIM1030

H1981mm x W686mm (6’6” x 2’3”)

F Standard DIM1040

P FD FD30 DFM1040

H1981mm x W711mm (6’6” x 2’4”)

F Standard DIM1050

H1981mm x W762mm (6’6” x 2’6”)

F Standard DIM1060

P FD FD30 DFM1060

H2032mm x W813mm (6’8” x 2’8”)


H1981mm x W838mm (6’6” x 2’9”)


P FD M FD30 DFM1070

H2040mm x W626mm

F Standard DIM1130

P FD FD30 DFM1130

H2040mm x W726mm

F Standard DIM1140

P FD FD30 DFM1140

H2040mm x W826mm


P FD M FD30 DFM1160

H2040mm x W926mm


P FD M FD30 DFM1170

Garda Rose Chrome

DFU0820

Featured

hardware


4 Panel Shaker smooth glazedWith four glazed panels, this modern door allows plenty of light to

flood the room.


• Ready for painting Mitred Lecco Rose LatchLAL1340

Featured

hardware

H1981mm x W686mm (6’6” x 2’3”)

F Standard DGM1840

H1981mm x W762mm (6’6” x 2’6”)

F Standard DGM1860

H1981mm x W838mm (6’6” x 2’9”)

F M Standard DGM1870


Linear smoothThe smooth finish of this door lends itself to both modern and classic

interiors.



H1981mm x W610mm (6’6” x 2’0”)

F Standard DIM1430

H1981mm x W686mm (6’6” x 2’3”)

F Standard DIM1440

P FD E Standard DFM1440

H1981mm x W762mm (6’6” x 2’6”)

F Standard DIM1460

P FD E Standard DFM1460

H1981mm x W838mm (6’6” x 2’9”)


P FD E M Standard DFM1470

Newington Rose

Polished/Satin Chrome

DFU0836

Featured

hardware


Arched Top grainedThe elegant mouldings and grained finish can be used to create a

modern or classic look.



H1981mm x W457mm (6’6” x 1’6”)

F Standard DIC0728

H1981mm x W533mm (6’6” x 1’9”)

F Standard DIC0729

H1981mm x W610mm (6’6” x 2’0”)

F Standard DIC0730

H1981mm x W686mm (6’6” x 2’3”)

F Standard DIC0740

H1981mm x W762mm (6’6” x 2’6”)

F Standard DIC0760

H1981mm x W838mm (6’6” x 2’9”)


Sofia Rose Chrome

DFU0709

Featured

hardware


Arched Top grained 6 light glazedThe gentle arch and simple moulded panel adds interest to this door

whilst clear glazing allows plenty of light into the room.




H1981mm x W686mm (6’6” x 2’3”)

F Glazed DGM1540

H1981mm x W762mm (6’6” x 2’6”)

F Glazed DGM1560

H1981mm x W838mm (6’6” x 2’9”)

F M Glazed DGM1570

Garda Latch Brass

DFU0701

Featured

hardware


Dordogne smoothThe smooth finish of this door lends itself to both modern and classic

interiors.



H1981mm x W457mm (6’6” x 1’6”)

F Standard DIC8310

H1981mm x W533mm (6’6” x 1’9”)

F Standard DIC8320

H1981mm x W610mm (6’6” x 2’0”)

F Standard DIC8330

H1981mm x W686mm (6’6” x 2’3”)

F Standard DIC8340

P FD E FD30 DIF7340

H1981mm x W711mm (6’6” x 2’4”)

F Standard DIC8350

H1981mm x W762mm (6’6” x 2’6”)

F Standard DIC8360

P FD E FD30 DIF7360

H1981mm x W838mm (6’6” x 2’9”)



H2032mm x W813mm (6’8” x 2’8”)

F Standard DIC8380

H2040mm x W626mm

F Standard DIM1330

H2040mm x W726mm

F Standard DIM1340

H2040mm x W826mm


H2040mm x W926mm


Arva Rose Polished/

Satin ChromeDFU0650

Featured

hardware


Dordogne smooth glazedThe large and stylish panel used on this door allows for maximum

light to enter the room.




H1981mm x W686mm (6’6” x 2’3”)

F Glazed DGM1640

H1981mm x W762mm (6’6” x 2’6”)

F Glazed DGM1660

H1981mm x W838mm (6’6” x 2’9”)

F M Glazed DGM1670

Lugano Rose Satin NickelDFU0725

Featured

hardware


Dordogne smooth bi-foldThis space saving door is ideal for many interiors.



H1981mm x W762mm (6’6” x 2’6”)

F Bi-Fold DIP1060

Featured

hardware


Height includes bi-fold track

Brass Effect knob handle HKB1572

22|

4 Panel smoothThe understated style of this door makes it suitable for many kinds of

interiors and the elegant mouldings work well with most hardware.



H1981mm x W457mm (6’6” x 1’6”)

F Standard DIC7410

H1981mm x W533mm (6’6” x 1’9”)

F Standard DIC7420

H1981mm x W610mm (6’6” x 2’0”)

F Standard DIC7430

P FD E FD30 DIF2930

H1981mm x W686mm (6’6” x 2’3”)

F Standard DIC7440

P FD E FD30 DIF2940

H1981mm x W762mm (6’6” x 2’6”)

F Standard DIC7460

P FD E FD30 DIF2960

H1981mm x W838mm (6’6” x 2’9”)


P FD M E FD30 DIF2970

H2032mm x W813mm (6’8” x 2’8”)



Victorian Rose Chrome

DFU0072

Featured

hardware


6 Panel smoothThis six panel door with a smooth surface gives a great opportunity

for a traditional paint finish.



H1981mm x W457mm (6’6” x 1’6”)

F Standard DIC1010†

H1981mm x W533mm (6’6” x 1’9”)

F Standard DIC1020†

H1981mm x W610mm (6’6” x 2’0”)

F Standard DIC1030

H1981mm x W686mm (6’6” x 2’3”)

F Standard DIC1040

P FD E FD30 DIF1040

H1981mm x W762mm (6’6” x 2’6”)

F Standard DIC1060

P FD E FD30 DIF1060

H1981mm x W838mm (6’6” x 2’9”)



Victorian Rose Chrome

DFU0072

Featured

hardware

Internal moulded panel doors†Subject to availability

24|

4 Panel grainedThis door is ideal for both traditional and contemporary homes.



H1981mm x W457mm (6’6” x 1’6”)

F Standard DIC2010

H1981mm x W533mm (6’6” x 1’9”)

F Standard DIC2020

H1981mm x W610mm (6’6” x 2’0”)

F Standard DIC2030

P FD E FD30 DIF0631

H1981mm x W686mm (6’6” x 2’3”)

F Standard DIC2040

P FD E FD30 DIF0641

H1981mm x W711mm (6’6” x 2’4”)

F Standard DIC2050

H1981mm x W762mm (6’6” x 2’6”)

F Standard DIC2060

P FD E FD30 DIF0661

H1981mm x W838mm (6’6” x 2’9”)



H2032mm x W813mm (6’8” x 2’8”)



H2040mm x W626mm

F Standard DIC1831

P FD E FD30 DIF2330

H2040mm x W726mm

F Standard DIC1841

P FD E FD30 DIF2340

H2040mm x W826mm



H2040mm x W926mm



Chrissi Latch Chrome

DFU0039

Featured

hardware


4 Panel grained 2 light glazedThe simple decorative etched glazing of this door complements the

mouldings.



• Supplied with toughened frosted glass

H1981mm x W686mm (6’6” x 2’3”)

F Glazed DGM1440

H1981mm x W762mm (6’6” x 2’6”)

F Glazed DGM1460

H1981mm x W838mm (6’6” x 2’9”)

F M Glazed DGM1470


DFU0039

Featured

hardware


4 Panel grained bi-foldThe grained surface of this traditional bi-fold door adds subtle texture

to any paint finish.



• Supplied pre-hinged complete with running gear

• Two bi-fold can be hung next to each other

H1981mm x W686mm (6’6” x 2’3”)

F Bi-Fold DIP0240

H1981mm x W762mm (6’6” x 2’6”)

F Bi-Fold DIP0260



Featured

hardware

Oak Effect knob handleHKB1121

|27

6 Panel grainedOur most popular door is the six panel grained design. This door will suit

a wide variety of interiors and is available in an extensive range of sizes.



H1981mm x W381mm (6’6” x 1’3”)

F Standard (3 Panel) DIC0900

H1981mm x W457mm (6’6” x 1’6”)


H1981mm x W533mm (6’6” x 1’9”)


H1981mm x W610mm (6’6” x 2’0”)

F Standard DIC0930

P Developer door DIC3930

P FD E FD30 DIF0531

H1981mm x W686mm (6’6” x 2’3”)

F Standard DIC0940


P FD FD30 35mm DIF5440

P FD E FD30 DIF0541

H1981mm x W711mm (6’6” x 2’4”)

F Standard DIC0950

H1981mm x W762mm (6’6” x 2’6”)

F Standard DIC0960



P FD E FD30 DIF0561

H1981mm x W838mm (6’6” x 2’9”)


P M Developer door DIC3970

P FD M FD30 35mm DIF5470


H1981mm x W864mm (6’6” x 2’10”)


H2032mm x W813mm (6’8” x 2’8”)




H2040mm x W526mm

F Standard (3 panel) DIC1921

P FD E FD30 (3 panel) DIF0920†

H2040mm x W626mm

F Standard DIC1931

P FD E FD30 DIF0930

H2040mm x W726mm

F Standard DIC1941

P FD E FD30 DIF0940

H2040mm x W826mm



H2040mm x W926mm



Mortice knob Chrome

DFU0063

Featured

hardware

Internal moulded panel doors†Subject to availability

28|

6 Panel grained 6 light glazedThe elegant glazing will brighten any interior whilst the simple design

has a versatile finish to suit any property.




H1981mm x W610mm (6’6” x 2’0”)

F Glazed DGM1230

H1981mm x W686mm (6’6” x 2’3”)

F Glazed DGM1240

H1981mm x W762mm (6’6” x 2’6”)

F Glazed DGM1260

H1981mm x W838mm (6’6” x 2’9”)

F M Glazed DGM1270

H2032mm x W813mm (6’8” x 2’8”)

F M Glazed DGM1280

H2040mm x W626mm

F Glazed DGM1330

H2040mm x W726mm

F Glazed DGM1340

H2040mm x W826mm

F M Glazed DGM1360

H2040mm x W926mm

F M Glazed DGM1370

Mortice knob Brass

DFU0050

Featured

hardware


6 Panel grained bi-foldIdeal where space is limited, this folding door combines

a natural-looking grain finish with practicality.


• Primed and ready for painting

• Supplied pre-hinged complete with running gear

• Two bi-fold can be hung next to each other

H1981mm x W686mm (6’6” x 2’3”)

F Bi-Fold DIP0140

H1981mm x W762mm (6’6” x 2’6”)

F Bi-Fold DIP0160



Oak Effect knob handleHKB1121

Featured

hardware

30|

Internal softwood doors

This range features a wide choice of

glazed and panelled designs.

You can also specify mobility sizes

– and if space is an issue, there are

neat bi-fold options.

Glazed doors are supplied with all

glass toughened to BS EN 12600 or

BS EN 12150.

Our softwood doors are ready for

finishing with varnish, stain or paint.

Fire Regulations:




Internal softwood doors |31


8 Light Clear Pine glazed†Perfect for maximising light within your home, this door can be

finished to suit your property (shown as a door pair).

• Constructed using engineered pine stiles and rails

• Ready for finishing with varnish, stain, paint or Osmo Oil


• Smaller sizes ideal for use as a door pair

H1981mm x W610mm (6’6” x 2’0”)

F Glazed DIS3830

H1981mm x W686mm (6’6” x 2’3”)

F Glazed DIS3840

H1981mm x W762mm (6’6” x 2’6”)

F Glazed DIS3860

H1981mm x W868mm (6’6” x 2’9”)

F M Glazed DIS3870

Mortice knob Brass

DFU0050

Featured

hardware

†Subject to availability32|

Pattern 10 Clear Pine glazed†This simple contemporary door keeps a home looking light and open.




H1981mm x W762mm (6’6” x 2’6”)

F Glazed DIS2860

H1981mm x W838mm (6’6” x 2’9”)

F M Glazed DIS2870

Satin Nickel Flush handle

GIR3031

Featured

hardware

Internal softwood doors†Subject to availability

|33

Downham Clear Pine glazed†The distinctive nine light pine door suits both traditional and

contemporary interiors and can be finished to match any decor.




H1981mm x W762mm (6’6” x 2’6”)

F Glazed DIS3960

H1981mm x W838mm (6’6” x 2’9”)

F M Glazed DIS3970

Victorian Latch

ChromeDFU0611

Featured

hardware


34|

†Subject to availability

6 Panel Clear pinePaint to suit any colour scheme or stain to keep the natural grain

visible for an authentic feel.



H1981mm x W610mm (6’6” x 2’0”)

F Standard DIS1330

H1981mm x W686mm (6’6” x 2’3”)

F Standard DIS1340

H1981mm x W762mm (6’6” x 2’6”)

F Standard DIS1360

H1981mm x W838mm (6’6” x 2’9”)

F M Standard DIS1370

H2040mm x W626mm

F Standard DIS1730†

H2040mm x W726mm

F Standard DIS1740†

H2040mm x W826mm

F M Standard DIS1780†

Chrissi Latch Satin NickelDFU0045

Featured

hardware


4 Panel Clear pineThis versatile pine door can benefit any style of room.



H1981mm x W610mm (6’6” x 2’0”)

F Standard DIS3430

H1981mm x W686mm (6’6” x 2’3”)

F Standard DIS3440

FD FD30 DFD2540

H1981mm x W762mm (6’6” x 2’6”)

F Standard DIS3460

FD FD30 DFD2560

H1981mm x W838mm (6’6” x 2’9”)


FD FD30 DFD2570

H2032mm x W813mm (6’8” x 2’8”)


H2040mm x W726mm

F Standard DIS3640

H2040mm x W826mm


Garda Latch Satin NickelDFU0719

Featured

hardware

Internal softwood doors36|

4 Panel Clear pine 2 light glazedTwo glass panes allow plenty of light to enter the room to

complement both contemporary and traditional interiors.




H1981mm x W686mm (6’6” x 2’3”)

F Glazed DIS3240

H1981mm x W762mm (6’6” x 2’6”)

F Glazed DIS3260

H1981mm x W838mm (6’6” x 2’9”)

F M Glazed DIS3270

H2032mm x W813mm (6’8” x 2’8”)

F M Glazed DIS3280

H2040mm x W726mm

F Glazed DIS3241

H2040mm x W826mm

F M Glazed DIS3261

Sofia Rose Chrome

DFU0709

Featured

hardware


4 Panel Knotty Pine†Carefully constructed from high quality pine, this classic door will

complement many homes.

• Dowelled construction


• Quality knotty pine timbers with raised and fielded panels

H1981mm x W610mm (6’6” x 2’0”)

Standard DIS2630

H1981mm x W686mm (6’6” x 2’3”)

Standard DIS2640

H1981mm x W762mm (6’6” x 2’6”)

Standard DIS2660

H1981mm x W838mm (6’6” x 2’9”)

M Standard DIS2670

Antique Ornate Latch

BlackDFU0028

Featured

hardware


38|

Internal primed stile and rail doors

Offering standard and glazed designs,

these primed doors are constructed

using glue and dowel and slab

constructions with HDF skins.

Glazed doors are supplied with all

glass toughened to BS EN 12600 or

BS EN 12150.

Stile and rail doors are supplied

primed, ready for finishing with paint.

Internal primed stile & rail doors

Fire Regulations:




|39

Internal primed stile & rail doors

Primed DordogneThis Dordogne styled door can be used in conjunction with the glazed

version or on its own.

• Constructed using veneered particleboard stiles and rails


H1981mm x W610mm (6’6” x 2’0”)

Standard DIR1330

H1981mm x W686mm (6’6” x 2’3”)

Standard DIR1340

FD FD30 DFD1340

H1981mm x W762mm (6’6” x 2’6”)

Standard DIR1360

FD FD30 DFD1360

H1981mm x W838mm (6’6” x 2’9”)

M Standard DIR1370

FD M FD30 DFD1370

Durham Latch Pewter

DFU0740

Featured

hardware

40|

Primed Dordogne glazedThe etched glazing of this door adds interest whilst allowing plenty of

light into the room.

• Constructed using engineered stiles and rails



H1981mm x W686mm (6’6” x 2’3”)

Glazed DGT1340

H1981mm x W762mm (6’6” x 2’6”)

Glazed DGT1360

H1981mm x W838mm (6’6” x 2’9”)

M Glazed DGT1370


Featured

hardware

Internal primed stile & rail doors |41

Primed LinearThis contemporary style of door with its clean lines is perfect for any

home.

• Constructed using veneered particleboard slab

• Primed and ready for paintingGarda Latch

BrassDFU0701

Featured

hardware

H1981mm x W610mm (6’6” x 2’0”)

Standard DIR1530

H1981mm x W686mm (6’6” x 2’3”)

Standard DIR1540

FD FD30 DIF8640

H1981mm x W762mm (6’6” x 2’6”)

Standard DIR1560

FD FD30 DIF8660

H1981mm x W838mm (6’6” x 2’9”)

M Standard DIR1570

FD M FD30 DIF8670

Internal primed stile & rail doors42|

Primed 4 Panel ShakerA versatile four panel Shaker style door. Use in conjunction with its

glazed version or on its own.



H1981mm x W610mm (6’6” x 2’0”)

Standard DIR1230

H1981mm x W686mm (6’6” x 2’3”)

Standard DIR1240

FD FD30 DIF8340

H1981mm x W762mm (6’6” x 2’6”)

Standard DIR1260

FD FD30 DIF8360

H1981mm x W838mm (6’6” x 2’9”)

M Standard DIR1270

FD M FD30 DIF8370

Garda Bathroom Chrome

DFU0737

Featured

hardware


Primed 4 Panel Shaker glazedFour clear glass panes add interest and light to modern interiors.




H1981mm x W686mm (6’6” x 2’3”)

Glazed DGT1240

H1981mm x W762mm (6’6” x 2’6”)

Glazed DGT1260

H1981mm x W838mm (6’6” x 2’9”)

M Glazed DGT1270

Turin Rose Satin

Stainless Steel

DFU0727

Featured

hardware


Primed WorcesterThis simple, elegant door can be painted to suit any colour scheme.

• Constructed using particleboard stiles and rails

• MDF centre panels


H1981mm x W610mm (6’6” x 2’0”)

Standard DIR1130

H1981mm x W686mm (6’6” x 2’3”)

Standard DIR1140

H1981mm x W762mm (6’6” x 2’6”)

Standard DIR1160

H1981mm x W838mm (6’6” x 2’9”)

M Standard DIR1170


DFU0039

Featured

hardware


Primed Worcester glazedThe minimalist look of the glazed door can enhance many interiors

and allows light to flow from room to room.




H1981mm x W686mm (6’6” x 2’3”)

Glazed DGT1140

H1981mm x W762mm (6’6” x 2’6”)

Glazed DGT1160

H1981mm x W838mm (6’6” x 2’9”)

M Glazed DGT1170

Garda Latch Chrome

DFU0705

Featured

hardware


Internal hardwood doors


Howdens oak and hardwood doors

have an engineered construction and

several fire door versions are available

in different designs.

We offer a varied choice of glazed and

panelled designs, as well as mobility

sizes and bi-fold doors which are ideal

for small spaces and wardrobes.

Within the Dordogne Oak door range

we have every door size and style

available.

Fire Regulations:




|47


Solid Rustic Oak ledgedThe Solid Rustic Oak Ledged door adds character to your home by

providing an authentic look and feel.

• Tongue and groove joints with glued and nailed ledges

• Ready for finishing with varnish, stain or Osmo Oil

H1981mm x W610mm (6’6” x 2’0”)

Standard DIE3430

H1981mm x W686mm (6’6” x 2’3”)

Standard DIE3440

H1981mm x W762mm (6’6” x 2’6”)

Standard DIE3460

H1981mm x W838mm (6’6” x 2’9”)

M Standard DIE3470

Suffolk Latch Antique Black

LAL0115

Featured

hardware

48|

Pre-finished Linear OakThe contemporary style of this Linear door will fit perfectly into any

modern home.

• All surfaces fully finished

H1981mm x W610mm (6’6” x 2’0”)

Standard DIE7130

H1981mm x W686mm (6’6” x 2’3”)

Standard DIE7140

FD FD30 DIF9540

H1981mm x W792mm (6’6” x 2’6”)

Standard DIE7160

FD FD30 DIF9560

H1981mm x W838mm (6’6” x 2’9”)

M Standard DIE7170

FD M FD30 DIF9570

Lugano Latch Chrome

DFU0905

Featured

hardware

Internal hardwood doors |49

4 Panel OakThe solid oak bolection mouldings and sturdy construction reflect this

door’s superior quality.



H1981mm x W610mm (6’6” x 2’0”)

Standard DIE4030

H1981mm x W686mm (6’6” x 2’3”)

Standard DIE4040

FD FD30 DFD4040

H1981mm x W762mm (6’6” x 2’6”)

Standard DIE4060

FD FD30 DFD4060

H1981mm x W838mm (6’6” x 2’9”)

M Standard DIE4070

FD M FD30 DFD4070

H2032mm x W813mm (6’8” x 2’8”)

M Standard DIE4080†

H2040mm x W626mm

Standard DIE4460

H2040mm x W726mm

Standard DIE4470

FD FD30 DFD4470

H2040mm x W826mm

M Standard DIE4480

FD M FD30 DFD4480

H2040mm x W926mm

M Standard DIE4490

FD M FD30 DFD4490

Garda Latch Brass

DFU0701

Featured

hardware

†Subject to availabilityInternal hardwood doors50|

4 Panel Oak 2 light glazedA simple four panel design with solid oak bolection mouldings.



• Supplied with toughened, clear bevelled glass

H1981mm x W686mm (6’6” x 2’3”)

Glazed DIE4140

H1981mm x W762mm (6’6” x 2’6”)

Glazed DIE4160

H1981mm x W838mm (6’6” x 2’9”)

M Glazed DIE4170

H2040mm x W726mm

Glazed DIE4570

H2040mm x W826mm

M Glazed DIE4580

Lugano Latch Chrome

DFU0905

Featured

hardware


Linear OakThe contemporary style of this linear door will fit perfectly into any

modern home.

• Constructed using veneered particleboard slab

• Ready for finishing with varnish, stain or Osmo OilBurford Rose

Brushed Stainless

SteelDFU0760

Featured

hardware

H1981mm x W610mm (6’6” x 2’0”)

Standard DIE2230

H1981mm x W686mm (6’6” x 2’3”)

Standard DIE2240

FD FD30 DFD3940

H1981mm x W762mm (6’6” x 2’6”)

Standard DIE2260

FD FD30 DFD3960

H1981mm x W838mm (6’6” x 2’9”)

M Standard DIE2270

FD M FD30 DFD3970

Internal hardwood doors52|

Linear Oak glazedThe distinctive diamond cut grooves in this glazed version of the

Linear Oak door adds interest while allowing plenty of light into the

room.



• Supplied with clear toughened diamond cut glass

H1981mm x W762mm (6’6” x 2’6”)

Glazed DIE2860

H1981mm x W838mm (6’6” x 2’9”)

M Glazed DIE2870

Garda Latch Satin NickelDFU0719

Featured

hardware


Worcester OakThis oak engineered door has a stylish design and classic panels that

sit comfortably in both traditional and modern homes.




H1981mm x W610mm (6’6” x 2’0”)

Standard DIC6430

H1981mm x W686mm (6’6” x 2’3”)

Standard DIC6440

FD FD30 DFD6540

H1981mm x W762mm (6’6” x 2’6”)

Standard DIC6460

FD FD30 DFD6560

H1981mm x W838mm (6’6” x 2’9”)

M Standard DIC6470

FD M FD30 DFD6570

Lago Rose Polished Stainless

SteelDFU0729

Featured

hardware


Worcester Oak glazedThe distinctive glazed panels of this door are suited to allow optimum

levels of light to pass from room to room.




H1981mm x W686mm (6’6” x 2’3”)

Glazed DIC6540

H1981mm x W762mm (6’6” x 2’6”)

Glazed DIC6560

H1981mm x W838mm (6’6” x 2’9”)

M Glazed DIC6570

Riva Rose Satin NickelDFU0470

Featured

hardware


4 Panel Oak ShakerThe simple look of this Shaker oak door, with its flat panels and clean

lines, suits both modern and classic interiors.



H1981mm x W610mm (6’6” x 2’0”)

Standard DIE5130

H1981mm x W686mm (6’6” x 2’3”)

Standard DIE5140

FD FD30 DIF7440

H1981mm x W762mm (6’6” x 2’6”)

Standard DIE5160

FD FD30 DIF7460

H1981mm x W838mm (6’6” x 2’9”)

M Standard DIE5170

FD M FD30 DIF7470


Featured

hardware


4 Panel Oak Shaker glazedThis contemporary engineered oak door with four glazed panels

allows plenty of light to enter a room. The glass design has a clear

border within each frosted pane.




H1981mm x W762mm (6’6” x 2’6”)

Glazed DIE5360

H1981mm x W838mm (6’6” x 2’9”)

M Glazed DIE5370

Garda Rose Brass

DFU0819

Featured

hardware


Dordogne OakWith its bold design, the Dordogne Oak adds a sense of heritage

to traditional interiors.



H1981mm x W381mm (6’6” x 1’3”)

Standard DIE4600

H1981mm x W457mm (6’6” x 1’6”)

Standard DIE4610

H1981mm x W533mm (6’6” x 1’9”)

Standard DIE4620

H1981mm x W610mm (6’6” x 2’0”)

Standard DIE6630

FD FD30 DFD4130

H1981mm x W686mm (6’6” x 2’3”)

Standard DIE6640

FD FD30 35mm DFD2440

FD FD30 DFD5840

H1981mm x W711mm (6’6” x 2’4”)

Standard DIE4650

H1981mm x W762mm (6’6” x 2’6”)

Standard DIE6660

FD FD30 35mm DFD2460

FD FD30 DFD5860

H1981mm x W838mm (6’6” x 2’9”)

M Standard DIE6670

FD M FD30 35mm DFD2470

FD M FD30 DFD5870

H1981mm x W864mm (6’6” x 2’10”)

M Standard DIE4690

H2032mm x W813mm (6’8” x 2’8”)

M Standard DIE4680

FD M FD30 35mm DFD2480

FD M FD30 DFD4180

H2040mm x W626mm

Standard DIE6631

FD FD30 DFD4930

H2040mm x W726mm

Standard DIE6641

FD FD30 DFD4940

H2040mm x W826mm

M Standard DIE6661

FD M FD30 DFD4960

H2040mm x W926mm

M Standard DIE6671

FD M FD30 DFD4970

Garda Rose Chrome

DFU0820

Featured

hardware


Dordogne Oak glazedThis elegant glazed version of the Dordogne Oak allows more light

into your home.



H1981mm x W610mm (6’6” x 2’0”)

Glazed DIE5030

H1981mm x W686mm (6’6” x 2’3”)

Glazed DIE5440

H1981mm x W762mm (6’6” x 2’6”)

Glazed DIE5460

H1981mm x W838mm (6’6” x 2’9”)

M Glazed DIE5470

H2032mm x W813mm (6’8” x 2’8”)

M Glazed DIE5080

H2040mm x W626mm

Glazed DIE5230

H2040mm x W726mm

Glazed DIE5240

H2040mm x W826mm

M Glazed DIE5260

H2040mm x W926mm

M Glazed DIE5270

Idro Latch Brass

DFU0601

Featured

hardware


Dordogne Oak bi-foldWith a bold design, this bi-fold door works well in traditional interiors

where space is limited.



• Supplied with premium bi-fold door track

• Two bi-folds can be hung next to each other

H1981mm x W686mm (6’6” x 2’3”)

Bi-Fold DIP0940

H1981mm x W762mm (6’6” x 2’6”)

Bi-Fold DIP0960


Featured

hardware



Burford 4 Panel OakThis classic oak door complements traditional and contemporary

interiors, and is fitted with matching Burford Contemporary oak

veneered skirting and architrave.




H1981mm x W610mm (6’6” x 2’0”)

Standard DIE7730

H1981mm x W686mm (6’6” x 2’3”)

Standard DIE7740

FD30 DIF5940

H1981mm x W762mm (6’6” x 2’6”)

Standard DIE7760

FD30 DIF5960

H1981mm x W838mm (6’6” x 2’9”)

M Standard DIE7770

M FD30 DIF5970


SteelDFU0760

Featured

hardware


Burford 4 Panel Oak glazedThe two glass panes of this classic door complement a variety of

interiors.





H1981mm x W686mm (6’6” x 2’3”)

Glazed DIE7840

H1981mm x W762mm (6’6” x 2’6”)

Glazed DIE7860

H1981mm x W838mm (6’6” x 2’9”)

M Glazed DIE7870

Arva Rose Polished/

Satin ChromeDFU0650

Featured

hardware


Victorian 4 Panel OakThe understated style of this door makes it ideal for both traditional

and contemporary homes.


• Ready for finishing with varnish, stain or Osmo OilGarda Rose

BrassDFU0819

Featured

hardware

†Subject to availabilityInternal hardwood doors

H1981mm x W838mm (6’6” x 2’9”)

Standard DIE7370†

|63

Victorian 4 Panel Oak glazedA simple four panel design door, supplied with two clear glazed

panels.




H1981mm x W838mm (6’6” x 2’9”)

M Glazed DIE7470†

Victorian Latch BrassDFU0621

Featured

hardware

Internal hardwood doors†Subject to availability

64|

Westlock OakPerfect for a more contemporary setting, this engineered door is a

great addition to the home.



H1981mm x W610mm (6’6” x 2’0”)

Standard DIE2530

H1981mm x W686mm (6’6” x 2’3”)

Standard DIE2540

H1981mm x W762mm (6’6” x 2’6”)

Standard DIE2560

H1981mm x W838mm (6’6” x 2’9”)

M Standard DIE2570

Sofia Rose Chrome

DFU0709

Featured

hardware


Pre-finished Holdenby OakPre-finished with an oak-enhancing lacquer, this classic design will

work well in both contemporary and traditional settings.

• Dowel and glue or slab construction

• All faces fully finished

H1981mm x W610mm (6’6” x 2’0”)

Standard DIE8830

H1981mm x W686mm (6’6” x 2’3”)

Standard DIE8840

FD FD30 DIF9140

H1981mm x W762mm (6’6” x 2’6”)

Standard DIE8860

FD FD30 DIF9160

H1981mm x W838mm (6’6” x 2’9”)

M Standard DIE8870

FD M FD30 DIF9170


Pre-finished Oak Lacquer Spray

Repair kitGAR0540

Associated

hardware

66|

Pre-finished Genoa OakThe simple yet stylish door is ideal for both classic and contemporary

interiors.

• All faces fully varnished

H1981mm x W610mm (6’6” x 2’0”)

Standard DIE7230

H1981mm x W686mm (6’6” x 2’3”)

Standard DIE7240

FD FD30 DIF8540

H1981mm x W711mm (6’6” x 2’4”)

Standard DIE7250

H1981mm x W762mm (6’6” x 2’6”)

Standard DIE7260

FD FD30 DIF8560

H2030mm x W813mm (6’8” x 2’8”)

M Standard DIE7280

H1981mm x W838mm (6’6” x 2’9”)

M Standard DIE7270

FD M FD30 DIF8570

H2040mmx W726mm

Standard DIE8440

H2040mm x W826mm

M Standard DIE8460

Sofia Rose Satin NickelDFU0726

Featured

hardware


Pre-finished Genoa Oak glazedThe glazed option of the pre-finished Genoa Oak door allows light into

the room whilst working in both classic and contemporary interiors.



• Supplied with clear toughened glass with screen printed lines

H1981mm x W762mm (6’6” x 2’6”)

Glazed DIE8560

H1981mm x W838mm (6’6” x 2’9”)

M Glazed DIE8570

Pre-finished Oak Lacquer Spray

Repair kitGAR0540


Associated

hardware

68|

Holdenby OakWith its cottage style design, the Holdenby Oak fits with both

contemporary and traditional interiors.

• Dowel and glue construction or slab construction


H1981mm x W457mm (6’6” x 1’6”)

Standard DIE6910

H1981mm x W533mm (6’6” x 1’9”)

Standard DIE6920

H1981mm x W610mm (6’6” x 2’0”)

Standard DIE6930

H1981mm x W686mm (6’6” x 2’3”)

Standard DIE6940

FD FD30 DIF7540

H1981mm x W711mm (6’6” x 2’4”)

Standard DIE6950

H1981mm x W762mm (6’6” x 2’6”)

Standard DIE6960

FD FD30 DIF7560

H1981mm x W838mm (6’6” x 2’9”)

M Standard DIE6970

FD FD30 DIF7570

H2032mm x W813mm (6’8” x 2’8”)

M Standard DIE6980

H2040mm x W626mm

P Standard DIE6931

H2040mm x W726mm

Standard DIE6941

H2040mm x W826mm

M Standard DIE6961

H2040mm x W926mm

P M Standard DIE6971

Idro Latch Chrome

DFU0604

Featured

hardware


Holdenby Oak glazedThis classic glazed version of the Holdenby Oak complements

a variety of interiors.

• Slab construction


• Supplied with toughened screen printed glass

H1981mm x W610mm (6’6” x 2’3”)

Glazed DIE8040

H1981mm x W762mm (6’6” x 2’6”)

Glazed DIE8060

H1981mm x W838mm (6’6” x 2’9”)

M Glazed DIE8070

H2040mm x W726mm

Glazed DIE8140

H2040mm x W826mm

M Glazed DIE8160

Capri Rose Polished/

Satin ChromeDFU0454

Featured

hardware


Genoa OakThis simple yet stylish door is ideal for both classic and contemporary

interiors.




H1981mm x W457mm (6’6” x 1’6”)

Standard DIE6410

H1981mm x W533mm (6’6” x 1’9”)

Standard DIE6420

H1981mm x W610mm (6’6” x 2’0”)

Standard DIE6430

H1981mm x W686mm (6’6” x 2’3”)

Standard DIE6440

FD FD30 DFD2840

H1981mm x W711mm (6’6” x 2’4”)

Standard DIE6450

H1981mm x W762mm (6’6” x 2’6”)

Standard DIE6460

FD FD30 DFD2860

H1981mm x W838mm (6’6” x 2’9”)

M Standard DIE6470

FD M FD30 DFD2870

H2032mm x W813mm (6’8” x 2’8”)

M Standard DIE6480

H2040mm x W626mm

Standard DIE6830

H2040mm x W726mm

Standard DIE6840

H2040mm x W826mm

M Standard DIE6860

H2040mm x W926mm

M Standard DIE6890

Idro Latch Chrome

DFU0604

Featured

hardware


Genoa Oak glazedThis glazed option of the Genoa Oak door adds interest and works

well in both modern and classic interiors.



• Supplied with clear toughened glass with screen printed lines

H1981mm x W686mm (6’6” x 2’3”)

Glazed DIE6740

H1981mm x W762mm (6’6” x 2’6”)

Glazed DIE6760

H1981mm x W838mm (6’6” x 2’9”)

M Glazed DIE6770

Garda Latch Chrome

DFU0705

Featured

hardware


H1981mm x W686mm (6’6” x 2’3”)

Bi-Fold DIP1449

H1981mm x W762mm (6’6” x 2’6”)

Bi-Fold DIP1469

Genoa Oak bi-foldThe classic cottage style of door is timeless and works well when

there is limited space.



Featured

hardware




|73

Internal flush doors

Howdens offer modern doors in

a range of finishes ideal for both

commercial and contemporary

domestic interiors.

Our range includes mobility sizes,

choice of lightweight standard cores

and fire-rated options, with or without

window apertures.

Our apertured fire doors are supplied

fully glazed and include a number

of options designed to meet the

effective visibility requirements for

Part M mobility doors.

Fire Regulations:




Internal flush doors74|

Oak foil 16G glazedThis internal commercial door complies with Part M regulations on

minimum zones of visibility and is highly functional.



• Supplied with Georgian wired glass

H1981mm x W686mm (6’6” x 2’3”)

FD E FD30 Glazed DFL1540

H1981mm x W762mm (6’6” x 2’6”)

FD E FD30 Glazed DIF3660

H1981mm x W838mm (6’6” x 2’9”)

FD M E FD30 Glazed DIF3670

H2040mm x W826mm


H2040mm x W926mm


Stainless Steel concealed fixing

handleDFU0136

Featured

hardware

Internal flush doors |75

Light Grey Oak foil 20G glazedIdeal for both domestic and commercial interiors whilst the clear

glass allows plenty of light in.



• Supplied with clear glass

H1981mm x W686mm (6’6” x 2’3”)


H1981mm x W762mm (6’6” x 2’6”)


H1981mm x W838mm (6’6” x 2’9”)


Stainless Steel

fingerplate DFU0094

Featured

hardware


Ash veneer 16G glazedIdeal for offices and other public spaces, the Ash Veneer 16G Glazed

features natural crown-cut timber veneer. The window style complies

with Part M regulations on minimum zones of visibility.


• Face fully varnished

• Lipped on two long edges


H1981mm x W762mm (6’6” x 2’6”)


H1981mm x W838mm (6’6” x 2’9”)


H2040mm x W826mm


H2040mm x W926mm


Stainless Steel

fingerplate DFU0094

Featured

hardware


Oak Foil 20G glazedThe clear glass on this door means its design suits homes and

commercial settings whilst allowing light into the space.




H1981mm x W686mm (6’6” x 2’3”)

FD E FD30 DIF7840

H1981mm x W762mm (6’6” x 2’6”)

FD E FD30 DIF7860

H1981mm x W838mm (6’6” x 2’9”)

FD M E FD30 DIF7870

H2040mm x W826mm

FD M E FD30 DIF7760

H2040mm x W926mm

FD M E FD30 DIF7770

Stainless Steel

fingerplate DFU0094

Featured

hardware


Ply 20G glazedThis versatile door is ideal for commercial environments but also it

complies with Part M regulations on minimum zones of visibility.




H1981mm x W686mm (6’6” x 2’3”)

P FD E FD30 DFL1740

H1981mm x W762mm (6’6” x 2’6”)

P FD E FD30 DIF7960

H1981mm x W838mm (6’6” x 2’9”)


H2040mm x W826mm

P FD M E FD30 DFL1860

H2040mm x W926mm

P FD M E FD30 DFL1870


Edinburgh Lock

Aluminium DFU0086

Featured

hardware

|79

Ply 16G glazedThis plywood door complies with Part M regulations on minimum

zones of visibility.





H1981mm x W686mm (6’6” x 2’3”)

P FD E FD30 Glazed DIF3340

H1981mm x W762mm (6’6” x 2’6”)


H1981mm x W838mm (6’6” x 2’9”)

P FD M E FD30 Glazed DIF3370

H2040mm x W826mm


H2040mm x W926mm



Stainless Steel

fingerplate DFU0094

Featured

hardware

80|

Ply G/O glazedThe square window of the Ply G/O glazed makes it suitable for many

internal applications.





H1981mm x W686mm (6’6” x 2’3”)


H1981mm x W762mm (6’6” x 2’6”)


H1981mm x W838mm (6’6” x 2’9”)


H2032mm x W813mm (6’8” x 2’8”)


H2040mm x W826mm


H2040mm x W926mm


Stainless Steel

fingerplate DFU0094

Featured

hardware


Dordogne Inlaid Oak veneerThis Dordogne styled flush door is fully finished on all faces and

inlaid with real walnut.


• All faces fully varnished with walnut inlay

H1981mm x W686mm (6’6” x 2’3”)

Standard DIL1240

FD FD30 DFL1240

H1981mm x W762mm (6’6” x 2’6”)

Standard DIL1260

FD FD30 DFL1260

H1981mm x W838mm (6’6” x 2’9”)

M Standard DIL1270

FD M FD30 DFL1270

Capri Rose Polished/

Satin ChromeDFU0454

Featured

hardware


Oak VeneerThe natural timber veneer of this door ensures a classic and timeless

feel for a variety of domestic and commercial environments.



H1981mm x W610mm (6’6” x 2’0”)

Standard DIL1830

H1981mm x W686mm (6’6” x 2’3”)

Standard DIL1840

FD E FD30 DIF9640

H1981mm x W762mm (6’6” x 2’6”)

Standard DIL1860

FD E FD30 DIF9660

H1981mm x W838mm (6’6” x 2’9”)

M Standard DIL1870

FD M E FD30 DIF9670

H2040mm x W826mm

FD M E FD30 DIF9760

H2040mm x W926mm

FD M E FD30 DIF9770

Aluminium Roundbar

Latch DFU0302

Featured

hardware


Oak Veneer 20G glazedThe clear glazing panel ensures this door complies with Part M

regulations on minimum zones of visibility.




H1981mm x W686mm (6’6” x 2’3”)

FD E FD30 DIF9340

H1981mm x W762mm (6’6” x 2’6”)

FD E FD30 DIF9360

H1981mm x W838mm (6’6” x 2’9”)

FD M E FD30 DIF9370

H2040mm x W826mm

FD M E FD30 DIF9960

H2040mm x W926mm

FD M E FD30 DIF9970

Edinburgh Latch

Aluminium DFU0085

Featured

hardware


Ash veneerHigh quality, natural timber veneer and concealed timber lippings

make this door a smart choice for many types of interiors.



H1981mm x W686mm (6’6” x 2’3”)

FD E FD30 DIF0740

H1981mm x W762mm (6’6” x 2’6”)

FD E FD30 DIF0760

H1981mm x W838mm (6’6” x 2’9”)

FD M E FD30 DIF0770

H2040mm x W826mm

FD M E FD30 DIF0240

H2040mm x W926mm

FD M E FD30 DIF0250

Victorian Latch

ChromeDFU0611

Featured

hardware


Oak foilThis door works equally well in domestic interiors and commercial

environments.



H1981mm x W610mm (6’6” x 2’0”)

Standard DIC3230

FD E FD30 DIF1730†

H1981mm x W686mm (6’6” x 2’3”)

Standard DIC3240

FD E FD30 DIF1740

H1981mm x W762mm (6’6” x 2’6”)

Standard DIC3260

FD E FD30 DIF1760

H1981mm x W838mm (6’6” x 2’9”)

M Standard DIC3270

FD M E FD30 DIF1770

H2040mm x W726mm

Standard DIC4941

FD E FD30 DIF2131†

H2040mm x W826mm

Standard DIC4961

FD M E FD30 DIF2161

H2040mm x W926mm

Standard DIC4971

FD M E FD30 DIF2171

Aluminium Roundbar

Latch DFU0302

Featured

hardware

†Subject to availabilityInternal flush doors86|

Light Grey Oak foilThis statement grey door is on trend and is ideal for both domestic

and commercial interiors.


• All faces fully finishedTurin RoseDFU0727

Featured

hardware

H1981mm x W610mm (6’6” x 2’0”)

Standard DIL1430

H1981mm x W686mm (6’6” x 2’3”)

Standard DIL1440

FD E FD30 DFL1440

H1981mm x W762mm (6’6” x 2’6”)

Standard DIL1460

FD E FD30 DFL1460

H1981mm x W838mm (6’6” x 2’9”)

Standard DIL1470

FD M E FD30 DFL1470


Sapele veneer†The richer tones of this door can complement many colour schemes

in both domestic and commercial situations.


• All faces fully varnished


H1981mm x W610mm (6’6” x 2’0”)

Standard DIC1430

H1981mm x W686mm (6’6” x 2’3”)

Standard DIC1440

H1981mm x W762mm (6’6” x 2’6”)

Standard DIC1460

FD E FD30 DIF1160

H1981mm x W838mm (6’6” x 2’9”)

M Standard DIC1470

FD M E FD30 DIF1190

H2040mm x W726mm

Standard DIC0641

H2040mm x W826mm

M Standard DIC0661

AluminiumRoundbar

Rose DFU0300

Featured

hardware

†Subject to availabilityInternal flush doors88|

Primed unlipped hardboardThis practical door looks good in modern homes, and performs well in

commercial and contract settings.



H1981mm x W381mm (6’6” x 1’3”)

Standard DIC1100

H1981mm x W457mm (6’6” x 1’6”)

Standard DIC1110

H1981mm x W533mm (6’6” x 1’9”)

Standard DIC1120

H1981mm x W610mm (6’6” x 2’0”)

Standard DIC1130

H1981mm x W686mm (6’6” x 2’3”)

Standard DIC1140

H1981mm x W711mm (6’6” x 2’4”)

Standard DIC1150

H1981mm x W762mm (6’6” x 2’6”)

Standard DIC1160

H1981mm x W838mm (6’6” x 2’9”)

M Standard DIC1170

Victorian Scroll Latch

ChromeDFU0661

Featured

hardware


PlywoodThis versatile door is available in a wide range of imperial and metric

sizes with both standard and FD30 cores.




H1981mm x W381mm (6’6” x 1’3”)

F Standard DIC1300

H1981mm x W457mm (6’6” x 1’6”)

F Standard DIC1310

H1981mm x W533mm (6’6” x 1’9”)

F Standard DIC1320

H1981mm x W610mm (6’6” x 2’0”)

F Standard DIC1330

P FD E FD30 DIF1430

H1981mm x W686mm (6’6” x 2’3”)

F Standard DIC1340


P FD E FD30 DIF1440

H1981mm x W711mm (6’6” x 2’4”)

F Standard DIC1350

H1981mm x W762mm (6’6” x 2’6”)

F Standard DIC1360


P FD E FD30 DIF1460

H1981mm x W838mm (6’6” x 2’9”)



P FD E FD30 DIF1470

H2032mm x W813mm (6’8” x 2’8”)

F Standard DIC1380



H2040mm x W526mm

F Standard DIC3020

P FD E FD30 DIF1520

H2040mm x W626mm

F Standard DIC3030

P FD E FD30 DIF1530

H2040mm x W726mm

F Standard DIC3040

P FD E FD30 DIF1540

H2040mm x W826mm



H2040mm x W926mm



Riva Rose Chrome

DFU0460

Featured

hardware


Internal doorsAn illustrated technical guide

Moulded panel doors

Choose from three core specifications, including Standard, Developer door and FD30

(fire resistant for up to 30 minutes). Glazed doors are another option, with all glass toughened

to BS EN 12600 or BS EN 12150.

These doors are made from hardwearing, one-piece moulded facings, bonded to a timber

frame and painted with a white base coat. Bi-fold versions are ideal for small areas and

wardrobes. We also offer mobility sizes.

Within the 6 Panel grained door range we have every door size and style available.

Standard core

A multi-cell core for light duty, non fire-rated applications.

Actual core construction may vary.

Developer door core

The solid core of the developer door provides additional strength and stability

to the product. It may also reduce noise transmission through the property.

Fire door core

The FD30 core is a high density core material. This proven construction, when

correctly installed with suitable hardware, f/c lining/casing and intumescent

materials, will provide certified fire resistance. Actual core construction may vary.

35mm Fire door core

Constructed with a high density non-reactive core, the door can be used to

upgrade an existing opening to a fire door, without the need to replace the

lining or frame*. Intumescent strips can be fitted directly to the door so it can

be used with an existing frame.

*See detailed product instructions and fire certificate, subject to material type

and dimensions.

Internal door thicknesses

All internal doors conform to the following thicknesses:

• Imperial sizes 35mm

• Metric sizes 40mm

• Fire doors 44mm (excluding 35mm fire doors)

CoreCCC

Core

Core

CoreCCCCorCorCorCoroooCoroooro eeeeeeeeeee

Skin

Skin

Skin

Skin

Intermediate

layers

Internal doors |91

Softwood doors

This range features a wide range of glazed and panelled designs. The 4 Panel Clear Pine is available

as a fire door. You can also specify mobility sizes.

Glazed doors are supplied with all glass toughened to BS EN 12600 or BS EN 12150.

Clear pine doors are manufactured with an engineered construction using selected veneers

and lippings. The scientific benefits of an engineered door are unique; controlling warp,

shrink and twist.

Doors are engineered using a solid internal core of laminated timber lengths. This gives a uniform

stile and crossrail construction that ensures maximum strength and stability.

Knotty pine, redwood and hemlock doors are of a solid construction.

Finishing information

Our softwood doors are ready for finishing with varnish, stain or paint. Please refer to pages 243 and

244 for a full range of finishing products.

The engineered construction:

Internal primed doors

Offering standard and glazed designs, these primed doors are constructed using glue and dowel and

slab constructions with HDF skins.



Stile and rail doors are supplied primed, ready for finishing with paint.

Premium grade

veneer

High strength

laminated core

Stile

Rail35, 40 or 44mm

construction

Engineered stile

MDF centre panel

HDF skin

Timber edge

lipping

Engineered rail

ggggg gggggggg

plplpllp ieieieiei dddddd prprprpppp imimmimmimmededededeed rerereeadadadaddadddyyyyyy fofofofofoforrrr finfinfinfinfinfifinfinfififififififi isisssshihihhihhhh ngngngngngn wwwwwitittithhhhhh pppp

EngEngEngEngEngEngE ggineineineinenenenennnnnnneereereereereereed sd sd sd sd sd dd tiltiltilti eeeeeeee

MDFMDFMDFMDFMMDFMMDFMMMDMDD cececececeeeceennnnnnn

skskskskskinininini

edededededdgegegegegegeegegg

Internal doors92|

Hardwood doors

High quality, engineered construction characterises this range. This includes fire door versions of the

4 Panel Oak, Worcester Oak, Burford 4 Panel Oak, Linear Oak, Genoa Oak, Dordogne Oak and 4 Panel

Shaker Oak designs. We offer a varied choice of glazed and panelled designs, as well as mobility

sizes and bi-fold doors.

The Dordogne Oak door range contains the most door sizes and styles.


Advantages of an engineered construction for hardwood doors include:

1. Superior colour matching within each door

It is far easier to colour match veneers than it is to do so on solid timber

components.

2. Environmentally friendly

The timber used to make 1 solid door would produce enough

veneers to make at least 10 engineered doors.

Our solid oak doors are of a tongue and groove construction with

glued and nailed ledges.

Hardwood door veneers are made from either oak or a combination

of oak and local hardwood inserts.

Finishing Information

Our hardwood doors are ready for finishing with varnish or stain.

Waxes, polishes and oils should not be used on our hardwood

doors as they do not seal the door properly and may cause

veneer delamination. Please refer to pages 243 and 244 for a full

range of finishing products.

Our Solid Rustic Oak ledged door can be finished with varnish, stain, oil or wax.

Flush doors

You have the choice of lightweight standard cores and fire-rated options, with or without window apertures.

Our apertured fire doors are supplied fully glazed and include a number of options designed to meet the

effective visibility requirements for Part M mobility doors. See regulation guidelines on page 251.

Where required, the external solid core blank lightweight door can be used internally. This plywood

faced fire door is extremely versatile and can be customised to create something unique. If required,

a 3rd party approved fire door installer can cut the door to size, make apertures (custom glazing) in

accordance with specific guidelines, and add veneers or other finishes (subject to instructions).

*Aperture dimensions after lining is applied and before the beading is fitted.

Engineered core

Real wood veneer

yyy eee annanananndd

aaaaaaa 3r3r3r3r3r33333333333333333 d d d ddddd papapapapappppappapappppppppppappap rtrtrtrttrtrty y y y y apapapapapappprprprprprprpp ovovovovovovvedededededdededdd fifififififififirerererereere dddddddddooooooooooooor r rrr inininninnnststststststsssstalalalalalallaaaa leleleleleelerr r rr r ccccc

acacacacacca cocococococococcocordrdrdrdrdananananannanannnannnnnnnnncecececececeeeeeee wwwwwwwwwwwwwwwwitititititittitiiiiiiiiiii hhhhhhhhhh spspspspspspppsps ecececececccececccccifiifiifiifiifiifiifiiii c c c ccccc guguguguguggugg ididididddidddeleleleleleeleeeeee inininininini esesesesesssssssssss, , , , ananaaanananaaaaaaaaanaaaaanaaanaaa dddddd

*Ap*Ap*Ap*Ap*ApAAApertertertertertrtureureureureureurerer didididididimenmenmenmenmenmennsiosiosiosiosiosiossss ns ns ns ns nnsnns aftaftaftaftaftaftaftaf er er er er e linlinlinlinlinnlinnnl nnnnnnnninnnnningingingingingiinginginiiiiii isisisissisis apapapapapaaappa plipliplipliliplied ed ed ed ed edd anddandandandanda bebebebebebeebbefofofofofofofoffofoooo

Core

Timber veneer, foil or

paint surface

200mm*

124mm*

127mm*

Internal doors |93

Fire rated doors

Where a fire door is required, Howdens has a selection of styles to choose from. We also offer a wide

variety of fire rated hardware and joinery products to accompany your fire door.

Intumescent seals

- Full perimeter seal (top and

sides of the door)

- Seals made from the correct

material and to the size and

specification required

- Suitable rating and

configuration to match the fire

rating of the door

F/C Certified approved

trenched lining

- Correct material and

dimensions for specific

fire door rating

- Securely fitted to

the aperture, with the

correct fixings and gap

filling materials

Fire rated lock/ latch

& handle

- Suitable for use on

a fire door provided

it is fire rated and CE

marked

- Fitted with the correct

intumescent paper

around the lock/latch/

handle

- Fitted in the correct

location

Fire door signage

Check the correct

signage is fitted in the

correct location

CE Marked fire rated

controlled door closer

- Suitable for use on the

specific fire door

- Adjusted to ensure the

door closes correctly

against the frame and the

door is easy to operate


intumescent pads and

fixings

Plywood FD30 door

- Tested and certified fire

door with certified label

visible on the top edge of

the door

- Fitted with all the

required ironmongery and

components

- Fitted to ensure there is a

3mm gap between the door

and frame when closed and

up to 8mm at the bottom

Expanding fire rated

foam

- Only use fire rated

foams/ intumescent

mastics to fill any gaps

around the door frame

CE Marked satin stainless

steel grade 13 hinges


intumescent pads behind

the hinge

- Fitted in the correct

location

- Standard height doors

should have a minimum of

three hinges to prevent the

door from warping in a fire

All fire rated hardware and joinery products should be fitted as detailed on the fire door certificate/ report.

Please refer to the fire doors specific test evidence assessment, or data sheet before fitting any fire doors.

For the full range of fire doors available please refer to door grids on pages 255-265

Internal doors94|

Fire Regulations:




Sliding wardrobe doors

Our sliding wardrobe doors are

available in white and oak finishes, in

both Shaker and mirror styles.

The Shaker style is a versatile door

that suits a variety of interiors and

can be combined with the Shaker

mirror door. The classic mirror door

is a simple design that is ideal for

creating a feeling of space in a room.

In addition to the doors in this

section, any of our range of over 60

internal doors can be used as sliding

doors by simply being fitted with the

Howdens sliding wardrobe door track.

Please refer to page 204 for our

range of sliding door gear.

Sliding wardrobe doors |95



White edged mirror doorThis classic mirrored wardrobe door is ideal in many different interiors

and creates a feeling of space in a room.

• Mirrored door supplied with 4mm annealed glass - impact tested

• Supplied with a steel frame construction

H2260mm x W610mm

Mirrored GIR2011

H2260mm x W914mm

Mirrored GIR2010

L1200mm

Silver trackset GIR2037

L1800mm


L2700mm


L3600mm


L1200mm

White trackset GIR2036

L1800mm


L2700mm


L3600mm


Learn more about this product through our sliding wardrobe door

movies at www.howdens.com/advice-inspiration/movies96|

White Shaker panel and mirror doorThe Shaker design is a versatile door that suits a variety of interiors.

The Shaker panel and Shaker mirror doors can be used together or

on their own.


• Panel doors constructed using 8mm paper faced chipboard



movies at www.howdens.com/advice-inspiration/movies Sliding wardrobe doors

H2260mm x W610mm

Mirrored GIR2015

H2260mm x W914mm

Mirrored GIR2013

H2260mm x W610mm

F Standard GIR2044

H2260mm x W914mm

F Standard GIR2042

L1200mm


L1800mm


L2700mm


L3600mm


L1200mm


L1800mm


L2700mm


L3600mm


|97

Oak Shaker panel and mirror doorThe Shaker design is a versatile door that suits a variety of interiors.

The Shaker panel and Shaker mirror doors can be used together or

on their own.


• Panel doors constructed using 8mm paper faced chipboard


H2260mm x W610mm

Mirrored GIR2025

H2260mm x W914mm

Mirrored GIR2023

L1200mm


L1800mm


L2700mm


L3600mm


H2260mm x W610mm

F Standard GIR2024

H2260mm x W914mm

F Standard GIR2022

L1200mm


L1800mm


L2700mm


L3600mm



movies at www.howdens.com/advice-inspiration/moviesSliding wardrobe doors98|


In addition to our sliding door range, Howdens offers a variety of wardrobe door solutions using our

existing range of over 60 internal door styles. Many of our doors can be finished to suit your individual

style and also fitted to match your existing internal doors.

Sliding door gear converts our existing joinery doors into sliding doors. It can accommodate two or

more doors, allowing them to be fitted flush within an opening. If space is limited, the door gear is

also suitable for use with single doors.

Please refer to page 204 for our range of sliding door gear.


Internal storage solutions

Many of the bespoke internal storage solutions shown with our sliding wardrobe doors have been

created using our standard product.

For full details visit our website at www.howdens.com

Top storage shelf Chrome oval tube and fittings

Shoe rack 4 Drawer base unit

Wide 2 drawer base unit Bespoke internal shelving

Internal Storage Solutions100|

Sliding wardrobe doorsAn illustrated technical guide

Sliding wardrobe door thickness

All sliding wardrobe doors conform to the following thicknesses:

Standard 610mm Standard 914mm


All our wardrobe doors are pre-finished.

Sliding wardrobe door construction

All doors are supplied with a steel frame construction. Shaker panel doors are constructed using

8mm paper faced chipboard, and mirror doors are supplied with 4mm annealed glass that is

impact tested.

Centre panel /

chipboard or mirror

Stile

Bottom rail

Sliding door gear

Sliding door gear allows joinery doors to be hung and act as sliding doors, ideal for when door swing

space is limited.

For single doors (GIR0030):

Face fixed to the wall above the door opening, this track accommodates a single door Max door weight: 55Kg Max door thickness: 900mm

Door thickness: 32-50mm

For multiple doors (GIR3010 and GIR3011):

Allows for doors to be fitted flush within an opening and can accommodate 2 or more doors Max door weight: 45Kg (per door) Max door thickness: 900mm Door thickness: 16-40mm

Track

Top plate

Guide

Stop

Adjuster bolt

Guide channel

Track

Truck

Floor guide

Door stop

0m0m0m0m0m0mmmmmmmmmmmmmm

mmmmmmmmmmmmm

0101010 00000000 ddddd GIGIGGGIGGGG R3R33301010101111)1)1

fifififitttttttttededededededededde flflflflusususushhh wiwwiww ththhhthinininn aaaannnnn opopopopppo eneeneneneeeeneeee ininng g g g gg ananannannd dd cacacaccacannnn acaccacccoccooccoommmmmmmmododododododaaaaaa

(p(p(p(p(p(perererererrer dddddddoooooooooooooo r)r)r)r)rr

00000000m0m0m0m0m0m0 mmmmmmmmm

mmmmmmmmmmmmm


External hardwooddoors

Howdens external hardwood doors

are of an engineered construction,

with a hardwood veneer to increase

stability.

We offer oak and hardwood doors

with double and triple glazing. There

is a decorative centre layer in the

triple glazed panels. This sealed

weatherproof unit increases the

thermal performance of the window,

and makes the design easy to clean.

Our hardwood doors are ready for

finishing with varnish or stain.

External hardwood doors

Fire Regulations:




102|

Part L Regent Oak†This popular design combines style with simplicity to suit a wide

variety of exteriors.

• Engineered construction

• Ready for finishing with varnish or stain

H2032mm x W813mm (6’8” x 2’8”)

F L L M Standard DXP1981

Garda Lock Chrome

DFU0704

Featured

hardware

U-Value 1.8

†Subject to availabilityExternal hardwood doors |103

Cottage Oak triple glazed†The design of this door is perfect for creating a traditional rural style.



• Supplied triple glazed

H2032mm x W813mm (6’8” x 2’8”)

M Glazed DXP2380

Garda Lock Brass

DFU0700

Featured

hardware

†Subject to availabilityExternal hardwood doors104|

External Dordogne OakThe contemporary looking external Dordogne Oak door is perfectly

suited for the modern home.



H1981mm x W838mm (6’6” x 2’9”)

M Standard DXP2670

H2032mm x W813mm (6’8” x 2’8”)

M Standard DXP2680

Door knocker

Satin NickelDFU0166

Featured

hardware

External hardwood doors |105

External Dordogne Oak glazedWith its unique four panel glazed design, this door is perfectly suited

for classic or contemporary looking homes.



• Supplied with frosted double glazing

H1981mm x W838mm (6’6” x 2’9”)

M Glazed DXP2970

H2032mm x W813mm (6’8” x 2’8”)

M Glazed DXP2980

Lugano Lock Chrome

DFU0904

Featured

hardware

External hardwood doors106|

External Worcester Oak†The contemporary looking external Worcester Oak door is perfectly

suited to any modern home.


• Ready for painting or staining

H1981mm x W838mm (6’6” x 2’9”)

M Standard DXP3170

H2032mm x W813mm (6’8” x 2’8”)

M Standard DXP3180

Garda Lock Chrome

DFU0704

Featured

hardware

†Subject to availabilityExternal hardwood doors |107

External Worcester Oak glazedWith its distinctive centre panel glazing, this door is perfect for the

more contemporary looking home.




H1981mm x W838mm (6’6” x 2’9”)

M Glazed DXP3270

H2032mm x W813mm (6’8” x 2’8”)

M Glazed DXP3280

Idro Lock Chrome

DFU0603

Featured

hardware


External Linear Oak†The external Linear Oak door creates a modern look to the entrance

of any home.



H1981mm x W838mm (6’6” x 2’9”)

M Standard DXP1570

H2032mm x W813mm (6’8” x 2’8”)

M Standard DXP1580

Escutcheon Chrome round

coveredDFU0206

Featured

hardware

External hardwood doors†Subject to availability

|109

Georgian glazedThis door lets in plenty of light to create an airy feel.



• Supplied with clear double glazing

H1981mm x W762mm (6’6” x 2’6”)

Glazed DXP5960†

H1981mm x W838mm (6’6” x 2’9”)

M Glazed DXP5970

H2032mm x W813mm (6’8” x 2’8”)

M Glazed DXP5980

Antique Lock Black

DFU0033

Featured

hardware


110|

|111

Bosworth glazedThis door lets in plenty of light to create an airy feel.



• Pre-beaded


H1981mm x W762mm (6’6” x 2’6”)

Glazed DXP5860†

H1981mm x W838mm (6’6” x 2’9”)

M Glazed DXP5870

H1981mm x W813mm (6’8” x 2’8”)

M Glazed DXP5880

Chrissi Lock Satin NickelDFU0044

Featured

hardware


|111

Richmond glazedThe vertical glazing panels in this door allow light to flood into any

home.




H1981mm x W762mm (6’6” x 2’6”)

Glazed DXP5460

H1981mm x W838mm (6’6” x 2’9”)

M Glazed DXP5470

H2032mm x W813mm (6’8” x 2’8”)

M Glazed DXP5480

Garda Lock Satin NickelDFU0720

Featured

hardware


Carolina glazedThis popular design can be used to add character and style to all

properties.




H1981mm x W762mm (6’6” x 2’6”)

Glazed DXP4660†

H1981mm x W838mm (6’6” x 2’9”)

M Glazed DXP4670

H2032mm x W813mm (6’8” x 2’8”)

M Glazed DXP4680

Mortice knob Brass

DFU0050

Featured

hardware


|113

H2XG glazedThis door lets in plenty of light to create an airy feel.



• Pre-beaded


H1981mm x W762mm (6’6” x 2’6”)

Glazed DXP5160

H1981mm x W838mm (6’6” x 2’9”)

M Glazed DXP5170

H2032mm x W813mm (6’8” x 2’8”)

M Glazed DXP5180

Victorian Scroll Lock

ChromeDFU0660

Featured

hardware


RegentThis six panel hardwood door arrives unstained and lends itself to a

variety of settings and colour schemes.



H1981mm x W762mm (6’6” x 2’6”)

Standard DXP4360

H1981mm x W838mm (6’6” x 2’9”)

M Standard DXP4370

H2032mm x W813mm (6’8” x 2’8”)

M Standard DXP4381

Chrissi Lock Satin NickelDFU0044

Featured

hardware

External hardwood doors |115

External softwooddoors

These products are suitable for

a range of applications. They are

supplied ready for finishing on site

to your particular specification.

FL&B and L&B doors have loose

pinned ledges and braces which

can be moved and pinned to the

opposite side of the door. This gives

flexibility when choosing which way

round the door is hung.

All our softwood doors are suitable

for paint finish only.

Fire Regulations:




External softwood doors116|

2XG/2XGG HemlockThis simple, functional door admits plenty of light as a single top

glazing panel (XG). It also has a loose pinned bottom panel that

offers the option of a second glazing panel (XGG).

• Constructed using Stub Mortice and Tenon frame


• Supplied unglazed. Suitable for double glazing,

single glazing options available for 2XG only

H1981mm x W762mm (6’6” x 2’6”)

P Standard DXT0160

H1981mm x W838mm (6’6” x 2’9”)

P M Standard DXT0170

H2032mm x W813mm (6’8” x 2’8”)

P M Standard DXT0180

Victorian Lock Chrome

DFU0610

Featured

hardware

External softwood doors |117

FL&BThis versatile door is an ideal choice for entrances to the garden and

outbuildings.

• Framed, Ledged and Braced construction using selected redwood

timber


• Redwood board and braces loose pinned

H1981mm x W610mm (6’6” x 2’0”)

F Standard DXC0530

H1981mm x W686mm (6’6” x 2’3”)

F Standard DXC0540

H1981mm x W762mm (6’6” x 2’6”)

F Standard DXC0560

H1981mm x W838mm (6’6” x 2’9”)

F M Standard DXC0570

H2032mm x W813mm (6’8” x 2’8”)


Antique Latch BlackDFU0034

Featured

hardware

External softwood doors118|

L&BThis plain door made of a tongue and groove construction,

is ideal for outbuildings and other utilitarian entrances.

• Ledged and Braced construction using selected redwood timber


• Redwood board and braces loose pinned

H1981mm x W686mm (6’6” x 2’3”)

F Standard DXC0640

H1981mm x W762mm (6’6” x 2’6”)

F Standard DXC0660

H1981mm x W838mm (6’6” x 2’9”)


Pull handle Antique Black

DFU0137

Featured

hardware

External softwood doors |119

Fire Regulations:




External flush doors

Versatile and practical, our external

flush doors come in a range of

options.

You can choose between solid doors

and versions with glazed window

apertures, and we offer FD30 and

FD60 models, fire resistant for up to

30 and 60 minutes respectively.

The external solid core blank

lightweight door can be cut to suit

different shape openings and sizes.

All our external flush doors are

suitable for a paint finish only.

External flush doors120|

Ply G/O glazedA basic plywood door with a square aperture, the Ply G/O glazed is

well suited to commercial settings.





H1981mm x W762mm (6’6” x 2’6”)

P FD FD30 Glazed DXF1360

H1981mm x W838mm (6’6” x 2’9”)

P FD M FD30 Glazed DXF1370

H2032mm x W813mm (6’8” x 2’8”)

P FD FD30 Glazed DXF1380

H2040mm x W826mm


H2040mm x W926mm


Briton security push

padSCF0081

Featured

hardware

External flush doors |121

Solid core blank lightweightThis plywood faced fire door is extremely versatile and can be

customised to create something unique.

• Constructed using three layers of laminate core


• Can be cut to size (see guidelines for details)

• Also suitable for internal use

• Part L compliant when fitted with a Howdens door frame

H2135mm x W915mm (7’0” x 3’0”)

FD L L M E FD30 DFD0041


H2440mm x W1220mm (8’0” x 4’0”)


Briton single panic bolt SCF0078

Featured

hardware

U-Value 1.2

U-Value 1.1

U-Value 1.2

External flush doors122|

PlywoodThis door is particularly suitable for commercial locations where

functionality is important.




H1981mm x W686mm (6’6” x 2’3”)

P FD FD30 DXF0140

H1981mm x W762mm (6’6” x 2’6”)

Standard DXL0560

P FD FD30 DXF0160

FD FD60 DXF0262

H1981mm x W838mm (6’6” x 2’9”)

M Standard DXL0570

P FD M FD30 DXF0170

FD M FD60 DXF0272

H2032mm x W813mm (6’8” x 2’8”)

P FD FD30 DXF0180

H2040mm x W826mm

P FD M FD30 DXF0460

H2040mm x W926mm

P FD M FD30 DXF0470

Briton double rebated

panic setSCF0076

Featured

hardware

External flush doors |123

Garage doors

Garage Doors

Our garage doors will enhance the

exterior of your property.

The redwood garage doors are made

from Group 1 European timber, and

are rebated for right hand opening.

All our garage doors are suitable for

a paint finish only.

Fire Regulations:




124|

Softwood FL&B†This practical tongue and groove garage door will enhance the exterior

of your property.

• Constructed using selected softwood timber


H1981mm x W2134mm (6’6” x 7’0”)

F Standard DXG0110

H2134mm x W2134mm (7’0” x 7’0”)

F Standard DXG0220

Antique Lock Black

DFU0033

Featured

hardware

Garage doors†Subject to availability

|125

External doorsAn illustrated technical guide

External door thicknesses

All external doors conform to the following thicknesses: Standard 44mm FD30 44mm FD60 54mm

External door essentials

We offer a complete range of door essentials to accompany your external door.

External door frame

(please refer to p131-p134)

Hinges

(please refer to p229-p232)Lock


Nightlatch


Handle


External door


Weather bar

(please refer to p134)

Letterplate

(please refer to p201)

LocLocLocLocLoccccLLoL k k kkk kkkkkk

222222222222222222219)19)19)19)19)1919)9)

tltltllatcatcatcatcatcatcat hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh

22222218)18)18)18)18)1118)18181818)181

ananananandledledledledleddd e

111111190)90)90)90)0)90))9

LetLetLetLetLettLetteeeeee tertererterteret plaplaplaplaplaplalp te te tetete tee

External doors126|

Hardwood doors

All our external hardwood doors are of an engineered construction, with a hardwood veneer to

increase stability.

Our external hardwood doors are constructed using either variants of the mortice and tenon joints,

dowell joints or slab construction.

Our oak doors consist of an engineered core and real oak veneer.

We offer oak and hardwood doors with double and triple glazing. There is a decorative centre layer

in the triple glazed panels (which can be clear, obscure or bevelled and with zinc leading) which is

protected by two outer layers of 4mm toughened glass. This sealed weatherproof unit increases the

thermal performance of the window, and makes the design easy to clean.


Our hardwood doors are ready for finishing with varnish or stain. Waxes, polishes and oils should

not be used on our hardwood doors as they do not seal the door properly and may cause veneer

delamination. Please refer to page 243 and 244 for a full range of finishing products.

Part L external doors

Part L doors are constructed with an internal insulation panel to provide improved thermal efficiency.

When fitted with an approved frame, our Part L doors achieve a ‘U’ value of 1.8W/m2K or better.

Please refer to pages 103 and 122 for our full range of Part L doors.

1.2mm Oak veneer

Insulation panel

Core

Engineered construction

InsInsInsnsn ulaulaulaulaulalatiotiotiotiotit

CorCorCoCorCorCorCCo eeeeee

Veneer

Engineered Timber Core

Centre

Panel

rrrrrrrrr

EngEngEngEngEngEnggEngEnEEEnn ineineneineineinennneereereererrereererereeed Td Td Td Td Tdd Td Timimimimmm

CCCCCCCCCCCCC

PPPP

External doors |127

Frame

Ledge

Brace

Softwood doors

These products are suitable for a range of applications. They are supplied ready for finishing on site

to your particular specification.

FL&B and L&B doors have loose pinned ledges and braces which can be moved and pinned to the

opposite side of the door. This gives flexibility when choosing which way round the door is hung.


All our softwood doors are suitable for a paint finish only.

Flush doors

Here you can choose between solid doors and versions with glazed window apertures, and we offer FD30

and FD60 models.

The external solid core blank lightweight door is constructed using three layers of laminate core.

This means it can be cut to suit different shape openings, cut to size, apertures can be made in

accordance with guidelines, and veneers or other finishes can be added.


All our external flush doors are suitable for a paint finish only.

FL&B construction L&B construction

Plywood veneer

Solid core blank lightweight

Tri-laminate core

Ledge

Brace

nenenenneeerererererrererrrrrrrrr

External doors128|

Garage doors

Our redwood garage doors are made from Group 1 European timber, and are rebated for right hand

opening as this illustration shows.


All our garage doors are suitable for a paint finish only.

Double & French doors

Howdens offer a good choice of double and French doors. Softwood doors are available with a solid

timber stub mortice and tenon or dowel construction. Bottom panels in the softwood doors are

engineered construction. Hardwood doors are also available within this range with an engineered

mortice and tenon construction.

All double and French doors are rebated for right hand opening.


All our softwood double and French doors are suitable for a paint finish only. Hardwood double and

French doors are suitable for finishing with varnish, paint or stain.

Door side

Mortice wedges

M&T construction

Rail

Stile

Tenon

External doors |129

Joinery

We offer a wide range of joinery

products to help professional fitters

get the best results in domestic

and commercial interiors. If you are

building or repairing a staircase,

we have stair parts in a choice of

styles. For a final touch that adds or

preserves character, there is a great

variety of redwood, oak and MDF

mouldings which can be finished to

your individual style.

Fire Regulations:




Joinery130|

External door frames

External door frames

Door frames are used to hang external doors. Our range includes a variety of softwood, hardwood and oak

veneered options which can be trimmed to the specific size of the door. We also offer a door frame length and

30 or 60 minute fire door frames, pre-grooved for intumescent strips which are included.

All softwood door frames are made from pine. Our oak veneered frames are made from a hardwood core with an

oak veneer applied and our hardwood door frames are made using Meranti timber.

* Timber is a natural material and therefore is subject to movement from changes in temperature and humidity. Each installation should be assessed individually on site

and brick opening sizes calculated referencing the physical frame size at that time. The brick opening sizes indicated above are a guide only.

To fit door To fit door Approx brick opening Approx brick opening

height x width (mm) height x width sizes* (mm) sizes* (inches)

(inches)

External softwood door frames

External hardwood door frames



(inches)

Unassembled softwood FD30 door frames, opens in or out (no sill)H1981mm x W762mm 6’6” x 2’6” H2033mm x W856mm 6’8” x 2’9.5” UK F DFR0111

H1981mm x W838mm 6’6” x 2’9” H2033mm x W935mm 6’8” x 3’0.5” UK F DFR0112

H2040mm x W926mm 6’6” x 3’0” H2088mm x W1015mm 6’10” x 3’4” UK F DFR0116

Unassembled softwood door frames, opens in or out (no sill)



Assembled softwood door frames, opens in (with hardwood sill)

H1981mm x W762mm 6’6” x 2’6” H2079mm x W856mm 6’9.5” x 2’9.5” UK F DFR0207



Assembled softwood door frames, opens out (with hardwood sill)H1981mm x W762mm 6’6” x 2’6” H2079mm x W856mm 6’9.5” x 2’9.5” UK F DFR0217


Softwood door frame length2.4m H2400mm x W56mm UK F DFR0900

Unassembled oak veneered door frames, opens in or out (with oak sill)H1981mm x W838mm 6’6” x 2’9” H2071mm x W932mm 6’9.5” x 3’0.5” DFR0018

H2032mm x W813mm 6’8” x 2’8” H2121mm x W907mm 6’11.5” x 2’11.5” DFR0019

Unassembled hardwood door frames, opens in or out (with hardwood sill)H1981mm x W762mm 6’6” x 2’6” H2071mm x W856mm 6’9.5” x 2’9.5” DFR0560



Unassembled hardwood FD60 door frames, opens in or out (no sill)H1981mm x W762mm 6’6” x 2’6” H2034mm x W858mm 6’8” x 2’9.5” DFR0599

H1981mm x W838mm 6’6” x 2’9” H2034mm x W934mm 6’8” x 3’0.5” DFR0590

H2032mm x W813mm 6’8” x 2’8” H2091mm x W914mm 6’8.6” x 3’0” DFR0117

External hardwood door sills (suitable for use with softwood and hardwood door frames)1.2m DFR0903

2.4m DFR0902

Weather seal roll8m UK DFR0901

|131

Assembled double softwood door frame, opens out (with hardwood sill)H1981mm x W1168mm 6’6” x 3’10” H2079mm x W1262mm 6’9.5” x 4’1.5” UK F DFR0302

Unassembled double hardwood door frame, opens out (with hardwood sill)H1981mm x W1168mm 6’6” x 3’10” H2070mm x W1264mm 6’9.3” x 4’1.5” DFR0305

Unassembled Garage Softwood, Opens outH2133mm x W2133mm 7’0” x 7’0” H2205mm x W2271mm 7’3” x 7’5” UK F DFR0342

Door linings and casingsDoor linings and casings are made from pine, primed MDF or oak veneered MDF (where stated).

Door liningsLinings are used to hang internal doors and come with a separate door stop which can be fitted once the door has

been installed. Softwood trenched linings have a reversible head to allow for two door sizes. We have a range of

FD30 and oak veneered linings and a lining length for double doors. When used with an intumescent strip the oak

veneered and primed MDF linings can be used with the internal moulded, flush and Dordogne Oak fire doors.

External double door frames

Garage door frame

* Timber is a natural material and therefore is subject to movement from changes in temperature and humidity. Each installation should be assessed individually on site

and brick opening sizes calculated referencing the physical frame size at that time. The brick opening sizes indicated above are a guide only.

*1 Finished size



(inches) (inches)

Oak veneered MDF linings, untrenchedH2070mm x W838mm 6’9” x 2’9” 138mm x 30mm*1 DFR0600

H2070mm x W838mm 6’9” x 2’9” 115mm x 30mm*1 DFR0620

Oak veneered MDF lining lengthsL2050mm 138mm x 30mm*1 DFR2140

L2070mm 115mm x 30mm*1 DFR2130

To fit door size up to To fit door size up to Nominal sizes of timber

height x width (mm) height x width (inches) after machining

Primed MDF door linings, trenchedH1981mm x W762mm 6’6” x 2’6” 115mm x 30mm F DFR2350

H1981mm x W762mm 6’6” x 2’6” 138mm x 30mm F DFR2360



Door linings, trenchedH1981mm x W610mm/686mm 6’6” x 2’0”/2’3” 108mm x 27.5mm UK F DFR0004

H1981mm x W610mm/686mm 6’6” x 2’0”/2’3” 132mm x 27.5mm UK F DFR0005



CLS Door linings, trenchedH1981mm x W762mm/838mm 6’6” x 2’6”/2’9” 120mm x 27.5mm UK P DFR0016

H1981mm x W762mm/838mm 6’6” x 2’6”/2’9” 94mm x 27.5mm UK P DFR0017

Door linings, untrenchedH2040mm x W926mm 108mm x 27.5mm UK P DFR2015

H2040mm x W926mm 132mm x 27.5mm UK P DFR2025

H2040mm x W926mm 145mm x 27.5mm UK P DFR2035

Lining lengthsL2040mm 108mm x 27.5mm DFR2110

L2040mm 132mm x 27.5mm DFR2120

F/C Certifire approved linings FD30, trenchedH1981mm x W762mm/838mm 6’6” x 2’6”/2’9” 108mm x 30mm UK F DFR3110

H1981mm x W762mm/838mm 6’6” x 2’6”/2’9” 132mm x 30mm UK F DFR3120

H2060mm x W826mm/926mm 108mm x 30mm UK P DFR3135

H2060mm x W826mm/926mm 132mm x 30mm UK P DFR3145

Door linings & casings


height x width (mm) height x width (inches) sizes* (mm) sizes* (inches)

132|

Door linings & casings

Door casings, trenched

H1981mm x W762mm 106mm x 33mm UK F DFR0030



Door casings, untrenched

H1981mm x W838mm 106mm x 33mm UK P DFR1015



F/C Certifire approved casings, FD30, untrenched




Door casingsCasings are used to hang internal doors. The head and jambs (sides) are rebated to form the door stops and

trenched casings are available pre-grooved for a quicker installation.

To fit door size up to Nominal sizes of timber

height x width (mm) after machining

Astro flame white 310ml FD30/FD60/FD120 FH ITS0020

Everbuild hand held B1 fire rated expanding foam 750ml FD30/FD60/FD120 FH GIR0088

4” Intumescent hinge pads (pack of 6) FH ITS0030

Intumescent paper pack FH ITS0050

Acoustic door seal pack FH GIR0400

Intumescent stripsIntumescent strips should be used in fire door applications.

Acoustic door sealConstant noise can be as disruptive as louder sounds. Our acoustic door seal pack increases the acoustic

performance of Part E compliant doors.

Intumescent and acoustic products

Intumescent accessories

(Can also be used as a smoke seal when a separate fire strip is fitted)

Fire and smoke strip Brown10mm x 4mm x L2.1m FD30 UK FH ITS0007

15mm x 4mm x L2.1m FD30 UK FH ITS0011

20mm x 4 mm x L2.1m FD30/FD60 UK FH ITS0013

Fire and smoke strip White



20mm x 4 mm x L2.1m FD30/FD60 UK FH ITS0014

Fire strip Brown

Fire strip White





|133

Joinery accessories

Fire check32mm x 25mm L2.1m UK F MOD0064

Metric32mm x 12mm L2.04m UK F MOD0067

Standard32mm x 25mm L2.1m UK F MOD0065

Square edged 45mm x 20mm L3m UK F MOD0406

Solid oak dowel plugs 12mm (bag of 10) UK MOD0060

Hardwood Lipping45mm x 8mm x L2.4m UK MOD0071

46mm x 18mm x L2.1m MOD0061

Hardwood hockey stick F/C beading26mm x 21mm x L2.1m MOD0062

Oak foil hockey stick F/C beading26mm x 21mm x L2.4m UK MOD0069

Ash veneer hockey stock F/C beading26mm x 21mm x L2.4m UK MOD0070

Weather barsOak 36” F DXE0002

Weather barsHardwood 36” DXE0001

Weather barsHemlock 36” UK DXT0900

Weather barsRedwood 36” UK DXC0900

Glazing panels

H1019mm x W599mm (to suit DXT0160) UK DGL0101

H1019mm x W675mm (to suit DXT0170) UK DGL0121

Joinery accessories

Door pair makersHowdens door pair makers are available in either oak veneer or pine and enable our internal doors to be used in

a double door configuration.

Door stops

Optional glazingSuitable for use with external softwood Hemlock 2XG/2XGG doors. Please refer to page 117.

Solid oak dowel plugs

Beading & lippingSuitable for use with firecheck doors

Weather bars

Oak1981mm x 35mm UK DFR0910

Pine1981mm x 35mm UK P DFR0930

134|

The rebated timber

forms the door stop

Trenched head

Loose door stop

Door lining Door casing

Stair parts

Howdens has a range of newel and spindle designs, all crafted in high quality pine or spruce or

engineered white oak. Our staircases, in Scandinavian whitewood with MDF treads and risers, are

manufactured to BS 585: 1989, and should be fitted following approved Document K. For quick and

simple fixing of stair parts please see our Slipfix connectors on page 235.

Going 223mm/225mm

13 Risers 9mm

Half newel post

12 Treads 22mm

Rise 200mm

Nosing 69mm x 22mm

Pitch line 42º

99mm max

Handrail

Newel post

Spindle

Baserail

Outer string 218mm (wide)

2676mm/2700mm

26

00

mm

Standard stairs with risers

Stair width 855mm/ 905mm

JoineryAn illustrated technical guide.

Door frames, linings and casings

Door linings come with a loose door stop which can be secured once the lining is installed in

the opening.

Door casings are rebated for the door stop.

Lining lengths which can be cut to fit any opening.

We offer casings and linings both assembled and unassembled. They have trenched or untrenched

heads which are reversible to accommodate different widths.


All stair parts can be painted, stained or varnished.

Joinery

Stair components, Balluster components and maximum spindle spacing in accordance with

approved document K.

|135

Intumescent strips & accessories

Intumescent strips

Intumescent strips should be used in fire door applications. Available in two types: intumescent only

and intumescent with smoke seal, in both brown and white. The 10mm and 15mm intumescent strips are

30 minute rated, the 20mm versions are 60 minute rated. All intumescent strips have Certifire approval

CF543, passed at BS 476 part 22 and 31.1, and have NHBC approval. All timber fire doors must be fire

stopped with intumescent strip. The key benefits of passive fire protection are:

Prevent the spread of fire, smoke and hot gases through a building by containing it in the

compartment of origin

Maintain the integrity of escape routes from a building

Reduce loss or damage to property from the effect of fire and smoke

Maintain pressure differential between compartments and ventilation channels

Fire strip

Our intumescent fire door strips are

for use where no smoke sealing is

required, fire only. In the event of a

fire the seal expands (intumesces)

to many times its original volume and

seals the gap around the door

to provide a safe and effective barrier

against the passage of fire.

Fire & smoke strip

Intumescent fire and smoke strips are

used as a safe and effective barrier

against fire, cold smoke and hot

gases. In the event of a fire the seal

expands (intumesces) to many times

its original volume and seals the gap

around the door to provide a safe

and effective barrier against the

passage of fire, smoke and hot gases.

Intumescent hinge pads

Our intumescent hinge pads suit most fire door

dimensions and can be easily cut to fit behind hinges.

Intumescent paper packs

Intumescent paper packs suit most fire door dimensions

and can be easily cut to fit behind hinges, door closers

and plates.

Joinery136|

Stair parts

Square spindles

Edwardian spindles

Oak spindles

Spindles

Stair parts

These stair parts are produced from the finest

quality timber.

For quick and simple fixing of stair parts please see our

Slipfix connectors on page 235.

Spindles can be painted or stained (see pages 243-244).

1 2 3 4 5 6 7 8

Redwood spindles

Primed spindles

Oak spindle

1

2

3

4

5

6

7

8

Victorian

32mm x 32mm x L900mm UK F SPN0240


Edwardian



Stop Chamfered



Square



Edwardian

32mm x 32mm x L900mm F SPN0248


Square



Stop Chamfered

41mm x 41mm UK SPN0030

Stop Chamfered



|137

Stair parts

1 2 3 4 5 6 7 8

9 10 11 12 13 14

Edwardian full

92mm x 92mm x L1413mm UK F NWL0011

Edwardian half

Square full with cap

Square half with cap


90mm x 90mm x L1500mm UK NWL0041


Stop Chamfered full


Stop Chamfered half




Square full with cap

Square half with cap

Edwardian full

91mm x 91mm x L1490mm F NWL0086

Edwardian half


Square full


Square half


Stop Chamfered full


Stop Chamfered half


Redwood newel posts

Newel posts

Primed newel posts

Oak newel posts

1

2

3

4

5

6

7

8

9

10

11

12

13

14

Newel post with ball newel cap

Square newel post with cap

Stop Chamfered spindles

138|

Stair parts

Newel caps

Redwood newel caps

Oak newel caps

Primed newel caps

1 2 3 4 5 6

7 8 9 10

1 Ball full

90mm x L150mm UK F NWL0015

2 Ball half

45mm x L150mm UK F NWL0016

3 Pine pattrice full

110mm x 110mm UK NWL0022

4 Pine pattrice half


5 Square full oak veneer


6 Square half oak veneer


Ball full

86mm x 150mm F NWL0088

7

Ball half


8

Square full

110mm x 110mm F NWL0093

9

Square half


10

Rails

Redwood rails

Handrail (with fillet)

L2.4m with 41mm groove UK F SRA0202




Baserail (with fillet)





Primed ball newel cap

Baserail

Pine pattrice newel cap

|139

Stair parts

Laminated mopstick handrailL4.2m UK F SRA0250

Pigs ear handrailL4.2m UK F MOD0209

Staircase

855mm (2’10” wide) UK STA0011

Staircase

915mm (3’0” wide Scotland) UK STA0020

Rails

Staircases

Standard staircases available in Scandinavian whitewood

with MDF treads and risers ready for finishing on-site.

The Howdens staircase is manufactured to BS 585 1989.

Please see page 233 for handrail brackets.

Please see page 135 for further details on our staircases.

Handrail (with fillet)L4.2 with 41mm groove F SRA0260

L4.2 with 32mm groove F SRA0262

Baserail (with fillet)L4.2 with 41mm groove F SRA0261

L4.2 with 32mm groove F SRA0263

Handrail (with fillet)L3.9m with 41mm groove UK SRA0004

Baserail (with fillet)L3.9m with 41mm groove UK SRA0005

Oak rails


Primed rails


Laminated mop stick handrail with Brass handrail brackets

Pigs ear handrail

Staircase

140|

Mouldings

Pencil Round architrave and skirting

Quadrant moulding

Angle moulding

Decorative mouldings

Mouldings

The Howdens range includes a number of moulding

options to suit your individual requirements. MDF

mouldings are available either primed or with an oak

veneer, and timber mouldings are manufactured from

high-grade scandinavian redwood.

Quadrant12mm x 12mm x L2.4m UK P MOD0081

18mm x 18mm x L2.4m UK P MOD0082


Scotia21mm x 21mm x L2.4m UK P MOD0711

Angle

Dowel

PSE

D-Section



9mm x 9mm x L2.4m P MOD0713





Primed MDF mouldings

Primed and ready for painting

Chamfered architrave

45mm x 15mm x L4.2m UK F MOD0806

Chamfered skirting96mm x 15mm x L4.2m UK F MOD0801

Pencil Round architrave45mm x 14.5mm x L4.2m UK F MOD0811

69mm x 14.5mm x L4.2m UK F MOD0815

Pencil Round skirting96mm x 14.5mm x L4.2m UK F MOD0810


|141

Mouldings

Torus architrave70mm x 18mm x L4.2m UK F MOD0808

Torus skirting120mm x 18mm x L4.2m UK F MOD0802



Burford Traditional architrave70mm x 14.5mm x L4.2m UK F MOD0835

Burford Traditional skirting120mm x 15mm x L4.2m UK F MOD0834


Burford Contemporary architrave70mm x 15mm x L4.2m UK F MOD0837

Burford Contemporary skirting120mm x 15mm x L4.2m UK F MOD0836


Square architrave44mm x 14.5mm x L4.2m UK F MOD0821

Square skirting96mm x 14.5mm x L4.2m UK F MOD0820

Newbridge architrave70mm x 18mm x L4.2m UK F MOD0839

Newbridge skirting120mm x 14.5mm x L4.2m UK F MOD0838

Window board25mm x 295mm x L2.7m UK F MOD0814

Ogee architrave70mm x 18mm x L4.2m UK F MOD0807

Ogee skirting120mm x 18mm x L4.2m UK F MOD0804



Torus architrave and skirting

Burford Traditional architrave and skirting

Square architrave and skirting

142|

Pencil Round architrave70mm x 15mm x L4.2m MOD0603

Pencil Round skirting120mm x 15mm x L4.2m MOD0602

Ogee architrave70mm x 18mm x L4.2m MOD0601

Ogee skirting120mm x 18mm x L4.2m MOD0600

Burford Traditional architrave70mm x 15mm x L4.2m MOD0531

Burford Traditional skirting120mm x 15mm x L4.2m MOD0530

Burford Contemporary architrave70mm x 15mm x L4.2m MOD0533

Burford Contemporary skirting120mm x 15mm x L4.2m MOD0532

MDF Tongue and Groove panel

Primed Shaker Wall panelling

509mm x 915mm x 6mm UK F MOD2100



Oak veneered MDF mouldings

Can be stained or varnished (see pages 243-244)

Wall panelling

Can be painted, stained or varnished (see pages 243-244)

Mouldings

Ogee architrave

Burford Traditional architrave

MDF Tongue and Groove wall panelling

|143

Flooring

We offer a variety of flooring to suit

every style and budget, from solid

oak and laminate flooring to natural

stone effect laminate tiles.

Our range includes a choice of

colours, such as oak, bamboo,

American pecan and walnut, as well

as different finishes, from timber

effect to limestone and slate.

Our selection provides products

suitable for a wide range of

applications throughout the home

and in commercial properties.

Howdens also supplies a variety

of flooring accessories for a

professionally fitted floor, including

underlay, damp proof membrane,

flooring spacers,

colour-matched scotias, pipe rose

and floor profiles.

For more details on all our flooring

and flooring accessories, please visit

www.howdens.com/flooring-collection

Flooring144|

Consider the size and shape of your room as well as lighting. Light floors will give you a greater feeling of

space and can brighten smaller spaces, whilst darker tones create warmth. Think about the needs of your

floor; is it likely to get wet or damp? Do you need underfloor heating? Do you prefer the look of wood or tiles?

Choose a style that suits your needs

Choosing the right floor for your home

Choose a suitable floor for your room

Different rooms in your home will have different levels of traffic on a daily basis. To get the most from your

floor, you will want to choose a floor that is suitable for the level of traffic. 2

1 Consider the size and shape of your room as well as lighting. Light floors will give you a greater feeling of





2

1 Consider the size and shape of your room as well as lighting. Light floors will give you a greater feeling of





Choose a suitable floor for your room

2

1

Suitability Key:

A Howdens Solid wood H

Howdens Professional Fast Fit V Groove tile

B Howdens Real wood (Engineered) I

Howdens Professional Random Effect tile

C Howdens Professional Click Fit Vinyl J

Howdens Professional Fast Fit tile

D Howdens Professional Fast Fit V Groove K

Howdens Decorative

E Howdens Professional L

Quick-Step Impressive Laminate

F Howdens

M Quick-Step Livyn Vinyl

G Howdens Professional Continuous tile

Flooring

A

A B

F

F H

B

B D

G

G

J

I

E

C

C E

C

H

H

H J

F

D

D F

D

I

I

I

G

E

E G

J

A

A B

F

F H

B

B D

G

G

J

I

E

C

C E

C

H

H

H J

L L

L

L

K

K

K

K

F

D

D F

D

I

I

I

G

E

E G

J

A

F

B

G

J

C

H

K L

M M

D

I

E

A

F

B

G

J

C

H

LK

D

I

E

M

M

M

M

A

F

B

G

J

C

H

LK

D

I

E

|145

AC4 and AC5 laminates can be used for domestic use, however please be aware that as the ranking increases the roughness of the flooring also increases.

The AC Rating tests the durability levels of laminate flooring

Suitable for heavy domestic/light commercial use.

Laminate flooring classification - Abrasion Classification (AC) Rating

Suitable for medium commercial use.

Suitable for medium to heavy commercial use.AC3 AC5

AC4

Aqua Block specifications

The Aqua Block logo indicates that when joints are sealed using flooring joint sealer (SDH0099), laminate flooring with Aqua Block becomes suitable for use in bathrooms and other areas prone to high moisture levels (excluding wet rooms).

Flooring specificationsPlease see below for flooring specifications, providing an essential guide on how to buy flooring specific to your needs.

V groove Planks have micro to deep bevelled edges to create a V groove.

Square profile Square profiled planks create a seamless look.

Continuous pattern Gives the appearance of a natural stone or slate floor with seamless joins.

Random pattern Offers a realistic slate finish.

Suitable for use with underfloor heating See fitting instructions for maximum temperature.

Characteristics of Howdens flooring

3Choose the right underlay

4 in 1 foil back underlay

This 4 in 1 underlay combines a foil backed foam for excellent thermal insulation properties, a damp proof

membrane. Suitable for use with Solid and Real wood.

Foam underlay

This foam underlay has excellent thermal insulation properties, as well as being easy to fit. Suitable for use

with Solid and Real wood.

High performance underlay (XPS)This underlay has many benefits including excellent levelling properties, compression strength and impact.

Suitable for use with Solid and Real wood.

SELITBLOC vinyl underlayThis foam underlay has many benefits including excellent thermal insulation properties, as well as being

able to help with sound reduction. Suitable for use with vinyl.

Damp proof membraneThis underlay has many benefits including excellent levelling properties, compression strength and impact.

Suitable for use with Solid, Real wood and laminate on concrete based sub-floors only.

Paintable damp proof membraneThis underlay has many benefits including excellent levelling properties, compression strength and impact.

Suitable for use with Solid, Real wood and laminate on concrete based sub-floors only.

Bitumen moisture barrier paperThis paper forms a protective barrier to help prevent moisture getting through to the flooring. Suitable for

use with Solid wood when nailing it down to a timber sub-floor.

AC3 AC5

AC4

Micro bevel Planks have shallow bevelled edges to create a seamless look.

Fully restorable Flooring can be restored to capture the finish and performance of the product when first installed. Real wood flooring can be re-finished up to 3 times.

Flooring146|

W120mm x D15mm 1.29m/sq UK P SDH2201

W120mm x D14mm 1.76m/sq F SDH2203

W150mm x D15mm 1.71m/sq UK P SDH2202


The natural beauty of oak is available in solid bevelled

planks. Benefits include greater sound absorption over

laminate flooring and warmth underfoot, varying lengths

create a traditional look. Solid Oak flooring is oiled

to give a smooth finish. Solid wood floors may contain

knots, shakes and natural colour and grain variation.

Dead knots are filled with brown filler to ensure a

smooth floor finish.

Howdens Solid Wood Pre-finished

Pre-finished Solid Oiled Oak

15 Yearguarantee

15Squareprofile

Fullyrestorable

Strand woven bamboo is a great alternative to traditional

oak. This flooring is both stylish and warm, which makes

it a striking feature in any room. Bamboo is hardwearing

and environmentally friendly. This flooring has a matt

lacquered finish.

Howdens Solid Wood Fast Fit

Pre-finished Solid Bamboo

25 Yearstructural guarantee

255 Year

finish & wear guarantee

5V groove Fully

restorable

SDH2300

Panel size: 1.85m x 125mm x 14mm

Pack size: 1.39m/sq

AFor room suitability

please see page 145

AFor room suitability

please see page 145

W120mm x D14mm 1.786m/sq SDH3071


Pre-finished Solid Oak Glossy

Flooring

Howdens Pre-Finished Solid Oiled Oak

Howdens Pre-Finished Solid Oak Glossy

Howdens Pre-Finished Fast Fit Solid Bamboo

|147

SDH3638

Light White Oak single plank wide


Pack size: 2.38m/sq

P SDH3630

Oak single plank wide


Pack size: 2.38m/sq

15 Yearguarantee

15Micro Bevel

SDH3612

Oak single plank


Pack size: 2m/sq

20 Yearguarantee

20

The elegant look of Real wood (engineered) flooring can

add warmth and character to any room in the home. Our

range of Real wood flooring is available in three different

profiles; square, micro bevel and V groove. Real wood

floors contain knots and natural colour variations. Dead

knots are filled with a brown filler to ensure a smooth

finish.

Howdens Real Wood Pre-finished Fast Fit

For room suitability

please see page 145

B

15 Yearguarantee

15

V groove Fullyrestorable

Suitable foruse with

underfloorheating

Flooring

Howdens Real Wood Light White Oak Single Plank

Howdens Real Wood Pre-Finished Oak 3 Strip

Howdens Real Wood Pre-Finished Oak Single Plank Wide

148|

SDH3636

Light Grey Oak single plank wide


Pack size: 2.77m/sq

SDH3635

Light Grey Oak 3 strip


Pack size: 3.18m/sq

SDH3637

Dark Oak single plank wide


Pack size: 2.38m/sq

P SDH3631

Chestnut Oak single plank wide


Pack size: 2.38m/sq

15 Yearguarantee

15Micro Bevel

15 Yearguarantee

15

15 Yearguarantee

15Squareprofile

15 Yearguarantee

15

F SDH3220

Oak 3 strip


Pack size: 3.18m/sq

20 Yearguarantee

20Squareprofile

Flooring

Howdens Real Wood Light Grey Oak single plank NEW

Howdens Real Wood Chestnut Oak single plank

Howdens Real Wood Dark Oak single plank NEW

|149

SDH3689

Canyon Oak Beige

Panel size: 1.25m x 187mm x 4.5mm

Pack size: 2.105m/sq

This flooring comes with a range of benefits, such as,

scratch and stain guard technology for easy maintenance,

water resistant qualities and is compatible with underfloor

heating*. Quick-Step Livyn also has a click fit system

which reduces fitting time

SDH3685

Light Oak Natural



SDH3683

Vintage Chestnut Natural



SDH3680

Classic Oak Natural



Quick-Step Livyn Vinyl

Aqua Block AC rating

AC4

MFor room suitability

please see page 145

20 Year finish & wear

guarantee

2010 Yearmedium

commercialguarantee

10Squareprofile


underfloorheating

*Refer to fitting instructions for details

Flooring

Quick-Step Livyn Canyon Oak Beige

Quick-Step Livyn Light Oak Natural

Quick-Step Livyn Vintage Chestnut Natural

150|

Quick-Step Livyn Canyon Oak Grey

Quick-Step Livyn Silk Oak Dark Grey

Quick-Step Livyn Cottage Oak Dark Brown

Flooring

SDH3681

Canyon Oak Grey



SDH3682

Silk Oak Dark Grey



SDH3684

Cottage Oak Dark Brown



Scratch guard technology -‘Scratch Guard’ layer ensures

superior resistance to scratches.

Stain guard technology - Quick-Step Livyn has a fully

sealed top layer with stain guard technology, offering

protection against stains and dirt.

Water resistant - Can be fitted in bathrooms and kitchen

(not wet rooms).

Installed as a floating floor - Ensuring a faster fit time.

Clickfit system - Easy fast fitting.

Compatible with underfloor heating*.

Benefits of Quick-Step Livyn

*Refer to fitting instructions for details

|151

SDH3688

Light Grey Travertine


Pack size: 2.08m/sq

SDH3686

Black Slate


Pack size: 2.08m/sq

SDH3687

Cream Travertine


Pack size: 2.08m/sq

As with the Quick-Step Livyn vinyl planks, these tiles come

with a range of benefits, such as, scratch and stain guard

technology for easy maintenance, water resistant qualities

and is compatible with underfloor heating. Quick-Step

Livyn also has a click fit system which reduces fitting time.

Quick-Step Livyn Vinyl tile


AC4

MFor room suitability

please see page 145


guarantee

2010 Yearmedium

commercialguarantee

10Squareprofile


underfloorheating

Flooring

Quick-Step Livyn Cream Travertine Tile

Quick-Step Livyn Light Grey Travertine Tile

Quick-Step Livyn Black Slate Tile

152|

SDH3641

Oak


Pack size: 1.76m/sq

SDH3640

Light Oak


Pack size: 1.76m/sq

SDH3643

Light


Pack size: 1.49m/sq

Get the natural look of wood or stone flooring with our

range of vinyl flooring. A textured finish on selected vinyl

flooring allows you to see and feel the grains and grooves

just like real wood.

Howdens Professional Click Fit Vinyl

20 Yearresidentialguarantee

2010 Yearmedium

commercialguarantee

10


please see page 145

CSquareprofile


underfloorheating

Flooring

Howdens Professional Click Fit Vinyl Oak plank

Howdens Professional Click Fit Vinyl Light tile

Howdens Professional Click Fit Vinyl Light Oak plank

|153

SDH2401

Grey Oak



Our Quick-Step Impressive laminate range adds an

element of style to your home. It’s laminate finish with

scratch-resistant coating ensures it is warm underfoot

and easy to maintain. You can easily cover your stairs with

Quick-Step Laminate using the Quick-Step Incizo profile.

The only condition is that the steps of your staircase must

be straight and not rounded.

Quick-Step Impressive

SDH2402

Oak



LFor room suitability

please see page 145

25 Yearstructural guarantee

25

Incizos are multi-purpose finishing strips which can be

easily trimmed using the cutting tool included to create

threshold strips, ramp strips or edge trims.

Colour matched to Quick-Step Impressive Grey Oak and

Oak laminate.

Length – 2.15m

Quick-Step Incizo Benefits

V groove Suitable foruse with

underfloorheating


AC4

Quick-Step Impressive Grey Oak NEW

Quick-Step Impressive Oak NEW

Quick-Step Incizo

Flooring154|

F SDH3583

Tawny Chestnut Oak


Pack size: 2.22m/sq

Available in textured and registered embossed finishes,

this premium laminate flooring has the natural, authentic

look of real wood, enhanced by a four sided V groove. The

quick fit, push down laminate flooring system increases fit

speed by up to 30%. The flooring can be laid one piece at

a time rather than row by row.

Howdens Professional Fast Fit V Groove


guarantee

205 Year

medium commercial guarantee

5V groove Suitable for

use withunderfloor

heating

AC rating

AC4

Aqua Block


please see page 145

D

P SDH3592

Light Oak


Pack size: 2.22m/sq

F SDH3576

Oak


Pack size: 2.22m/sq

Howdens Professional Fast Fit V Groove Tawny Chestnut Oak

Howdens Professional Fast Fit V Groove Light Oak

Howdens Professional Fast Fit V Groove Oak

Flooring |155

F SDH3577

American Pecan


Pack size: 2.22m/sq

UK F SDH3575

P SDH3590

Hickory

White Washed Oak


Pack size: 2.22m/sq


Pack size: 2.22m/sq

SDH3578

Light Grey Oak


Pack size: 2.22m/sq

SDH3582

Dark Grey Oak


Pack size: 2.22m/sq

Howdens Professional Fast Fit V Groove White Washed Oak

Howdens Professional Fast Fit V Groove Dark Grey Oak

Howdens Professional Fast Fit V Groove American Pecan

Flooring156|

SDH3581

Rustic Chestnut Oak


Pack size: 2.22m/sq

UK F SDH3584

Smoky Hickory


Pack size: 2.22m/sq

P SDH3591

P SDH3595

P SDH3596

Grey Oak

Dark Oak

Black Oak


Pack size: 2.22m/sq


Pack size: 2.22m/sq


Pack size: 1.99m/sq

Howdens Professional Fast Fit V Groove Grey Oak

Howdens Professional Fast Fit V Groove Smoky Hickory

Howdens Professional Fast Fit V Groove Rustic

Chestnut Oak

Flooring |157

With a textured finish, the elegant wood tones of this two

strip laminate flooring can be used to create a modern or

classic look in a variety of settings.

Howdens Professional

Squareprofile


underfloorheating

AC rating

AC4

Aqua Block


please see page 145

E

F SDH3722

Grey Oak


Pack size: 2.22m/sq

F SDH3573

Light Oak


Pack size: 2.22m/sq

SDH3588

Light Grey Oak


Pack size: 2m/sq


guarantee

205 Yearlight

commercial guarantee

5

Howdens Professional Grey Oak

Howdens Professional Light Grey Oak

Howdens Professional Light Oak

Flooring158|


Pack size: 2.22m/sq

F SDH3574

Dark Grey Oak


Pack size: 2.22m/sq

F SDH3720

Rustic Hickory


Pack size: 2.22m/sq

F SDH3572

Oak


Pack size: 2.22m/sq

F SDH3570

F SDH3721

Walnut

Dark Brown Oak


Pack size: 2.22m/sq

Howdens Professional Walnut Laminate

Howdens Professional Oak

Howdens Professional Rustic Hickory

Flooring |159

P SDH2094

Oak


Pack size: 2.73m/sq

SDH2098

3 Strip Oak


Pack size: 3m/sq

P SDH2093

Light Oak


Pack size: 2.73m/sq

P SDH3587

3 Strip Grey Oak


Pack size: 2.73m/sq

P SDH2112

3 Strip White Washed Oak


Pack size: 2.73m/sq

Howdens laminate flooring has a smooth finish and is

suitable for most areas in the home, except bathrooms.

Howdens

Squareprofile


underfloorheating

AC rating

AC3 F

7 Yearfinish & wear

guarantee

7

7 Yearfinish & wear

guarantee

7

7 Yearfinish & wear

guarantee

7


guarantee

10


guarantee

10


please see page 145

Howdens Oak

Howdens Light Oak


Flooring160|

P SDH2082

Natural Stone

Tile size: 1.18m x 395mm x 8mm

Pack size: 2.32m/sq

P SDH2083

Limestone


Pack size: 2.32m/sq

P SDH2088

Light Stone


Pack size: 2.32m/sq

P SDH2084

Black Slate


Pack size: 2.32m/sq

The registered embossed finish is designed to give the

appearance of a natural stone or slate floor. The joins in

this laminate tile are almost seamless, resulting in a floor

that looks very natural.

Howdens Professional Continuous tile

30 Yearfinish & wear

guarantee

305 Year

medium to heavy commercial guarantee

5Continuous

patternSuitable for

use withunderfloor

heating

AC rating

AC5

Aqua Block

GFor room suitability

please see page 145

Howdens Professional Continuous Light Stone tile

Howdens Professional Continuous Black Slate tile

Howdens Professional Continuous Natural Stone tile

Flooring |161

P SDH3668

Light Travertine


Pack size: 2.52m/sq

P SDH3586

Marble


Pack size: 2.53m/sq

SDH3598

White Slate


Pack size: 2.52m/sq

SDH3599

Concrete


Pack size: 2.52m/sq

This product is ideal for kitchens, giving warmth underfoot

with practicality and easy maintenance. The quick fit,

push down laminate flooring system increases fit speed

by up to 30%.

Howdens Professional Fast Fit V Groove

tile


guarantee

205 Year


5V groove 2 Tile Suitable for

use withunderfloor

heating

AC rating

AC4

Aqua Block

HFor room suitability

please see page 145

P SDH3585

Grey Slate


Pack size: 2.53m/sq

Howdens Professional Fast Fit V Groove White Slate tile

Howdens Professional Fast Fit V Groove Concrete tile

Howdens Professional Fast Fit V Groove Grey Slate tile

Flooring162|

Our chevron laminate flooring combines this stylish

French chateaux look with convenience and affordability

to provide a great alternative to solid wood. It is suitable

for kitchens, living areas and conservatories and the quick

fit glueless system makes it easier to fit.

P SDH2075

Oak Chevron

Tile size: 1.18m x 239.4mm x 8mm

Pack size: 2.08m/sq

SDH3600

Midnight Slate


Pack size: 2.53m/sq

SDH3670

SDH3601

P SDH2076

Basalt Slate tile

Grey Stone

Grey Chevron


Pack size: 2.52m/sq


Pack size: 2.53m/sq

Tile size: 1.18m x 239.4mm x 8mm

Pack size: 2.08m/sq

Decorative tiles

30 Yearfinish & wear

guarantee

305 Year


5Suitable for

use withunderfloor

heating

Aqua Block

KFor room suitability

please see page 145

Howdens Professional Oak Chevron tile

Howdens Professional Grey Chevron tile

Howdens Professional Fast Fit V Groove Basalt Slate tile

Flooring |163

P SDH3652

Slate


Pack size: 2.53m/sq

F SDH2089

Slate


Pack size: 2.5m/sq

This random effect tile is textured and offers a realistic

slate finish, which is suitable for a variety of locations in

your property.

Howdens Professional Random Effect tile


guarantee

205 Year


5Squareprofile

Randompattern


underfloorheating

AC rating

AC4

Aqua Block

This fast fit tile is quick to fit, offering a realistic slate

finish throughout your home.

Howdens Professional Fast Fit tile


guarantee

205 Year


5Squareprofile

Randompattern


underfloorheating

AC rating

AC4

Aqua Block

I

J


please see page 145


please see page 145Howdens Professional Random Effect Slate tile

Howdens Professional Fast Fit Slate tile

Howdens Professional Random Effect Slate tile

Flooring164|

4 in 1 foil backed underlay

1m x 10m x 3mm SDH0915

Foam underlay

1m x 15m x 2mm UK SDH0900

High performance underlay (XPS)

1m x 600mm x 5mm UK SDH0909

SelitBloc® Vinyl underlay

1.18m x 8.5m x 1.5mm SDH0926

Damp proof membrane

3m x 4m x 0.2mm UK SDH0910

Paintable damp proof membrane

5 Litres UK SDH0931

Bitumen moisture barrier paper

1m x 25m UK SDH0932

Bitumen moisture barrier paper tape

45m x 75mm UK GAR0410

Underlay

Moisture barriers

Flooring accessories

Howdens supplies a variety of flooring accessories for a professionally fitted floor. The right underlay is essential

for use with floating floors. It provides thermal insulation and reduces the transmission of sound. A damp proof

membrane can be used on stone or concrete based sub-floors before laying the underlay. Use flooring spacers

around the edge of the floor to allow a gap for expansion and contraction, colour-matched scotias can then be

used to cover the gaps left around the edge.

Quick-Step accessories

Hydro Foam sealant Hydro Foam kit Incizo

310ml SDH0088 20m x 10mm SDH0089 Oak L2.15m SDH2410

Grey L2.15m SDH2411

Flooring accessories |165

Chamfered

900mm x 140mm x 18mm UK SDH0959

Square profile

900mm x 140mm x 18mm UK SDH0958

Hardwood threshold strips

Howdens Joinery hardwood threshold strips are available in either a chamfered or square profile.

They are ideal for replacing thresholds and supplied unfinished, allowing them to be painted or varnished to

exact requirements.

Flooring accessories

Ramp strip Threshold stripWhite scotia

L2.4m P SDH0961

L2.4m UK P MOD0711

Sold by range Pages 272-275Sold by range Pages 272-275

Solid Oak L section

L970mm F SDH3041

Chrome pipe rose

Pack of 4 SDH0895

White pipe rose

Pack of 4 UK SDH0896

Profile A - L2.7m x W32mm

Laminate to laminate,

aluminium SDH0940

Profile B - L2.7m x W38mm

Laminate to carpet,

aluminium SDH0942

Profile F - L2.7m x W30mm

Edge profile for flooring

7mm to 9mm, aluminium SDH0945

Clear edge T-Bar SDH4120

Redwood scotia

Floor profiles

For complete installation, Howdens offers a range of aluminium and hardwood floor profiles in addition to a

range of colour matched accessories. For more information please refer to product ranges on pages 272-276

166|

Sealants

310ml Beech Sold by range

Flooring joint sealer

125ml SDH0099

Wood floor adhesive

13kg tub SDH3176

Lumberjack adhesive applicator gun

SDH3182

Laminate flooring fitting kit

UK SDH0970

Flooring adhesive trowel

SDH0912

Heavy duty pull bar SDH9011 Knocking block Vinyl floor roller UK SDH9010 NEW SDH9013

Flooring care kit SDH0715 Oil refresher SDH9020 Combi-cleaner SDH9021

Lumberjack adhesive pack for gun

12 x 600ml cartridges UK SDH3181

Laminate flooring spacers

Pack of 20 SDH0980

Sealants & adhesives

Flooring tools

Flooring aftercare

Flooring accessories |167

Flooring care and maintenance guide

Cleaning and care

Stain & treatment tips

Care and regular maintenance will ensure flooring lasts for

many years. Below are some helpful tips to maintain flooring:

Fruit, berries, juice, milk, cream, soft drink, beer, wine,

tea, coffee, urine - Mild cleaning agent

Rubber, tar, ink, asphalt, lipstick - White spirit or

acetone (wipe with a damp cloth)

Chocolate, shoe polish, oil, grease - Methylated spirits

(wipe with a damp cloth)

Blood - Cold water

Use a soft brush or vacuum cleaner to remove any

surface dust

For regular cleaning use a cloth or mop, ensuring it is

well wrung. It is important not to apply excess moisture

to the floor

We recommend the use of felt pads under furniture to

protect the floor. Moveable furniture/chairs should be on

soft castors or placed on a plastic mat

Door mats should be used inside and outside all

external doorways to prevent grit from being carried

across floor, protecting surfaces from excessive wear

and tear

The flooring care kit can be used to disguise minor

scratches and dents to floors and other areas subjected

to high levels of wear and tear. Suitable for use with

Solid timber, Real wood (Engineered) and wood effect

laminate flooring

Do not use steam mops or cleaners

Do not use abrasive cleaners, steel wool or scouring

pads, as they will damage your floor

Restoring Solid & Real wood floors

Over time, the surface of Solid and Real wood flooring will wear.

When this happens, flooring can be restored in order to capture

the finish and performance of the product when first installed.

We recommend that Real wood flooring is not re-finished more

than three times.

Refinishing guidelines

1. Surface preparation

Remove the existing layer of lacquer/oil with a disk

sander, extract and clear any dust.

2. Finishing

Finish with suitable flooring lacquer/oil. Always follow

the lacquer/oil manufacturer’s instructions. We recommend

testing the finish on a hidden area or off cut, before applying

to the full floor.

Flooring care & maintenance168|

Solid Bamboo flooring

Our strand woven carbonised Bamboo flooring, is resistant to stains, offers a 25 year structural

guarantee and 5 year finish and wear guarantee. Solid Bamboo boards are a quick fit, drop and

lock fast fit system, this increases fit speed by 30%, compared to traditional tongue and groove

profile flooring.

Not suitable for use with underfloor heating.

Recommended fitting method for concrete sub-floors - glue down

Click joint

Recommended fitting method for timber sub-floors - secret nail

Secret

45º nailTongue &

Groove joint

Bitumen moisture

barrier paper & tape

Sub-floor

Tongue &

Groove joint

Paintable damp proof

membrane & flooring

adhesive

Sub-floor

Flooring underlay is essential for use with a floating floor. It provides a cushion for the flooring to sit

on, and will provide thermal insulation and reduce the emission and transmission of sound.

All underlay can be found on page 165.

Real wood (engineered) floors are popular due to their resistance to expansion and contraction from

temperature change and moisture, and also their adaptability. Engineered wood is produced using

oak veneer layers with each layer oriented in different directions for strength. The top layer can be sanded

and re-laquered up to 3 times. The Chestnut Oak flooring will need to be re-stained with a tinted lacquer,

once sanded back to maintain colour. Subject to fitting instructions, Real wood flooring can be used in

conjunction with underfloor heating.

Real wood flooring

Recommended fitting method for timber or concrete sub-floors - floating

Click joint

Bitumen moisture

barrier paper or

damp proof membrane

Sub-floor

Timber substrate

Foam underlay or

high performance underlay

2.5mm Oak veneer

Foam, high performance

or 4 in 1 underlay

Bitumen moisture

barrier or damp

proof membrane

Sub-floor

FlooringAn illustrated technical guide

Solid Oiled Oak flooring

For those who demand a high quality, natural product, our Solid Oiled Oak flooring is the

perfect choice.

Manufactured from A/B/C rustic grade timber, it is UV oiled and comes with a 15 year guarantee

against any manufacturing defects. Solid Oak boards can be: secret nailed to timber sub-floors

(see diagram below); or glued with a suitable adhesive to solid, dry, flat screeded or concrete

sub-floors. This flooring is fully restorable and will last for many years.

Not suitable for use with underfloor heating.

Flooring

454545 nanann illl GroGroGroGroGrooveoveov

G oG oG oG o eo eo eoo e jjj

|169

Aqua Block

On selected ranges, our Aqua Block specification makes Howdens flooring suitable for bathrooms and

other areas prone to high moisture levels (excluding wet rooms), if the joints are sealed using flooring

joint sealer. Standing water should not be left on any laminate flooring. When cleaning laminate flooring,

always ensure that where a mop is used, it is well wrung out.

The right underlay and sub-floor preparationFlooring underlay is essential for use with a floating floor. It provides a cushion for the flooring to sit on and will provide thermal insulation and reduce the emission and transmission of sound.

Foam underlay

Popular because it is easy to fit, it also has an excellent thermal insulation. Foam underlay can be used in conjunction with a damp proof membrane, paintable damp proof membrane or Bitumen moisture barrier paper. Sheets must be joined together using multi-purpose tape.

High performance underlay (XPS) This underlay has many benefits including excellent levelling properties, compression strength and impact noise reduction. It is also lightweight and easy to handle. It can be used in conjunction with damp proof membrane, paintable damp proof membrane or Bitumen moisture barrier paper.

4 in 1 foil backed underlay

This 4 in 1 underlay combines a foil backed foam for excellent thermal insulation properties, a damp proof membrane and tape, removing the need for any additional products. Easy to fit and suitable for use on concrete sub-floors.

Damp proof membrane

It can be used on mineral based sub-floors. Details of where and how to use damp proof membrane can be found in the relevant flooring installation guidelines. Use in conjunction with multi-purpose tape.

Bitumen moisture barrier paper Required when fitting flooring on a timber based sub-floor. Use in conjunction with Bitumen moisture barrier paper tape (GAR0410).

Paintable damp proof membrane – SDH0931

Is suitable for use with Howdens flooring on cement based sub-floors. Paintable damp proof membrane is used as a moisture barrier on sub-floors when damp proof membrane (SDH0910) is not suitable.

Standard click system Fast Fit click systemClick joint

Bitumen moisture

barrier paper or

damp proof membrane

Apply flooring joint sealer

along all edges of planks

when laying

Sub-floor

Foam, high

performance or

4 in 1 underlay

Sub-floor

Laminate flooring

Howdens quality laminate flooring has a tried and tested locking system for fast, secure installation.

It features a HDF core and edge sealing which ensures the absolute minimum amount of moisture is

absorbed. The quick fit, push down laminate fast fit system that features on our Fast Fit products increases

fit speed by up to 30%. The flooring can be laid one piece at a time rather than row by row. All of our

laminate flooring is suitable for use with underfloor heating up to a maximum temperature of 27°.

Flooring

SS flfl SubSubSubS bSubbb-flo-floflo-flofl orororo

170|

Hardware

Door furniture, security products

and fixings are ranges where it

is important to have the widest

possible choice, and Howdens has

all the options you need to complete

your projects.

Everything we supply is designed

and manufactured to the highest

standards. All our hardware products,

where appropriate, meet British

Standards, building regulations

and insurance requirements for

both domestic and commercial

applications.

From essentials such as hinges and

screws to finishing touches such as

door stops and draught excluders,

we have fixings for every job.

We also supply a complete range of

sealants, adhesives, varnishes and

finishes, as well as a range of tools

and other hardware accessories.

Hardware

Fire Regulations:




|171

Choosing the right handle

Latch handlesAre for internal use and usually mounted on a backplate. They are used

in conjunction with a tubular mortice latch. Suitable for use with doors

that are of 35-44mm thickness.

Bathroom handlesAre used in conjunction with a bathroom mortice sashlock. All

Howdens bathroom handles have a thumbturn on the inside of the

door and a release slot on the outside of the door for unlocking in an

emergency, this complies with building regulations for bathroom locks

in commercial applications. Suitable for use with doors that are of 35-

44mm thickness.

Privacy handlesAre used on bathroom doors and in conjunction with a tubular mortice

latch. On the inside of the door there is a thumbturn and on the outside

of the door there is a release slot which can be used to unlock the door

in an emergency. Suitable for use with doors that are

of 35-44mm thickness.

Lock handlesHave a keyhole cut for use where a lock is required and are used in

conjunction with mortice sashlocks. Suitable for use with doors that are

of 35-54mm thickness.

Choosing the right handle172|

Choosing the right handle

Rose handlesAn alternative to a latch handle, rose handles are mounted on a

small round or square backplate. Rose handles can be fitted on their

own with a tubular mortice latch or with a matching bathroom turn or

escutcheon. Suitable for use with doors that are 35-54mm thickness.

Euro/Oval profile handlesAre used mainly in commercial settings. They have an enlarged euro

or oval profile keyhole shape cut out of the backplate which is used

to house a key operated cylinder. They are used in conjunction with a

cylinder lock.

Disabled access handleAre used on bathroom doors. On the inside of the door there is a lever

and on the outside of the door there is a release slot which can be

used to unlock the door in an emergency. Suitable for use with doors

that are of 40-54mm thickness.

Mortice knob handlesMortice knobs are mounted on a round backplate and usually fitted in

conjunction with a tubular mortice latch. These can also be paired with

a bathroom turn or escutcheon. Suitable for use with doors that are

35-44mm thickness.

Choose the right handle |173

Rose handles

See matching door furniture on pages 195-210

Victorian Scroll RoseBrass DFU0071

Chrome DFU0615

H62mm x W62mm x D9mm

Victorian RoseChrome DFU0072


Lugano RoseChrome DFU0907

Satin Nickel DFU0725


Sofia RoseChrome DFU0709


Black Nickel NEW DFU1040


Garda RoseBrass DFU0819

Chrome DFU0820



Ledro RoseBlack DFU0482


Mitred Lecco RoseSatin Stainless Steel FH DFU1030

H45mm x W45mm x D10mmFD30/FD60

Durham Pewter RosePewter UK DFU0742


Victorian Rose Chrome handle

Ledro Rose Black handle

Mitred Lecco Rose Satin Stainless Steel handle

Rose handles174|

Rose handles

See matching door furniture on pages 195-210

Lecco RoseSatin Stainless Steel FH DFU0471

H45mm x W45mm x D10mmFD60

Newington RosePolished/Satin Chrome DFU0836

H53mm x W53mm x D10mmFD30/

Cadeby RoseChrome Effect FH DFU0835


Lamport RosePolished/Satin Chrome DFU0837


1010 yearoperationalwarranty

Adina RosePolished/Satin Chrome DFU0458


Riva RoseChrome DFU0460



Capri RosePolished/Satin Chrome DFU0454


Arva RosePolished/Satin Chrome DFU0650


Rose handles

Lamport Rose Polished Satin Chrome handle

Riva Rose Chrome handle

Capri Rose Polished/Satin Chrome handle

|175

Rose handles

Turin RoseSatin Stainless Steel FH DFU0727


Lago RosePolished Stainless SteelFH DFU0729


Burford RoseBrushed Stainless Steel DFU0760


Pewter Effect Scroll RosePewter DFU0755


Roundbar RoseAluminium FH DFU0300**

Stainless Steel FH DFU0260*


1010 yearoperationalwarranty**

5 yearoperationalwarranty*

5

Alento RosePolished/ Satin Chrome DFU1035


Turin Rose Satin Stainless Steel handle

Pewter Effect Scroll Rose handle

Alento Rose Satin/Polished handle NEW

Rose handlesSee matching door furniture on pages 195-210

176|

Durham LatchPewter UK DFU0740


Durham LockPewter UK DFU0741


Durham BathroomPewter UK DFU0743


Durham RosePewter UK DFU0742


Durham

Durham Pewter Lock handle

Durham Pewter Rose handle

Durham handles

Durham Pewter Latch handle

See matching door furniture on pages 195-210|177

Pewter Effect LatchPewter DFU0833


Pewter Effect LockPewter DFU0834


Pewter Effect RosePewter DFU0755


Pewter Effect

Pewter Effect Scroll Lock handle

Pewter Effect Scroll Latch handle

Pewter Effect handles

Pewter Effect Scroll Rose handle

See matching door furniture on pages 195-210178|

Chrissi Chrome

Chrissi LatchChrome DFU0039


Chrissi LockChrome DFU0038


Chrissi BathroomChrome DFU0031


Chrissi PrivacyChrome DFU0040


Chrissi Chrome handles

Chrissi Chrome Lock handle

Chrissi Chrome Latch handle Chrissi Chrome Privacy handle


Chrissi Satin Nickel

Chrissi Satin Nickel Latch handle

Chrissi Satin Nickel Bathroom handle

Chrissi LatchSatin Nickel DFU0045


Chrissi LockSatin Nickel DFU0044


Chrissi BathroomSatin Nickel DFU0032


Chrissi PrivacySatin Nickel DFU0046


Chrissi Satin Nickel handles

Chrissi Satin Nickel Lock handle


Idro

Idro LatchBrass DFU0601

Chrome DFU0604



Idro LockBrass DFU0600

Chrome DFU0603



Idro PrivacyBrass DFU0602

Chrome DFU0605



Idro Chrome Latch handle

Idro Brass Privacy handle

Idro handles

Idro Satin Nickel Lock handle


Garda

Garda Chrome Bathroom handle

Garda Satin Nickel Lock handle

Garda LatchBrass DFU0701

Chrome DFU0705



Garda LockBrass DFU0700

Chrome DFU0704



Garda BathroomBrass DFU0738

Chrome DFU0737



Garda PrivacyBrass DFU0702

Chrome DFU0706



Garda RoseBrass DFU0819

Chrome DFU0820



Garda handles

Garda Brass Lock handle


Lugano LatchChrome DFU0905


Lugano LockChrome DFU0904


Lugano PrivacyChrome DFU0906


Lugano RoseChrome DFU0907



Lugano

Lugano Chrome Lock handle

Lugano Chrome Rose handle

Lugano handles

Lugano Chrome Latch handle


Victorian Scroll

Victorian Scroll Chrome Privacy handle

Victorian Scroll Brass Latch handle

Victorian Scroll LatchBrass DFU0631

Chrome DFU0661


Victorian Scroll LockBrass DFU0630

Chrome DFU0660


Victorian Scroll BathroomBrass DFU0632

Chrome DFU0662

H155mm x W41.5mm x D10mm

Victorian Scroll PrivacyBrass DFU0633

Chrome DFU0663

H118mm x W41.5mm x D9.5mm

Victorian Scroll RoseBrass DFU0071

Chrome DFU0615


Victorian Scroll handles

Victorian Scroll Brass Rose handle


Victorian LatchBrass DFU0621

Chrome DFU0611



Victorian BathroomBrass DFU0622

Chrome DFU0612



Victorian LockBrass DFU0620

Chrome DFU0610



Victorian PrivacyBrass DFU0623

Chrome DFU0613


Chrome DFU1014



Victorian Rose Budget Victorian LatchChrome DFU0072



Victorian / Budget Victorian

Victorian Satin Nickel Bathroom handle

Victorian Chrome Latch handle

Victorian / Budget Victorian handles

Victorian Brass Privacy handle


Roundbar LatchAluminium FH DFU0302


Roundbar LockAluminium FH DFU0301


Roundbar BathroomAluminium FH DFU0303


Roundbar RoseAluminium FH DFU0300**

Stainless Steel FH DFU0260*


Roundbar Aluminium

Roundbar Aluminium Bathroom handle

Roundbar Aluminium Rose handle




1010 yearoperationalwarranty**

5 yearoperationalwarranty*

5

Roundbar Aluminium handles

Roundbar Aluminium Latch handle


Edinburgh LatchAluminium FH DFU0085

Chrome FH DFU0840


Edinburgh LockAluminium FH DFU0086

Chrome FH DFU0841


Edinburgh Bathroom/PrivacyAluminium FH DFU0087

Chrome FH DFU0842


Edinburgh

Edinburgh Aluminium Latch handle

Edinburgh Chrome Effect Lock handleEdinburgh Aluminium Bathroom/Privacy handle

DFU0087 & DFU0842 can be used as a bathroom

or a privacy handle - combine with the appropriate lock

or latch pack.




Edinburgh handlesSee matching door furniture on pages 195-210

|187

Antique

Antique Black Ornate Lock handle

Antique Black Latch handle Antique Black Ornate Latch handle

Antique LatchBlack DFU0034

H130mm x W49mm x D4.5mm

Antique LockBlack DFU0033

H160mm x W50mm x D4.5mm

Antique Ornate LatchBlack DFU0028


Antique Ornate LockBlack DFU0029


Antique handlesSee matching door furniture on pages 195-210

188|

Mortice knobs

Chrome mortice knob

Satin Nickel mortice knob Brass mortice knob

Mortice knobsBrass DFU0050

Chrome DFU0063


D62mm

KnobsetPlastic Brown (mortice/rim) DFU0064

D56mm

Taylors dummy spindle

Bright Zinc plated high-grade alloy steel DFU0910

H32mm x L30mm x T8mm

Mortice knobs & knobsetSee matching door furniture on pages 195-210

|189

Euro, Oval and Disabled

Victorian Chrome Euro profile handle

Disabled Aluminium access lever handle Edinburgh Chrome Euro profile handle

Victorian Euro profile LockChrome DFU0616


Aluminium Roundbar Euro profile LockEuro FH DFU0304

Oval FH DFU0305


Edinburgh Euro profile LockAluminium FH DFU0088

Chrome FH DFU0843


Universal Aluminium disabled

access lever handle DFU0922




5

Euro, Oval & Disabled handlesSee matching door furniture on pages 195-210

190|

Lock and Latch packs

Newington Satin Stainless Steel Latch pack

Mitred Lecco Rose Latch pack NEW

Newington Matt Black Latch pack NEW


Packs include door furniture, locks/latches, hinges and fixings.

Newington Rose Latch packPolished/Satin Stainless Steel LAL0758

Black Nickel NEW LAL1330

Matt Black NEW LAL1331

Polished/Satin fire rated NEW FH LAL1332

Turin Rose Latch pack

Stainless Steel NEW LAL1220

Lecco Rose Latch pack

Satin Stainless Steel NEW LAL1221

Mitred Lecco Rose Latch PackStainless Steel NEW LAL1340

Sofia Rose Latch packChrome LAL1222

Black Nickel NEW LAL1350

|191

Garda Lock and Latch packsBrass Latch pack LAL2020

Brass 3 Lever Lock pack LAL2050

Brass Bathroom pack LAL2092

Brass Privacy pack LAL2030

Chrome Latch pack LAL2060

Chrome 3 Lever Lock pack LAL2080

Chrome Privacy pack LAL2070


Chrissi Lock and Latch packsChrome Latch pack LAL1060

Chrome 3 Lever Lock pack LAL1080

Chrome Bathroom pack LAL1090



Burford Rose Latch packBrushed Stainless Steel LAL3020

Newington Push Button Lock and Latch pack

Polished Privacy Satin Stainless Steel NEW LAL0770

Sofia Push Button Lock and Latch Pack

Chrome Privacy NEW LAL0771

Newington Polished Satin Push Button NEW

Sofia Chrome Push Button NEW

Chrissi Chrome 3 Lever Lock pack

192|


Latch pack (no handle)Chrome Latch pack LAL0178

Brass Latch pack LAL0172

*10 year operational warranty applies to the handle only

Edinburgh Aluminium Lock and Latch packsAluminium Latch pack LAL0166

Aluminium Privacy pack LAL0168

1010 yearoptionalwarranty*

Victorian Lock and Latch packsBrass Latch pack LAL1130

Brass Privacy pack LAL1120

Chrome Latch pack LAL1102

Chrome Bathroom pack LAL1112



Victorian Budget Lock and Latch packsBudget Brass Latch pack LAL0752

Budget Chrome Latch pack LAL0756

Budget Chrome Privacy pack LAL0757

Budget Victorian Satin Nickel Latch pack NEW LAL1310

Budget Victorian Satin Nickel Latch pack NEW

Edinburgh Aluminium Latch pack

Victorian Brass Privacy pack

|193

Quick-Fit Lock and Latch Packs

Newington Polished/Satin Quick-Fit latch pack LAL1211

Sofia Chrome Quick-Fit latch pack LAL1212

Quick-Fit handle jig pack TLS0607

Quick-Fit handle Jig - Keep locator TLS0672


Fino Chrome Quick-Fit latch pack NEW LAL1214

Cesano Chrome Quick-Fit latch pack NEW LAL1213

Newington Polished/Satin Quick-Fit latch pack

Sofia Chrome Quick-Fit latch pack

Newington Polished/Satin Quick-Fit latch pack

194|

Fire Regulations:




Door furniture

Howdens offers a wide range of

matching door furniture to complete

the look of the door. This includes

pull handles, coat hooks, cabin

hooks, door stops, door knockers,

escutcheons and many more.

Door furniture|195

Bathroom turns

Available in multiple finishes and sizes, and supplied with fixings.

Suitable for use with bathroom bolts (LAL0130/31). See page 214.

D53mm

Polished/Satin bathroom turn DFU0432


5D50mm

Stainless Steel lever indicator and turn DFU0270

D53mm

Aluminium bathroom turn DFU0313

H50mm x W50mm

Brushed Steel Effect Square bathroom turn DFU0761

H50mm x W50mm

Satin Nickel Square bathroom turn DFU0250

H50mm x W50mm

Chrome Square bathroom turn DFU0445

D52mm

Black Nickel bathroom turn DFU0443

D52mm

Matt Black bathroom turn NEW DFU1046

D38mm

Antique Black bathroom turn DFU0035

D44mm

Pewter Effect bathroom turn DFU0756

D44mm

Pewter bathroom turn UK DFU0731

D52mm

Polished Stainless Steel bathroom turn DFU0447

D53mm

Satin Stainless Steel bathroom turn DFU0449

D47mm

Satin Nickel bathroom turn DFU0431

D47mm

Chrome bathroom turn DFU0442

D47mm

Brass bathroom turn DFU0441

Door furniture

Chrome Square bathroom turn

Satin Stainless Steel bathroom turn

Brass bathroom turn

196|

Escutcheons

All escutcheons are sold in pairs unless otherwise stated.

H50mm x W50mm

Chrome square DFU0550

H50mm x W50mm

Satin Nickel square DFU0779

H52mm x W52mm

Brushed Stainless Steel Effect square DFU0780

D47mm

Chrome round DFU0777

D43mm

Satin Nickel round DFU0775

D54mm

Satin Stainless Steel round DFU0771

D52mm

Polished Stainless Steel round DFU0772

D40mm

Pewter round UK DFU0732

D50mm

Pewter Effect round DFU0776

D50mm

Aluminium Euro profile round DFU0773

D50mm

Stainless Steel Euro profile round DFU0774

D53mm

Black Nickel round DFU0216

D53mm

Matt Black round NEW DFU1045

D53mm

Polished/Satin Chrome round DFU0781

H40mm x W35mm

Brass round covered DFU0207

Sold in single units

H40mm x W35mm

Chrome round covered DFU0206


H43mm x W33mm

Satin nickel round covered DFU0215


Door furniture

Pewter round escutcheon

Chrome square escutcheon

Brass round covered escutcheon

|197

Pull handles

Supplied with fixings.

Fingerplates & kickplates

Brass bow 6” DFU0147

Chrome bow 6” DFU0138

Satin Nickel bow 6” DFU0139

Aluminium bow 6” DFU0141

Antique Black 7” DFU0137

Aluminium concealed fixing 9” DFU0142

Aluminium cranked 9” DFU0144

Aluminium bolt fixing 9” DFU0143

Stainless Steel concealed fixing 12” FH DFU0136

Fingerplates

Aluminium fingerplate 12” x 3” UK FH DFU0107

Brass fingerplate 12” x 3” UK FH DFU0146

Polished Stainless Steel fingerplate 12” x 3” UK FH DFU0145

Stainless Steel fingerplate 15” x 3” UK FH DFU0095

Kickplates

SAA kickplate 30” H150mm x L762mm UK FH DFU0157

SAA kickplate 33” H150mm x L838mm UK FH DFU0106

FD30/FD60

Door furniture

Aluminium fingerplate

Stainless Steel concealed fixing pull handle

Aluminium bow pull handle

198|

Brass GIR0364

H127mm x W33mm

Chrome GIR0363

H127mm x W33mm

Satin Nickel GIR0365

H120mm x W30mmAluminium GIR0367

H135mm x W33mm

Antique Black GIR0366

H110mm x W35mm

4” / H35mm x L110mm LAL0116

6” / H35mm x L170mm LAL0117

4”/ H35mm x L110mm LAL0113

6”/ H35mm x L170mm LAL0114

4”/ H35mm x L110mm LAL0118

6”/ H35mm x L170mm LAL0119

6”/ H35mm x L170mm LAL0110

Coat hooks


Cabin hooks


Brass Chrome

Satin Nickel Antique Black

Door furniture

Chrome cabin hook

Chrome coat hook

Antique Black coat hook

|199

Brass Projection GIR0342

H41mm x L65mm

Satin Nickel Projection GIR0358

H41mm x L65mm

Chrome Projection GIR0345

H41mm x L65mm

Aluminium Projection GIR0344

H41mm x L65mm

Brass Finish Flexible GIR0340

3”/ H24mm x L74mm

Chrome Oval GIR0346

H20mm x L50mm

Satin Nickel Oval GIR0357

H20mm x L50mm

Aluminium Oval GIR0343

H20mm x L50mm

White Plastic GIR0004

H20mm x L25mm

Door stops

Bolts


BJP - Black Japanned*No fixings supplied

6” / H19mm x L152mm SCF0166Satin Nickel flush bolt

4” / H25mm x L100mm SCF0045Aluminium necked barrel bolt

5” / H37mm x L135mm SCF0067Antique Black bolt

6” / H38mm x L185mm SCF0059*

8” / H45mm x L247mm SCF0155*

BJP tower bolt6” / H45mm x L208mm SCF0125*

8” / H45mm x L255mm SCF0126*

Galvanised padbolt

12” / H120mm x L310mm SCF0300Galvanised garage drop bolt

4” / H25mm x L116mm SCF0046Brass barrel bolt

6” / H30mm x L145mm SCF0047Brass heavy duty bolt

4” / H25mm x L100mm SCF0048

6” / H25mm x L152mm SCF0140

Brass necked barrel bolt6” / H19mm x L152mm SCF0171Brass flush bolt

4” / H25mm x L116mm SCF0141

6” / H25mm x L165mm SCF0163

Chrome barrel bolt4” / H25mm x L100mm SCF0158

6” / H25mm x L152mm SCF0159

Chrome necked barrel bolt

6” / H19mm x L152mm SCF0173Chrome flush bolt

6” / H30mm x L145mm SCF0147Chrome heavy duty bolt

4” / H25mm x L116mm SCF0167Satin Nickel barrel bolt

4” / H25mm x L100mm SCF0168

6” / H25mm x L152mm SCF0169

Satin Nickel necked barrel bolt6” / H30mm x L145mm SCF0170Satin Nickel heavy duty bolt

4” / H25mm x L116mm SCF0041Aluminium barrel bolt

6” / H19mm x L152mm SCF0172Aluminium flush bolt

Door furniture200|

Chrome door tidy

Antique Black letterplate

Brass door knocker

Door furniture

Brass DFU0165

H153mm x W80mm

Chrome DFU0164

H153mm x W80mm


H168mm x W80mm

Aluminium letterplate DFU0239

L252mm x H80mm

Gold sleeved letterplate DFU0235

L297mm x H71mm

Brass door tidy DFU0150

To suit 252mm / 10” letterplates

Chrome door tidy DFU0159


Satin Nickel door tidy DFU0158


Satin Nickel letterplate DFU0099 L252mm x H80mm

Antique Black letterplate DFU0096 L250mm x H80mm

Brass letterplate DFU0100

L252mm x H80mm

Chrome Plated letterplate DFU0233

L252mm x H80mm

Door knockers

Letterplates & door tidies

L297mm x H71mm

Chrome sleeved letterplate DFU0236

|201

Suffolk latches

Cylinder pulls

Fixings not required. Held in place by cylinder lock.

Draught excluders

Brass DFU0108

H70mm x W47mm

Chrome DFU0205

H70mm x W47mm


H70mm x W47mm

Antique Black LAL0115

Black Japanned LAL0101

Galvanised UK LAL0109

Exitex Lowline Gold GIR0010

L914mm x H55mm x W25mm

Exitex Lowline Aluminium GIR0035


Exitex Gold mobility weather bar kit GIR0016





Door furniture

Antique Black Suffolk latch

Brass cylinder pull

Exitex Lowline Gold draught excluder

202|








White trackset 1200mm UK GIR2036




Waterbar GAR0010

L914mm

Exitex Aluminium door surround GIR0037

L5,180mm x H40mm x W9mm

Exitex Gold door surround GIR0012

L5,180mm x H40mm x W9mm

Exitex Threshex Aluminium GIR0038

L933mm x H80mm x W18.5mm

Exitex Threshex Gold GIR0014

L933mm x H80mm x W18.5mm

Exitex Aluminium brush strip GIR0039


Exitex Gold brush strip GIR0155


Exitex Aluminium mobility weather bar kit GIR0036


Silver trackset 1200mm UK GIR2037




Sliding wardrobe door tracks

Suitable for use with sliding wardrobe doors. See pages 99-101

Waterbar

Draught excluders

Door furniture

Silver trackset

Exitex Threshex Gold draught excluder

Exitex Aluminium mobility weather bar

|203

1 yearguarantee

1 yearguarantee

Marathon sliding door gear (suitable for single doors)

L1500mm UK GIR0030

Sliding door gear L1500mm (fittings for 2 doors included) UK GIR3010

Sliding door gear L2400mm (fittings for 3 doors included UK GIR3011

Floor Channel L1500mm UK GIR3012

Floor Channel L2400mm UK GIR3013

Nylon guides for floor channel (pair) GIR3014

Additional Truck Kit UK GIR3025

Chrome round tube 19mm x 2.5m GIR0040

Chrome round Socket 19mm GIR0052

Chrome round end bracket 19mm GIR0050

Chrome round centre bracket 19mm GIR0051

Chrome oval tube 15mm x 30mm x 1.8m GIR0056

Chrome oval socket 15mm x 30mm GIR0059

Chrome oval end bracket 15mm x 30mm GIR0057

Chrome oval centre bracket 15mm x 30mm GIR0058

Accessories for multiple doors

Sliding door gear

Sliding door gear is suitable for doors, partitions and wardrobes

in heavy-duty domestic and light commercial applications.

For multiple doors

For single doors

Chrome tube and fittings

Max. weight 45kg per door.

Max. weight 55kg.

Brass flush handle GIR3033

Chrome flush handle GIR3032

Satin Nickel flush handle GIR3031

Door furniture

Chrome oval tube

Floor channel

Marathon sliding door gear

204|

Commercial door furniture

Fire Regulations:




Commercial door

furniture

Howdens supplies a range of

commercial door furniture suitable

for communal buildings, offices

and commercial properties. The

products available include a variety

of handles, fingerplates, door closers,

digital door lock, panic hardware and

signage.

Commercial properties often require

fire rated door furniture and all

Howdens fire rated products are

highlighted with either an essential

fire door hardware or a non-essential

fire door hardware symbol.

The Edinburgh and Aluminium

Roundbar handles also come with

a 10 year operational warranty.

|205



5

Universal Aluminium disabled access lever handle DFU0922


5

Stainless Steel lever indicator and turn DFU0270

D50mm

Stainless Steel Euro profile round DFU0774

D50mmSold in pairs


Edinburgh Aluminium Euro profile FH DFU0088



Edinburgh Chrome Effect Euro profile FH DFU0843



5

Stainless Steel Roundbar 19mm FH DFU0260



Aluminium Roundbar 19mm FH DFU0300


Handles & accessories


FD30/FD60

Aluminium Roundbar 19mm Oval profile FH DFU0305


Aluminium Roundbar 19mm Euro profile FH DFU0304

Universal Aluminium disabled access lever

Stainless Steel Euro profile round escutcheon

Aluminium Roundbar 19mm Euro profile

206|

Stainless Steel fingerplate

Briton 2003.SES door closer

Eclipse 73 door closer


Union Retro 3 door closer fixed size 3 Silver FH FD120 DCL0017

Briton 2003.SES door closer fixed size 3 Silver FH FD120* DCL0007

Briton 1110.SES door closer adjustable

size 2-4 Silver FH FD120*¹ DCL0012

Stainless Steel fingerplate 15” x 3” UK FH DFU0095

Polished Stainless Steel Fingerplate 12” x 3” UK FH DFU0145

Aluminium Fingerplate 12” x 3” UK FH DFU0107

SAA Kickplate 30” H150mm x L762mm UK FH DFU0157

SAA Kickplate 33” H150mm x L838mm UK FH DFU0106

Door closers

Door closers are an important link in the control of fire and

smoke and their usage can help save lives.

All Howdens door closers meet BS EN1154, which is the

required standard to attain CE marking for controlled door

closing devices.

Handles & accessories

*Not fire rated when fitted with parallel fixing plate *¹Not FD120 if power size 2 setting is used, minimum power size 3 setting required

10 10 yearguarantee

10 10 yearguarantee

10 10 yearguarantee


Cadeby Chrome Effect FH DFU0835


Stainless Steel concealed fixing 12” FH DFU0136 FD30/FD60

• Silver finish with matching arm• Supplied with parallel fixing plate• Suitable for low usage

• Silver finish with matching arm• Supplied with parallel fixing plate• Suitable for low usage

• Supplied with parallel fixing plate• Suitable for medium usage

|207

EB - Electro Brass

NP - Nickel Plated

Self closing door hinge packs

Concealed door closer

Door closers

Digital door lock

Digital door locks offer a convenient method for allowing access

to authorised-only users.

• Light duty• Internal use• Non-handed • 14 digit key pad• Tubular latch mechanism• Optional holdback mechanism• 60mm backset

10 10 yearguarantee

1 yearguarantee

Suitable for low usage

Briton 121 CE.SES door closer fixed size 3 Silver FH FD120 DCL0001

Parallel fixing plate for DCL0001 DCL0061

See pages 229-232 for the full range of hinges

FD30/FD60

FD30/FD60

4” Satin Stainless Steel (pack of 3) FH HNG0430

Briton digital door lock Satin SCF0241

Concealed closer EB FH DCL0002

Concealed closer NP FH DCL0022

Eclipse 73 door closer fixed size 3 Silver FH FD120*¹ DCL0019

Suitable for low to high usage

10 10 yearguarantee


EB Stainless Steel self closing door hinge

Brass concealed door closer

Briton Satin digital door lock

208|

Briton security push pad FH SCF0081

Briton outside access device - lever FH SCF0074

Panic hardware

On January 1st 2010, it became mandatory for all exit devices

to comply with the latest revisions of BS EN 1125: 2008,

BS EN 179: 2008 and CE Marking.

BS EN 1125: 2008 - Applies to PANIC APPLICATIONS where the

exit door is used by the public and provides safe and effective

escape through the doorway with minimum effort, and without

prior knowledge of operation.

BS EN 179: 2008 - Applies to EMERGENCY APPLICATIONS

where the exit door is used by people who “are familiar with the

emergency exit and its hardware, and therefore a panic situation

is unlikely to occur”.

This product is for use on the exterior surface in conjunction with panic hardware

5 5 yearguarantee

5 5 yearguarantee

Suitable for doors up to H2500mm x W1300mm. Pack includes signage

5 5 yearguarantee

Briton double rebated panic set FH SCF0076

FD30/FD60

Briton single panic bolt FH SCF0078


5 5 yearguarantee

FD30/FD60

Briton rim panic latch FH SCF0077


5 5 yearguarantee

FD30/FD60

FD30/FD60

FD30/FD60


Briton single panic bolt

Briton security push pad

Briton double rebated panic set

|209

Signage

All signage is 75mm diameter and polished stainless steel.

Push UK FH GIR0090

Pull UK FH GIR0091

Ladies (emblem) UK FH GIR0094

Gents (emblem) UK FH GIR0095

Accessible (emblem) UK FH GIR0096

Fire Door Keep Locked UK FH GIR0092

Fire Door Keep Shut UK FH GIR0093


Fire Door Keep Shut Polished Stainless Steel

door sign

Ladies Polished Stainless Steel door sign

Push Polished Stainless Steel door sign

210|

Door security

As the door is the most obvious

way into a property, it is the first

place a thief will try. If a door is not

securely locked, a burglar can either

kick or lever it open very easily. It is

therefore essential that all external

doors are protected securely with a

high quality lock, which is embedded

into the door for extra strength.

Howdens supplies a variety of

options for making homes and

commercial properties secure.

These include a range of locks and

deadlocks, nightlatches, security

bolts, door chains and viewers, all

complying with insurance guidelines

and British Standards as necessary.

Door Security

Fire Regulations:




|211

Choose the right type of latch/lock

Choosing the right type of latch/lock

Tubular mortice latches

A tubular mortice latch can be used in conjunction with either

latch, rose or knob handles. Bolt through and Quick-Fit options

are available.

Bathroom bolts

Bathroom bolts are operated by a bathroom turn and allow

flexibility when fitting a separate rose or knob handle with latch.

Quick-Fit options are available.

Bathroom locks

Bathroom locks are based on a 3 lever lock case, with a deadbolt

operated by a bathroom turn instead of a key.

Sashlocks

Sashlocks have a deadbolt, latch and a key, and can be operated

from both sides of the door. Sashlocks are suitable for use with

lock handles or a rose handle/mortice knob and an escutcheon.

Deadlocks

Deadlocks have a deadbolt and a key only, and can be operated

from both sides of the door. Deadlocks are often used in

conjunction with a nightlatch, to increase security.

Traditional nightlatches

Are mounted on the surface of the door and are a simple method

of opening external doors, where key access is not required on the

inside. Ideal for use on entrance doors in multi-residential dwellings.

Double locking nightlatches

Automatically deadlock when the door is closed. The inside

handle can be deadlocked by a turn of the key from the inside,

making them ideal for glass panelled doors.

Digital door locks



Euro/oval profile cylinder locks

Are thumbturn operated and ideal for locations that require

controlled access from one direction and easy access from the other

or as a double cylinder which operates with a key on both sides.

Rebate kits

Use when fitting either a mortice sashlock or deadlock to a

pair of doors with rebated meeting stiles (i.e. the doors overlap

when closed).

Rim locks

A basic deadbolt used for locking sheds, outhouses and similar

applications.

212|

Door security



Premium tubular mortice latch 2½” PB/PSS FH LAL0075*

Premium tubular mortice latch 3” PB/PSS FH LAL0076*

Tubular mortice latch 2½” EB LAL0235

Tubular mortice latch 2½” NP LAL0236

Tubular mortice latch 3” EB LAL0237

Tubular mortice latch 3” NP LAL0238

Tubular mortice latch 95mm EB LAL0040*¹

Tubular mortice latch 95mm NP LAL0041*¹

Bolt through tubular latch 2½” EB/CP LAL0078

Bolt through tubular latch 3” EB/CP LAL0077

Quick-Fit latch 60mm CP NEW LAL0863

Quick-Fit latch 60mm NP NEW LAL0864

Quick-Fit latch 70mm CP LAL0860

Quick-Fit latch 70mm NP LAL0861

Quick-Fit latch 70mm BN LAL0862


Tubular mortice latches can be used in conjunction with either

latch, rose or knob handles.

PB - Polished Brass

PSS - Polished Stainless Steel

EB - Electro Brass

NP - Nickel Plated

CP - Chrome Plated

BN - Black Nickel

*Suitable for use with bolt through fixings

*1CE marked

FD30/FD60

Quick-Fit latch

Premium tubular mortice latch

Tubular mortice latch

|213

Door security

Bathroom bolts & locks

Bathroom bolts are operated by a bathroom turn and allow

flexibility when fitting a separate rose or knob handle with a

latch.

Bathroom bolts

Bathroom locks

Bathroom locks are based on a 3 lever lock case, with a

deadbolt operated by a bathroom turn instead of a key.

SSS - Satin Stainless Steel

EB - Electro Brass

NP - Nickel Plated

CP - Chrome Plated

SCP - Satin Chrome Plated

BN - Black Nickel

MB - Matt Black



FD30/FD60

Bathroom bolt with dual striking plate 2½” SSS FH LAL0127

Bathroom bolt with dual striking plate 3” EB/NP FH LAL0130

Bathroom Bolt with dual striking plate 3” BN/MB LAL0250

Quick-Fit bathroom bolt 70mm CP LAL0128

Quick-Fit bathroom bolt 70mm NP LAL0129

Quick-Fit bathroom bolt 70mm BN LAL0126

Mortice sashlock 2½” EB LAL0241

Mortice sashlock 2½” CP LAL0242

Mortice sashlock 3” EB LAL0243

Mortice sashlock 3” CP LAL0244

Bathroom bolt with dual striking plate

Bathroom mortice sashlock

Quick-Fit bathroom bolt

214|

5 Lever mortice sashlock

British Standard 5 lever Union mortice sashlock

3 Lever mortice sashlock

Door security

Sashlocks

Sashlocks have a deadbolt, a latch and a key, and can be

operated from both sides of the door. Sashlocks are suitable

for use with lock handles or a rose handle/mortice knob and

an escutcheon.

3 Lever locks

3 lever locks are a basic type of mortice lock, that is ideal for

securing internal doors. The locks have 100 key patterns -

at least 100 different key patterns must be made before any

key pattern can be used again.

5 Lever locks

5 lever locks are a more secure option than the 3 lever version.

The locks have 500 key patterns - at least 500 different key

patterns must be made before any key pattern can be used again.

British Standard 5 lever locks

The BS approved 5 lever locks are the most secure option.

The locks have 1000 key patterns - at least 1000 different

key patterns must be made before any key pattern can be

used again.

For external use

Hardened steel rollers

False notching to prevent picking

Fittings supplied

2 keys supplied

For external use


Anti-drill/saw deadbolt

Anti-drill lockcase

Fittings supplied

2 keys supplied

Fittings supplied

2 keys supplied


10 10 yearguarantee

10 10 yearguarantee

FD30/FD60

Mortice sashlock 2½” EB LAL0231

Mortice sashlock 2½” CP LAL0232

Mortice sashlock 3” EB LAL0233

Mortice sashlock 3” CP LAL0234

Mortice Sashlock 2½” EB LAL0003

Mortice Sashlock 2½” SCP LAL0033

Mortice sashlock 3” SCP LAL0086

Union StrongBOLT mortice sashlock BS 2½” EB FH LAL0042

Union StrongBOLT mortice sashlock BS 3” EB FH LAL0043

Union StrongBOLT mortice sashlock BS 2½” SCP FH LAL0044

Union StrongBOLT mortice sashlock BS 3” SCP FH LAL0045

|215

5 5 yearguarantee

ERA mortice deadlock 2½” EB LAL0038

ERA mortice deadlock 2½” SCP LAL0039

ERA mortice deadlock 2½” EB LAL0007

ERA mortice deadlock 2½” SCP LAL0034

ERA mortice deadlock 3” SCP LAL0035

Union mortice deadlock BS 3” SCP FH LAL0087

Union StrongBOLT mortice deadlock BS 2½” EB FH LAL0046

Union StrongBOLT mortice deadlock BS 2½” SCP FH LAL0047

Deadlocks

Deadlocks have a deadbolt and a key only, and can be operated

from both sides of the door. Deadlocks are often used in

conjunction with a nightlatch, to increase security.

3 Lever locks

3 lever locks are a basic type of mortice lock, that is ideal for

securing internal doors. The locks have 100 key patterns - at

least 100 different key patterns must be made before any key

pattern can be used again.

5 Lever locks

5 lever locks are a more secure option than the 3 lever version.


patterns must be made before any key pattern can be used

again.

British Standard 5 lever locks

The BS approved 5 lever locks are the most secure option.


patterns must be made before any key pattern can be used again.

Fittings supplied

2 keys supplied

Fittings supplied

2 keys supplied

For external use

Hardened Steel rollers

Anti-drill lockcase

Fittings supplied

2 keys supplied

For external use


Anti-drill/saw deadbolt

EB - Electro Brass


10 10 yearguarantee

10 10 yearguarantee

FD30/FD60

Door security

Union British Standard 5 lever mortice deadlock

ERA 5 lever mortice deadlock

ERA 3 lever mortice deadlock

216|

Economy Brass cylinder nightlatch

Yale 88 Grey case cylinder nightlatch

Yale 81 Rollerbolt nightlatch

Door security

Traditional nightlatches

Are mounted on the surface of the door and are a simple

method of opening external doors, where key access is not

required on the inside. Ideal for use on entrance doors in

multi-residential dwellings.

Latch can be deadlocked from the inside only.



*Backset is the measurement from the edge of the door to the centre of

the key hole.

2 yearguarantee

2 yearguarantee

2 yearguarantee

2 yearguarantee

Yale 81 Rollerbolt nightlatch (60mm backset)* LAL0509

Yale 85 Grey case/Brass cylinder (40mm backset)* LAL0503

Yale 89 Grey Case/Brass cylinder (60mm backset)* LAL0505

Latch can be deadlocked from the inside and outside.



Yale 77 Brass cylinder (60mm backset)* LAL0500

ERA Green case/Brass cylinder (60mm backset)* LAL0050

Economy Brass cylinder (60mm backset)* LAL0053

ERA replacement rim Brass cylinder LAL0063

ERA replacement rim Chrome cylinder LAL0067

ERA replacement rim Satin cylinder LAL0064

|217

10 10 yearguarantee

10 10 yearguarantee

(40mm backset)* LAL0510


Euro/oval cylinder sashlock case 2½” Satin LAL0220

Euro/oval cylinder sashlock case 3” Satin LAL0221

Euro/oval cylinder deadlock case 2½” Satin LAL0222

Euro/oval profile cylinder deadlock case 3” Satin LAL0230

Yale BS anti snap and anti bump Euro profile double cylinder CP*¹*² LAL0090

ERA Euro profile cylinder and thumbturn Satin*² LAL0226

ERA oval profile cylinder and thumbturn Satin LAL0229

ERA double locking nightlatch Brass case and cylinder


ERA double locking nightlatch Brass case and cylinder


ERA double locking nightlatch Chrome case and cylinder


ERA double locking nightlatch Chrome case and cylinder


ERA double locking nightlatch Satin Nickel case and cylinder


ERA double locking nightlatch Satin Nickel case and cylinder



Available as double cylinder or cylinder and thumbturn.

Double locking nightlatches

Automatically deadlock when the door is closed. The inside

handle can be deadlocked by a turn of the key from the inside,

making them ideal for glass panelled doors.

Euro/oval profile cylinder lock cases

Are a mortice lock offering total versatility. They are ideal for

commercial premises.

*1 Ensures controlled access from both sides of the door.

*2 2 Euro profile escutcheons available DFU0203 and DFU0212.

ERA Euro profile double cylinder Satin*¹*² LAL0200

ERA BS locking nightlatch Chrome case and cylinder

Door security

Yale BS Euro profile cylinder

ERA BS Chrome double locking nightlatch

ERA Brass double locking nightlatch

218|

Deadlock Black rim lock

EB Latch rebate kit

Briton Satin digital door lock

Door security

1 yearguarantee

Latch rebate kit for LAL0235/0237/0245 EB LAL0239

Latch rebate kit for LAL0236/0238/0246 NP LAL0240

Sashlock rebate Kit for LAL0003 EB LAL0032

Sashlock Union BS rebate kit for LAL0042/LAL0043 EB LAL0048

Sashlock Union BS rebate kit for LAL0044/LAL0045 SCP LAL0049

Deadlock 4” Black LAL0011

Sashlock 5” Grey LAL0023

Briton digital door lock Satin SCF0241

Rebate kits

Use when fitting either a mortice latch or sashlock to a

pair of doors with rebated meeting stiles (i.e. the doors overlap

when closed).

Rim locks

A basic deadbolt used for locking sheds, outhouses and similar

applications.

EB - Electro Brass

NP - Nickel Plated


Digital door lock



• Light duty• Internal use• Non-handed • 14 digit key pad• Tubular latch mechanism• Optional holdback mechanism• 60mm backset

|219

Brass door chain SCF0005

Chrome door chain SCF0008

Brass door security bolt twin pack (2 bolts, 1 key) SCF0321

Satin door security bolt twin pack (2 bolts, 1 key) SCF0322

Door security bolt key SCF0001

Security fittings

Chrome door viewer SCF0009

Length adjustable dependent on the door thicknessPrecision optical glass viewer with 120o viewing angle

Brass door viewer SCF0007

Length adjustable dependent on the door thicknessPrecision optical glass viewer with 120o viewing angle

H40mm x W40mmChain L210mm

H40mm x W40mmChain L210mm

L35mm-45mm x H15mm

L35mm-45mm x H15mm

Door security

Brass door security bolt

Chrome door viewer

Brass door chain

220|

BJP – Black Japanned

Gate furniture

BJP Ring Gate Latch LAL0132

Black safety hasp and staple 4½” SCF0101

Galvanised safety hasp and staple 4½” SCF0121

ERA Brass padlock 50mm SCF0204

Door security

Black safety hasp and staple

ERA Brass padlock

Black Japanned ring gate latch

|221

Fire rated hardware

All the specialist fire rated hardware we offer has been tested to meet all relevant fire regulations. Please always

remember to consult a qualified building inspector for exact fire door accessory requirements.

Door closersA legal requirement when fitting any fire door, door closers ensure the door is closed and latched when not in

use to prevent fire from spreading. All our overhead door closers come with a 10 year manufacturer’s guarantee.

Fire door hinges Essential in ensuring the integrity of the fire door is not compromised during an emergency, all our graded hinges

are fire rated. Our wide range of graded hinges suit every application, from heavy commercial to light domestic

use. It is recommended a minimum of 3 hinges are used when installing a fire door, with the grade of hinge

dictated by the weight of the fire door being fitted. See page 230 for a simple hinge grade calculator.

Fire rated door framesA comprehensive range of fire rated door

frames are available to view on page 131.

Fire rated expanding foam Quick-setting, fire rated expanding foam

expands on application to fill small holes

or gaps. Once set, it can provide up to

4 hours fire resistance in linear joints

and help to control the spread of fire.

GIR0088 Everbuild hand held B1 fire

rated expanding foam 750ml can be

found on page 133.

SignageCrucial in directing users to fire exits

in the event of an emergency, signage

ensures awareness of safety procedures

at all times. Find our comprehensive

range of commercial signage on

page 210.

Fire rated handles We have several fire rated handles that

have a higher melting point to ensure the

integrity of the handle is not compromised

in the event of a fire. They are fire rated for

up to 60 minutes and suitable for use with

all our fire doors. These can be identified

by the FH logos and FD30/FD60 labels.

See page 267.

Fire rated latches Help to prevent the spread of fire by ensuring the door remains closed in its frame in the event of a fire.

We offer 2½" and 3" premium tubular mortice latches and BS 5 lever sashlocks and deadlocks, all of which are

fire rated for up to 60 minutes. See pages 213, 215 and 216.

Intumescent door seals & hinge pads Our intumescent products react to heat in the event of a fire and seal the door to help prevent the spread of fire

and smoke. Intumescent products can be found on page 133.

For a full list of Howdens fire rated products, please go to pages 267 - 269.

Page 267

Fire rated

handles

Page 133

Intumescent

door seal

Fire rated hardware

Page 210

Signage

Pages 207 - 208

Door closers

Pages 230 -231

Fire door hinges

Page 131

Fire rated

door frames

222|

HardwareAn illustrated technical guide

Door closers

In order to help us recommend the best door closer for your needs, please make sure you know your door

width, height, location, usage, fire door requirements and whether it is push or pull mounted.

Light dutyDomestic, light commercial

2,000 – 100,000 cycles each year, 60kg

Medium duty Offices, apartment blocks

5,000 – 500,000 cycles each year, 80kg

Heavy dutyOpen plan offices, public buildings, department stores

100,000 – 1,500,000 cycles each year, 120kg

Door closer weight calculator

When a door closer or ironmongery is added to a door this has a disproportionate effect on the

calculated door weight. It is essential this calculated weight is taken into account when choosing hinges

and door closers, and NOT the original door weight alone. To calculate your correct door weight: Add 20% for fitting a door closer and ironmongery or add 75% if the door closer requires a

backcheck function Add 10% for heavy use doors (i.e. corridors in public buildings) Reduce by 10% for light use doors (i.e. internal office doors)

For example – 35kg fire door fitted with DCL0007 door closer in a busy public corridor:

20% added for closer (7kg) + 15% added for heavy use (5.2kg) = correct weight is 47.2kg.

All door closers can be found on page 207-208.

Draught excluders

Draught proofing is one of the most inexpensive and effective energy efficiency measures for any size

of building - yet it is often overlooked. A 5mm gap, commonly found under a domestic door, can let

through 80m3 of cold air per hour.

We offer a wide selection of draught excluders suitable for both commercial and residential properties.

All draught excluders can be found on pages 202-203.

Mobility weather bar kitBase of door

Draught

excluder

Doorstep Weather deflecting end caps

Hardware

DraDraDraDraDraDrDrDDrD aDDDrDDDDDDDrDDDD ughughughughu t t tt

excexcexcexexcexcee ludludludddludluddereerereeere

DDDDD ttt WWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWW ththth dddd flflflflfl tititiititttt ggg dddd

|223


Use a tubular mortice latch where a simple door catch function is required.

Sashlocks

Use a sashlock where both a latch and key locking mechanism are required.

General domestic and commercial use

Standard tubular mortice latches can be used on

internal doors in general domestic applications.

They can be used in conjunction with lever handles.

Premium tubular mortice latches are also available as

an alternative, which are suitable for high traffic and

commercial areas.

For more rigid handle fixings

Bolt through tubular mortice latches can be used on

internal doors where the bolt through fixings provided

with the handle are used for rigidity. Holes in the latch

allow the bolts to pass through it to fix either side of

the door.

All tubular mortice latches can be found on page 213.

Highest security

Ideal for external doors requiring the highest levels

of security, the British Standard 5 lever locks are

manufactured to BS standards and can withstand

drilling or sawing of the deadbolt and the lockcase.

5 lever mortice lock

Striking

plate

Bolt

Face plate

Lever handle components

Handle

Screw

Striking plates provided in both Electro Brass

and Chrome Plated finishes

Latch

Striking

plate

Face plate

Medium security

The 5 lever locks are ideal for internal & external

doors that require substantial security. Manufactured

with hardened steel rollers within the bolt to withstand

sawing.

Low level security

More suited to internal doors or external doors that

only require minimal security the 3 lever locks offer a

basic key locking mechanism.

All sashlocks can be found on page 215.

Hardware

nHanHanHananandledledledledleddd

crcrcrcrcrcc ewewewewweewwwwwwLatLatLatLatLata chchchchch

StrStrStrSStrStrikikiiikki

plaplaplapplaplaplalap tetettete

FacFacFFacFacFaFFaa e pe pe pe pe pee e latlatatlatlatatatateeeeeee

ng ng ng ngngngngnggnnnnnnnngn

BolBolBolBo tttt

FacFacFacFacacce pe pe pe pe pe ppplatlatlatlatateeeeee

224|

Hardware

5 Minsor less

to fit

Quick-Fit handle LAL packs & jig

Reduce installation time with the Quick-Fit handle jig. Sold in latch packs consisting of a Quick-Fit

handle, Quick-Fit latch and standard hinges. When fitted with the Quick-Fit handle jig pack, the

overall fitting time can be reduced from 25 minutes down to 5 minutes.

Quick-Fit handle jig

The lever mechanism within the cylinder is more complex

and offers increased levels of security to 3 and 5 lever

mortice sashlocks.

Available in Euro or oval profiles, the double cylinder locks

allow key controlled access from both sides of the door.

Cylinder locks are often chosen for premises where regular

lock replacement is required. The cylinder locks available

from Howdens are for timber doors. Of those offered, the

Yale BS Euro profile double cylinder provides the highest

level of security with anti-snap, anti-bump, anti-drill and

anti-pick features.

All Euro/oval profile cylinder locks can be found on

page 218.


Often used on commercial or multi-tenant properties, cylinder locks offer versatility, functionality

and security.

Face plate Strike plate

Latch

Bolt

LatLatLaLatLatLatLLLLatLatLLL chchchchchch

|225

Slipfix stairpart connectors

The Slipfix stairpart connector kits are a fast and simple solution to make fitting a staircase a one-

man job. There are three connectors that secure the different stairparts; the newel post, the angled

handrail and the straight handrail.

Straight Slipfix kit

For fitting a straight handrail between two newel posts.

Angled Slipfix kit

For fitting an angled handrail between the bottom and

top newel posts.

Newel post fastener

For securely fitting a newel post into a wood or concrete

base.

All Slipfix stairpart connectors can be found on page 235.Connectors

Quick-Fit latch

The Quick-Fit latch is a simple and clever latch which can be installed in less than 5 minutes without

the need for chiselling. They can be used in conjunction with all lever handles (latch, rose, knob and

privacy). Quick-Fit bathroom bolts are also available and can be found on page 214.

Radius hinges

Radius hinges are an alternative to standard square corner hinges. Their round corners allow doors to

be routered with the use of a jig (TLS0667) instead of chiselled, saving approximately 20 minutes per

door set for the builder.

Quick-Fit latch

Standard striking plate Standard latch

Quick-Fit striking plate5 Mins

or less

to fit

10 Minsor less

to fit

Hardware226|

Fixings

Howdens has a selection of fixings

for every job, including hinges,

shelving and brackets, catches,

worktop accessories and screws.

Our range covers both commercial

and domestic settings.

Fixings

Fire Regulations:




|227

Choose the right hinge

Choosing the right type of hinge

Butt hinges

Butt hinges are basic general purpose hinges, mainly used for

hanging standard doors in low use, domestic applications.

Graded hinges

All our graded hinges are fire rated. Suitable for commercial

applications, typically used on fire doors and heavier standard

doors.

Self closing hinges

Self closing hinges are suitable for commercial applications on

standard or fire doors up to 40kg where controlled door closing is

not required.

Flush hinges

Flush hinges can be used for hanging lightweight internal and

cupboard doors.

Parliament hinges

Parliament hinges are used to hang double doors between two

rooms where doors need to hinge 180° past the lining/casing.

Tee hinges

Tee hinges can be used internally and externally to hang standard

doors, shed doors and gates. The hinge leaf should be 1/3 -1/2 of

the width of the door or gate.

Hooks and bands

Hooks and bands are used to hang large gates and garage doors.

Piano hinges

Piano hinges are used internally, traditionally for cabinet work.

228|

Fixings

Chrome Plated Brass DPBW hinge

Zinc Plated Steel Pattern 5050 hinge

EB Steel Pattern 1838 hinge

6” ZP Sherardized Steel butt hinge (Pattern 5050) HNG0015

3” BK Steel butt hinge (Pattern 1838) HNG0056

3” CP Steel butt hinge (Pattern 1838) HNG0017

3” EB Steel butt hinge (Pattern 1838) HNG0003

3” SC Steel butt hinge (Pattern 1838) HNG0001

3” SN Steel butt hinge (Pattern 1838) HNG0023

3” ZP Steel butt hinge (Pattern 1838) HNG0019

4” BK Steel butt hinge (Pattern 1838) HNG0057

4” CP Steel butt hinge (Pattern 1838) HNG0018

4” EB Steel butt hinge (Pattern 1838) HNG0004


4” SN Steel butt hinge (Pattern 1838) HNG0024




3” EB Steel loose pin butt hinge (Pattern 1840) HNG0007

3” SC Steel loose pin butt hinge (Pattern 1840) HNG0005

3” PB Brass DSW hinge HNG0042

3” SC Brass DSW hinge HNG0046

4” PB Brass DSW hinge HNG0043

3” CP Brass DPBW hinge HNG0061

3” PB Brass DPBW hinge HNG0048

4” CP Brass DPBW hinge HNG0060

Hinges

Sold as single units unless otherwise stated.

Butt hinges Butt hinges are basic general purpose hinges, mainly used for

hanging standard doors in low use, domestic applications.

EB - Electro Brass

SC - Self Coloured

ZP - Zinc Plated

CP - Chrome Plated

BN - Black Nickel

3” CP Steel HNG3033

Ball bearing

Pattern 451 Not supplied with fixings

Pattern 1840 - loose pin Not supplied with fixings

Pattern 5050 Not supplied with fixings

Double Steel washered

Double Phosphor Bronze washered

Pattern 1838Not supplied with fixings

PB - Polished Brass

DPBW - Double Phosphor Bronze Washered

SN - Satin Nickel

BK - Black

|229

Fixings

Satin Stainless Steel washered butt hinge grade 7

Satin Chrome Steel ball bearing butt hinge grade 11

Black Nickel Stainless Steel ball bearing butt hinge grade 7

Graded butt hingesAll our graded hinges are fire rated. Suitable for commercial

applications, typically used on fire doors and heavier standard

doors. All are CE marked.

3” EB Stainless Steel FH FD30 HNG0111

3” Polished Stainless Steel FH FD30 HNG0161

3” Stainless Steel FH FD30 HNG0068

4” EB Stainless Steel FH FD30/FD60 HNG0112

4” Polished Stainless Steel FH FD30/FD60 HNG0160

4” Satin Stainless Steel FH FD30/FD60 HNG0069

Grade 7 - washered

3” BN Stainless Steel FH FD30 HNG0372

3” EB Stainless Steel FH FD30 HNG0371

3” Polished Stainless Steel FH FD30 HNG0085

3” Satin Stainless Steel FH FD30 HNG0370

Grade 7 - ball bearing





4” Polished Stainless Steel FH FD30/FD60 HNG0086

4” Satin Chrome Steel FH FD30/FD60 HNG0029



Graded hinges have different specifications dependent on the

grade that is achieved in testing. It is important to understand

the differences in specification when selecting the hinge to

ensure it is compatible with the door and other hardware being

fitted; ensuring the door does not sag and operates smoothly.

Please see the table and other guidance information below to

select the correct hinge grade for the door mass:

Door closers increase the loading on hinges and the rate at

which they wear.

Door closers without a backcheck increase the door mass by

20%* while door closers with a backcheck increase the door

mass by 75%*1.

Hinges should be selected according to the total mass; actual

door mass plus the mass added by the door closer.

It is recommended that three hinges are used on timber doors

when fitting with a door closer.

*Add 20% to the mass of the actual door

*1Add 75% to the mass of the actual door

Grade Door Mass (kg)

7 40

11 80

13 120

230|

Electro Brass Steel flush hinge

Chrome Plated Steel loose pin hurlinge

Chrome Plated Brass parliament hinge

Fixings

Radius graded ball bearing hinges

Not supplied with fixings

EB - Electro Brass CP - Chrome Plated

PB - Polished Brass NP - Nickel Plated

3” Polished Stainless Steel Grade 7 FH FD30/FD60 HNG0077

3” Satin Stainless Steel Grade 7 FH FD30/FD60 HNG0076

4” Satin Chrome Steel Grade 11 FH FD30/FD60 HNG0078

4” Satin Stainless Steel Grade 13 FH FD30/FD60 HNG0079

Self closing door hinge packsSelf closing hinges are suitable for commercial applications on

standard or fire doors up to 40kg where controlled door closing

is not required. All are CE marked.

4” Satin Stainless Steel (pack of 3) FH FD30/FD60 HNG0430

Intumescent hinge padsRecommended for use when fitting fire door hinges.

Please refer to page 133 for full range of intumescent accessories.

4” Intumescent hinge pads (pack of 6) UK FH FD30/FD60 ITS0030


Flush hingesFlush hinges can be used for hanging lightweight internal and

cupboard doors.

2” CP Steel flush hinge HNG0096

2” EB Steel flush hinge HNG0053

3” CP Steel flush hinge HNG0097

3” EB Steel flush hinge HNG0054


Flush hinges - loose pin hurlinge

3” CP Steel loose pin hurlinge hinge HNG0382

3” EB Steel loose pin hurlinge hinge HNG0352

4” CP Steel loose pin hurlinge hinge HNG0392

4” EB Steel loose pin hurlinge hinge HNG0362

Radius hinge jig UK TLS0667

Parliament hingesParliament hinges are used to hang double doors between two

rooms where doors need to hinge 180° past the lining/casing.

4” CP Brass parliament hinge HNG0098

4” PB Brass parliament hinge HNG0071

|231

Fixings

1¼” x 6’0” NP Steel piano hinge HNG0204

11” Antique Black HNG0022

16” Galvanised Steel HNG0101

Coach bolt and nut M12 x 75mm NAB0002

12” Black Japanned Steel HNG0104




24” Galvanised steel hook and band HNG0110

Paintable with metal primer and metal paint.

Tee hingesTee hinges can be used internally and externally to hang

standard doors, shed doors and gates. The hinge leaf should be 1/3 - 1/2 of the width of the door or gate.

Hooks & bandsHooks and bands are used to hang large gates and garage doors.

Piano hingesPiano hinges are used internally, traditionally for cabinet work.

Antique Black tee hinge

Nickel Plated Steel piano hinge

Galvanised Steel hook and band

232|

Fixings

Ball catch

Brass handrail bracket

Braking castor

Projection 63mm

Brass SAB0055

Projection 63mm

Chrome SAB0056

Projection 76mm

Stainless Steel SAB0053

Projection 63mm

White SAB0051

Ball catch ¾” EB GIR0007

Adjustable roller catch EB GIR0018

Adjustable roller catch NP GIR0019

Brown magnetic catch GIR0331

White magnetic catch GIR0330

Chrome finish cabinet lock GIR0308

Double roller catch BZP GIR0311

Magnetic cupboard lock UK HYH1702

50mm braking castors (pack of 2) HKC0017

50mm non-braking castors (pack of 2) HKC0018

EB - Electro Brass

NP - Nickel Plated

BZP - Bright Zinc Plated

Catches & castors

Catches

Handrail brackets

Castors

|233

Aluminium end cap

Aluminium T-bar joint strip

Corner brace

Fixings

Table Stretcher Plate Self Coloured Steel SAB0010

Corner plate 324 Pattern Self Coloured Steel SAB0030

Aluminium 28mm (8mm radius) UK GIR0031


Aluminium 38mm (6mm/8mm radius) UK HYH2515

Aluminium 38mm square edge UK GIR0129

Black 28mm (8mm radius) UK GIR0032


Black 38mm (6mm/8mm radius) UK GIR0119

Black 38mm square edge UK GIR0114

Chrome Effect 38mm (6mm/8mm radius) UK HYH2506

Adjustable worktop bracket (pack of 1) UK GIR0053

End caps





Matt Silver Effect 38mm (6mm/8mm radius) UK GIR0110

T-bar joint strips



Aluminium 38mm (6mm/8mm radius) UK HYH2510




Chrome Effect 38mm (6mm/8mm radius) UK HYH2505

Joint strips

Worktop accessories

Standard GIR0020

Slim GIR0029Easibolt UK GIR0025

Zipbolt GIR0026

Zip bolt Allen bit TLS0476

Connecting bolts

Corner brace & mending plates

1” SAB0003

2” SAB0004

3” SAB0001

Corner brace 319 Pattern Self Coloured Steel

3” SAB0020

4” SAB0021

6” SAB0022

Mending plate Self Coloured Steel

234|

Newel post fastener GIR0522

3mm x 12mm SCW0523

3mm x 16mm SCW0451

3.5mm x 20mm SCW0452



4mm x 25mm SCW0455

4mm x 30mm SCW0456

4mm x 35mm SCW0457

4mm x 40mm SCW0458

4mm x 50mm SCW0459

4mm x 60mm SCW0475






5mm x 30mm SCW0463

5mm x 40mm SCW0464

5mm x 50mm SCW0465

5mm x 60mm SCW0466

5mm x 70mm SCW0467

5mm x 80mm SCW0468

5mm x 100mm SCW0469

6mm x 50mm SCW0470

6mm x 100mm SCW0472

6mm x 80mm SCW0471

Screws and anchors

Woodscrews - Reisser R2 single thread Yellow

passivated hardened steel (Box of 200)

4mm x 30mm SCW0476

4mm x 40mm SCW0477

4mm x 50mm SCW0478

5mm x 80mm SCW0479

Woodscrews - Reisser R2 single thread Yellow passivated

hardened steel (Large tubs)

Angled Slipfix kit GIR0520 Set includes 2 fixings, screws, 5mm hex driver bit and 5mm allen key

Straight Slipfix kit GIR0521

Set includes 2 fixings, screws and 5mm hex driver bit

Set includes 1 fixing, screws and 6mm hex driver bit

Slipfix stairpart connectors are designed to offer a time-saving

alternative to traditional methods of fitting stair parts. Fitting

can now be a quick and easy one-man job with the fixings

concealed when the fillet strip and spindles are fitted.

Slipfix stairpart connectors

Fixings

Straight Slipfix kit

Angled Slipfix kit

Newel post fastener

|235

Fixings

Reisser Medium assorted box of screws

Reisser medium assorted box of screws SCW0550

Reisser screw box trade pack SCW0557

Woodscrews - Reisser R2 single thread

Bright Zinc plated

(Box of 200)

3mm x 12mm SCW0522

Lost head nails steel

(1kg box)

40mm FIX0090

65mm FIX0091

Kitchen hinge screws

Box of 200 HKC0024

Woodscrews - Reisser R2 Retinox single

thread Stainless Steel (Box of 200)


4mm x 30mm SCW0521

20mm FIX0065

25mm FIX0066

30mm FIX0067

Panel pins steel

(250g box)

Woodscrews - Reisser R2 single thread

Bright Zinc plated (Box of 200)

7mm x 1” SCW0020

8mm x 1¼” SCW0031

Paslode Gun nail packs

(Pack of 2,000 with 2 x 30ml fuel cells)

Galvanised angled brads 32mm FIX0220





Galvanised straight brads 32mm FIX0230





Panel pins

Reisser Medium assorted box of screws

Paslode gun nail packs

236|

Fixings

Anchors

BZP - Bright Zinc Plated

Brown plastic plugs (box of 100) FIX0002

Red plastic plugs (box of 100) FIX0001

Anchors

Plasterboard cavity fixing BZP (box of 100) FIX0121

Frame fixings M10 x 100mm (box of 10) SCW0920






Concrete frame screws 7.5mm x 102mm (box of 100) SCW0931





Plasterboard cavity fixings

Kitchen screws

Brown plastic plugs

|237

Tools and accessories

Howdens has a selection of tools to

complete any job, from router cutters to

saws, screwdrivers to clamps. We also

supply a wide range of sealants and

adhesives, stains and varnishes.

Fire Regulations:




Tools & accessories238|

Tools

Worktop jigs and accessoriesCurved worktop jig (suitable for concave curves) UK TLS0645

65 Worktop jig UK TLS0600

1001 Worktop jig UK TLS0601

Lamona Stainless Steel 1.5 bowl undermount worktop jig UK TLS0646

Lamona ceramic 1.5 bowl undermount worktop jig UK TLS0647

Lamona Stainless Steel single bowl undermount worktop jig UK TLS0648

Lamona granite composite 1.5 bowl undermount worktop jig UK TLS0649

Jig pegs (pack of 4) UK TLS0605

Worktop biscuits (pack of 50) WRK4010

Universal sub-base UK TLS0602

Guide bush 30mm TLS0603

Unika double sided worktop tape GAR0415

Quartz and Granite worktop tools and accessoriesVacuum brazed dry diamond holesaw M14 35mm TLS1010

Diamond granite blade 150mm TLS1011

Vacuum brazed drum M14 70/80 grit 20mm TLS1012



Dry diamond polishing drums M14 50mm (pack of 7) TLS1036

Dry diamond polishing pads M14 100mm (pack of 9) TLS1014

Rubber backing pad M14 100mm (to fit TLS1014) TLS1013

Drainer groove wheel vacuum brazed 50 grit 12mm TLS1037

Drainer groove flute polishing wheels (pack of 6) TLS1038

Vacuum brazed diamond holesaw 50mm TLS0474

Drainer groove jig UK TLS0662

Makita grinder guide UK TLS0664

M14 to Hex drill spindle adapter TLS1015

500mm Base cabinet support rail UK TLS1022



800mm Drawer base cabinet support rail UK TLS1024



450mm Appliance support rail UK TLS1029

600mm Appliance support rail UK TLS1026

600mm Oven support rail UK TLS1027

600mm Fridge support rail UK TLS1028

SenGuard NF anti-stain protection 375ml TLS1040

White solid granite jointing compound 125ml UK WOR9040

Black solid granite jointing compound 125ml UK WOR9041

Everbuild Everflex premium silicone/frame sealant Clear 310ml UK GAR0117

Everbuild Everflex premium silicone/frame sealant Black 310ml UK GAR0112

Granite worktop cleaner 500ml UK TLS1016

Plastic packing shims assorted sizes (pack of 100) UK TLS0895

Dust mask FFP3 UK TLS1018

Worktop jigs

Granite worktop accessories

Jointing compound and sealants

Tools & accessories |239

Drill and screwdriver bitsHowdens 10 piece drill bit set TLS0130

Kitchen drill bit pack TLS9991

Wera Bi-Torsion screwdriver bit PZ2 (pack of 2) TLS0141

Wera Bi-Torsion screwdriver bit PZ2 (pack of 10) TLS0139

Irwin flat bit 16mm TLS0110






Masonry drill bits 6mm TLS0124

Masonry drill bits 7mm TLS0125

Irwin Impact driver bits - Pack of 20 TLS0143

Irwin Impact driver bits - Holder TLS0144

Flat bit 1” (25mm) 7mm centre point TLS0475

Irwin flat bit 8 piece set TLS0115

Irwin 7 piece multi-purpose drill bit set TLS0117

Router cutters

Trend TR17D 12.7mm straight cutter TLS0639

Trend TR17D 12.7mm straight cutter (pack of 3) TLS0655

Trend 2 flute 12.7mm straight cutter TLS0642

Trend 35mm hinge boring bit TLS0665

Trend TR32 multi profile cutter TLS0098

Trend TR40D 15mm intumescent strip cutter TLS0615

Trend TR41 10mm intumescent strip cutter TLS0095

Trend TR42 15mm intumescent strip cutter TLS0096

Trend PBR03 ¼” Size 0, 10 and 20 biscuit cutter TLS0089

Bearing guided Ovolo cutter 3mm TLS0670

Bearing guided chamfer cutter 45° TLS0671

Drill bits

Router cutters

Jigsaw blades


Jigsaw bladesReisser (T101B) for wood and board materials 3-30mm (pack of 5) TLS0450

Reisser (T111C) for wood and board materials 5-50mm (pack of 5) TLS0451

Reisser (T119B) for softwood, plywood, chipboard and fibreboard 2-15mm (pack of 5) TLS0452

Reisser (T114D) for wood and board materials 5-50mm and soft plastics less than 50mm (pack of 5) TLS0453

Reisser (T101BR) for wood and board materials including laminates 3-30mm and soft plastics less than 30mm (pack of 5) TLS0454

SawsIrwin Drywall saw 6½” TLS0480

Irwin hacksaw 12” TLS0483

Irwin BiMetal hacksaw blades (pack of 2) TLS0484

Irwin junior hacksaw 6” TLS0481

Irwin junior hacksaw blades (pack of 10) UK TLS0482

Bahco hard point medium saw 22” TLS0488

Bahco hard point fine saw 22” TLS0487

Spear & Jackson hard point 22” TLS0002

Irwin Jack universal saw 20” TLS0015

Bahco coping saw 6” TLS0013

Bahco coping saw blades (pack of 5) TLS0014

Tenon saw TLS0019

Laminator saw TLS0025

190mm circular saw blade TLS0457

160mm plunge saw blade TLS1048

165mm plunge saw blade TLS1049

216mm mitre saw blade TLS0456

Trend planer blades (pair) TLS0455

HammersEstwing claw hammer 16oz TLS0040

Estwing claw hammer 20oz TLS0041

KnivesIrwin Folding Knife TLS0314

Irwin Replacement Blades (pack of 10) TLS0325

Stanley Fat Max instant change retractable blade knife TLS0320†

Stanley Fat Max knife blades (pack of 10) UK TLS0322†

BradawlStanley bradawl TLS0082

ScrewdriversStanley screwdriver PZ1 TLS0223

Stanley screwdriver PZ2 TLS0224

Stanley screwdriver PZ3 TLS0225

Stanley screwdriver PZ2 extra long TLS0226

Stanley screwdriver flare tip 100mm TLS0227



Stanley ratchet stubby screwdriver multi bit TLS0230


Saws

Hammers

Wood chisels


Tools & accessories

Wood chiselsIrwin Marples soft touch chisel 6mm TLS0180

Irwin Marples soft touch chisel 10mm TLS0181






Irwin Marples soft touch 5 piece chisel set TLS0087

Irwin Marples split-proof 6 piece chisel set TLS0196

SharpeningTrend fast track diamond sharpening stone honing system UK TLS9888

Trend replacement stone 120 grit diamond TLS9889

Trend replacement stone 220 grit diamond TLS9890

ClampsIrwin quick release clamp 6” (pack of 2) TLS0340

Irwin quick release clamp 12” (pack of 2) TLS0341

Solo trigger G clamp 6” UK TLS0358

Spirit levelsStabila spirit level 24” TLS0067

Stabila spirit level 48” TLS0066

Stabila spirit level 71” TLS0065

Measuring tapeStanley Fat Max tape 8m TLS0061

Combination squares

Stanley combination square 12” UK TLS0062

FinishingStanley fine grade finishing file TLS0240

P60 coarse Aluminium Oxide sandpaper roll 115mm x 5m TLS0510

P80 medium Aluminium Oxide sandpaper roll 115mm x 5m TLS0511

P120 fine Aluminium Oxide sandpaper roll 115mm x 5m TLS0512

Masking tape (25mm x 50m) TLS0967

Masking tape (50mm x 50m) TLS0961

Multi-purpose tape (50mm x 50m) SDH0930

Frog tape TLS0968

Clamps

Spirit levels & measuring tape

Sharpening system

242|

Tools & accessories

Decorating accessories

Paint brushesHarris paint brush 1” TLS0962

Harris paint brush 2” TLS0963

Harris paint brush 3” TLS0964

Harris mini roller set TLS0965

Harris mini roller sleeves (pack of 10) TLS0966

PackersPlastic packing shims assorted sizes (pack of 300) UK TLS0890

CleaningBlue paper roll 2 ply 135m TLS9950

Everbuild adhesive removal wipes (pack of 100) UK TLS9943

Everbuild adhesive removal spray 1 litre GAR0070

ProtectionRoll and Stroll carpet protector roll 25m GAR9200

Roll and Stroll hard surface protector roll 25m GAR9201

Cotton twill dustsheet 12’ x 9’ TLS0910

GeneralCanvas tool bag 24” TLS9905

Kitchen fitters pack TLS9990

Roughneck door lifter TLS0659

Rubble sacks (5 pack) TLS9945

Door finger protector NEW TLS0820

Door stand NEW TLS0657

Winbag airbag (pack of 2) TLS0627

Howdens branded Box TLS9989

Oils, stains, varnishes and primersDoors finishing matrix can be found on page 270.

Oils & coatingHJ worktop wax oil 1 litre WRK4015

Prime worktop oil 1 litre WRK3595

Rustins Danish oil 1 litre UK GAR0125

Rustins plastic coating and hardener gloss 1 litre UK GAR0580

Grey worktop tint wax oil GAR0126

Osmo door oil GAR0542

Osmo tinted oil graphite - 500ml GAR0545

Osmo tinted oil terra - 500ml GAR0544

Osmo tinted oil white - 500ml GAR0543

Osmo top oil clear matt - 500ml GAR0546

Kitchen fitters pack

Paint brushes

Danish oil

|243

Interior stain and varnishSadolin English Oak interior stain 750ml UK GAR0536

Sadolin interior varnish satin 1 litre UK GAR0539

Exterior stains and varnishesSadolin Clear exterior base coat 1 litre UK GAR0530

Sadolin Mahogany exterior stain 1 litre UK GAR0531

Sadolin Dark Oak exterior stain 1 litre UK GAR0532

Sadolin Heritage Oak exterior stain 1 litre UK GAR0533

Sadolin Walnut exterior stain 1 litre UK GAR0534

Sadolin Clearcoat exterior varnish satin 1 litre UK GAR0510

Sadolin Clearcoat exterior varnish gloss 1 litre UK GAR0511

PrimerMacpherson primer/undercoat 2.5 litre STN0805

Adhesives & sealants

Skeleton gun

Skeleton gun for use with 290/310/350mm tubes GAR0200

Howdens Joinery bath and sanitary siliconeHJ White 310ml UK GAR0105

HJ Clear 310ml UK GAR0106

HJ Cream 310ml UK GAR0124

Premium silicone/frame sealantEverbuild Everflex White 310ml UK GAR0115

Everbuild Everflex Brown 310ml UK GAR0116

Everbuild Everflex Clear 310ml UK GAR0117

Everbuild Everflex Black 310ml UK GAR0112

Howdens Joinery general purpose siliconeHJ White 310ml UK GAR0120

HJ Cream 310ml UK GAR0119

HJ Brown 310ml UK GAR0121

HJ Clear 310ml UK GAR0122

HJ Grey 310ml UK GAR0118

HJ Black 310ml UK GAR0123

Intumescent masticAstro Flame White 310ml UK ITS0020

Howdens Joinery decorators caulkHJ White solvent free 310ml UK GAR0305

HJ Cream solvent free 310ml UK GAR0302

Expanding FoamsHJ fix and fill expanding foam 750ml GIR0077

HJ gun grade expanding foam 750ml GIR0078

Everbuild hand held B1 fire rated expanding foam 750ml GIR0088

P45 Gun applicator for HJ foams GIR0079

Everbuild PU foam gun cleaner 500ml UK GIR0086

Oils, stains, varnishes & primers

Skeleton gun

Silicone products


General adhesivesEvo-Stik Sticks Like White 290ml UK GAR0053

Evo-Stik Sticks Like Clear 290ml UK GAR0063

Everbuild Stixall adhesive & sealant White 300ml UK GAR0065

Everbuild Stixall adhesive & sealant Clear 300ml UK GAR0066

Evo-Stik Gripfill solvent based 350ml UK GAR0055

Evo-Stik Gripfill solvent free 350ml UK GAR0056

Everbuild Pink Grip solvent based 350ml UK GAR0160

Everbuild Pink Grip solvent free 350ml UK GAR0161

Evo-Stik contact adhesive solvent based 65g UK GAR0062

Evo-Stik contact adhesive solvent based 250ml UK GAR0059

Evo-Stik contact adhesive solvent free 250ml UK GAR0058

Unika double sided worktop tape GAR0415

Mitre pen pack with 1 adhesive (50g) UK GAR0381

Mitre bond adhesive 50g and aerosol activator 200ml UK GAR0365

Flooring adhesives & sealantsEverbuild Lumberjack adhesive applicator gun UK SDH3182

Everbuild Lumberjack adhesive pack for gun (12 x 600ml cartridges) UK SDH3181

SikaBond 54 wood floor adhesive (13kg tub) SDH3176

Flooring adhesive trowel SDH0912

Unika Clicseal flooring joint sealer 125ml SDH0099

Unika Beech colour sealant 310ml SDH0090

Unika Medium Oak colour sealant 310ml SDH0091

Unika Ochre Burl colour sealant 310ml SDH0095

Unika Light Grey colour sealant 310ml SDH0097

Wood adhesivesEverbuild Lumberjack PU expanding wood adhesive 750g UK GAR0057

Evo-Stik wood adhesive 1 litre UK GAR0001

Evo-Stik weatherproof wood adhesive 1 litre UK GAR0050

HJ Weatherproof wood adhesive 1 litre UK GAR0003

HJ Weatherproof wood adhesive 500ml UK GAR0004

Wood fillersEverbuild stainable wood filler light 250ml UK GAR0081

Everbuild stainable wood filler medium 250ml UK GAR0082

Everbuild 2 part stainable wood filler light 500g UK GAR0083

Everbuild 2 part stainable wood filler medium 500g UK GAR0084

General purpose fillerEverbuild all purpose powder filler 1.8kg UK GAR0085

Everbuild One Strike ready mixed filler 1 litre UK GAR0086

Care kitsKitchen door care kit GIR0982

Tewkesbury Stone kitchen door care kit GIR0986

Tewkesbury Skye kitchen door care kit GIR0985

Tewkesbury Blue kitchen door care kit GIR0987

Flooring care kit SDH0715

Gloss surface cleaner 150ml UK GIR0981

WD40 450ml TLS0970

Repair kit - Pre-finished hardwood door NEW GAR0540

Repair kit - Pre-finished moulded door NEW GAR0541

Expanding foams

Flooring adhesives & sealants

Wood fillers


Kitchen overview

In addition to doors, joinery,

hardware and flooring, Howdens

Joinery offers over 70 inspirational

kitchens plus a full range of

accessories, worktops, sinks, taps

and a wide variety of Lamona

appliances exclusive to Howdens.

For full details please refer to The

Kitchen Collection brochure or visit

our website at www.howdens.com

Bring kitchens to life on the Howdens

website. You can learn more through

our collection of movies at

www.howdens.com/

advice-inspiration/movies

Kitchen overview246|

T h e U n i v e r s a l C o l l e c t i o n

In virtually any kitchen, this simple slab door design works perfectly. Whether you're aiming for a sleek, clean look,

or want something purely functional, you can adapt The Universal Collection to suit your style.

This range is versatile and capable of customisation, with handles and colour combinations, hence the name

Universal.

There are 3 families within this collection - Glendevon, Greenwich Gloss and Greenwich.

The Kitchen Collection |247

T h e S h a k e r C o l l e c t i o n

From urban chic to country classic, The Shaker Collection makes any style of kitchen possible. Choose your

finish - wood grain, super matt or gloss - to create a modern or traditional feel.

There are 8 families within this collection - Tewkesbury Framed, Tewkesbury, Burford Gloss, Burford Tongue & Groove,

Fairford, Burford, Allendale and Greenwich Shaker.

The Kitchen Collection 248|

T h e C o n t e m p o r a r y C o l l e c t i o n

Integrated handles and a super-smooth finish give The Contemporary Collection the purest of clean lines.

This is a modern design with understated elegance - and in a wide range of soft, subtle colours.

There are 3 families within this collection - Bayswater, Clerkenwell Gloss and Clerkenwell Super Matt.

The Kitchen Collection |249

Our commitment

Over 75% of the products we

supply to the builder are timber

or timber based. Howdens Joinery

is committed to ensure all timber

based products come from legally

harvested sources and where

possible we look to purchase

through certified sources. 100% of

wood-based material used in our

manufacturing processes are from

FSC® certified sources.

For more details, please visit

www.howdens.com/about-us/

corporate-social-responsibility

Regulations

Fire Regulations:




250|

The following is a guide to the regulations that apply to selected joinery products. Door ranges that

include products conforming to these regulations will be marked with the relevant icon.

Door regulations

Fire doors (FD)

Howdens doors are tested to BS 476: Part 22: 1987 achieving fire resistance up to

30 minutes (FD30) or 60 minutes (FD60) when hung and installed in accordance with

the instructions provided with the door. Our fire doors are supported by third party test

evidence, assessment or certification schemes.

Part E doors (E) - sound reducing

Doors which conform to Building Regulation Part E help to minimise sound travel,

providing a peaceful and quiet environment.

Essential fire door hardware (FH)

Howdens essential fire door hardware is tested to perform against fire regulations and

legislation, and has test evidence to support this for presentation to a Building Control

Inspector. These items of hardware are classed as essential, to ensure that the fire resisting

door stays closed in its frame in a fire emergency, and include items such as door closers,

hinges and latches. Other items which do not alter the integrity or performance of the

door would be classed as non-essential and do not require test evidence (see FH below).

Any hardware listed in a fire doors data sheet is essential to that door. This includes

intumescent strips and glazing systems.

Non-essential fire door hardware (FH)

Howdens hardware includes a range of products suitable for use on fire doors, which does

not require test evidence to support this for presentation to a Building Control Inspector.

These items of hardware are classed as non-essential, and consist of face fixed products

that do not affect the integrity of the fire door, and in no way impede or reduce the door's

ability to withstand fire attack for the specified time. These products include items such

as fingerplates, kickplates and signage. Although these items do not require test evidence

like essential fire door hardware, careful selection is still needed, as often holes are drilled

through timber fire doors or large metal components are attached, which can invalidate a

fire door test certificate.

Part M doors (M) - mobility and access

For access and facilities for disabled people, wider doors and reduced threshold heights

are required by Building Regulation Part M (selected sizes only).

Part L doors (L) - warmth & insulation suitable for new build

Doors carrying Building Regulation Part L have a greater thermal efficiency and help to keep

rooms warm and cosy. Suitable for most new build and extension projects. A U-Value of

2.00 W/m2 K or better is achieved by these products, when fitted with an approved frame in

accordance with instructions.

Part L doors (L) - warmth & insulation suitable for refurbishment projects

Doors carrying Building Regulation Part L have a greater thermal efficiency and help to keep

rooms warm and cosy. Suitable for most refurbishment projects where both door and frame

are being replaced.

A U-Value of 1.80 W/m2 K or better is achieved by these products, when fitted with an

approved frame in accordance with instructions.

These regulatory specifications are correct at the time of going to press, and are subject to fitting in accordance with relevant guidelines.

FD

FH

E

L

M

L

FH

Regulations |251

Howdens Joinery supplies high quality doors, joinery and hardware to trade customers from stock.

When professionally installed, these products will provide many years of reliable use.

Our commitment – We work closely with our suppliers to ensure that the items we purchase come

from sustainable, renewable resources and are produced in a socially responsible way. Howdens

Joinery has successfully achieved the Forest Stewardship Council® (FSC®) and the Programme for

the Endorsement of Forest Certification™ (PEFC™) Chain of Custody certificates, which apply to a

number of products as indicated in this brochure by F for FSC® P for PEFC™.

The Chain of Custody certification means there is an unbroken and documented chain of ownership

all the way from the forest, via the mill, the importer, the manufacturer and the supplier to the end

user. Our full environmental policy is available on request.

Forest Stewardship Council® (F) – The Forest Stewardship Council® (FSC®) is an international

network designed to promote responsible management of the world's forests.

Programme for the Endorsement of Forest Certification™ (P) – The Programme

for the Endorsement of Forest Certification™ (PEFC™) is a framework for the recognition of

forest certification schemes meeting internationally recognised requirements for sustainable forest

management.

UK Manufactured (UK) – Howdens Joinery is a British business. We pride ourselves on the sense of

local community, traditional values and long established relationships that thrive in our depots and

manufacturing facilities. This logo UMANUFACTURED

or UK indicates that the products illustrated are manufactured

and assembled in the UK.

British Standards (BS) – In all instances it is good practice to fit British Standard approved

locks to all of your external doors. In many cases this is an insurance company requirement and may

reduce your premium. Approved locks carry the BSI Kitemark™ and are approved to either BS 3621:

2007 or BS EN 1303: 2005, rigorous test standards to which the locks must perform.

BS 3621: 2007 – A well established product standard for thief resistant locks in the UK. Locks tested

to BS 3621: 2007 must exceed a minimum level of performance and be subjected to a general

vulnerability assessment to enable the product to be Kitemark™ by BSI.

Standards and accreditations

Standards & accreditations252|

BS EN 1303: 2005 – The product standard for thief resistant cylinders for locks in the UK. Locks

tested to BS EN 1303: 2005 must pass various performance and vulnerability assessments to

enable the product to be KitemarkTM by BSI.

BS EN 1154: 1997 – The required standard to test to, in order to attain CE marking for controlled

door closing devices.

BS EN 1125: 2008 – Applies to panic exit devices where the exit door is used by the public and

provides safe and effective escape through the doorway. The emphasis of products covered by this

standard is the safe exit, rather than security.

BS EN 179: 2008 – Applies to emergency applications where the exit door is used by people who

‘are familiar with the emergency exit and its hardware, and therefore a panic situation is unlikely

to occur.’

Secured by Design (SBD) – Secured by Design is the official police initiative to guide and encourage

those engaged within the specification, design and build of new homes to adopt crime prevention

measures. Secured by Design focuses on reducing crime in homes and commercial premises and

promotes the use of security standards to ensure products help to achieve this. The objective is to

reduce burglary and crime in the UK by designing out crime through physical security and processes.

Where a product is shown with the Secured by Design logo you have the reassurance that the product

has been tested to the highest relevant standard for security.

Guild of Architectural Ironmongers (GAI) – Howdens Joinery is an affiliate member of the

Guild of Architectural Ironmongers (GAI) ensuring the highest professional standards are achieved

and ongoing commitment to quality assurance.

Standards & accreditations |253

Doors,hardware & flooring overview

Fire Regulations:




Doors, hardware& flooring overview

A comprehensive guide to our full

range of internal and external doors,

handles, fire rated hardware and

flooring accessories.

254|

Howdens range of doors

Internal doors

External doors

We offer a comprehensive range of internal and external doors that is sure to meet all your requirements.

To help you find the perfect door for your home, visit our door visualiser at

www.howdens.com/advice-inspiration/door-visualiser


pages 08 to 30


pages 102 to 115


pages 31 to 38

External softwood doors

pages 116 to 119

Internal primed stile

and rail doors

pages 39 to 46


pages 120 to 123


pages 47 to 73


pages 74 to 90


pages 95 to 100

Garage doors

pages 124 to 125

Doors Overview |255



Imperial sizes 35mm, Metric sizes 40mm, Fire doors 44mm (excluding 35mm Fire doors).

All external doors conform to the following thicknesses: Standard and FD30 44mm, FD60 54mm.

Pre-finished Dordogne Smooth

Pre-finished 6 panel grained

Burford 4 panel

4 Panel Shaker smooth

Linear smooth

Arched top grained

Imperial (inch)

6'6" x 1'3"

6'6" x 1'6" DIM1610 UK F DIM1210 UK F DIC9810 UK F DIC0728 UK F6'6" x 1'9" DIM1620 UK F DIM1220 UK F DIC9820 UK F DIM1020 UK F DIC0729 UK F6'6" x 2'0" DIM1630 UK F DIM1230 UK F DIC9830 UK F DIM1030 UK F DIM1430 UK F DIC0730 UK F6'6" x 2'3" DIM1640 UK F DIM1240 UK F DIC9840 UK F DIM1040 UK F DIM1440 UK F DIC0740 UK F6'6" x 2'4" DIM1650 UK F DIM1250 UK F DIM1050 UK F6'6" x 2'6" DIM1660 UK F DIM1260 UK F DIC9860 UK F DIM1060 UK F DIM1460 UK F DIC0760 UK F6'6" x 2'9" DIM1670 UK F M DIM1270 UK F M DIC9870 UK F M DIM1070 UK F M DIM1470 UK F M DIC0770 UK F M 6'6" x 2'10"

6'8" x 2'8" DIM1680 UK F M DIM1280 UK F M DIC9880 UK F M DIM1080 UK F M

Metric (mm)

2040 x 526

2040 x 626 DIM1730 UK F DIM1530 UK F DIC8530 UK F DIM1130 UK F2040 x 726 DIM1740 UK F DIM1540 UK F DIC8540 UK F DIM1140 UK F2040 x 826 DIM1760 UK F M DIM1560 UK F M DIC8560 UK F M DIM1160 UK F M2040 x 926 DIM1770 UK F M DIM1570 UK F M DIC8570 UK F M DIM1170 UK F M

Developer door

imperial

6'6" x 2'0"

6'6" x 2'3"

6'6" x 2'6"

6'6" x 2'9"

Firecheck FD30

imperialFire door

6'6" x 2'0"

6'6" x 2'3" DGM1640 UK P E DIF8140 UK P E DIF2640 UK P E DFM1040 UK P DFM1440 UK P E6'6" x 2'6" DGM1660 UK P E DIF8160 UK P E DIF2660 UK P E DFM1060 UK P DFM1460 UK P E6'6" x 2'9" DGM1670 UK P M E DIF8170 UK P M E DIF2670 UK P M E DFM1070 UK P M DFM1470 UK P M E6'8" x 2'8"

Firecheck FD30 metric

Fire door

2040 x 526

2040 x 626 DFM1130 UK P2040 x 726 DFM1140 UK P2040 x 826 DFM1160 UK P M2040 x 926 DFM1170 UK P M

Firecheck FD30 35mm

imperialFire door

6'6" x 2'3"

6'6" x 2'6"

6'6" x 2'9"

6'8" x 2'8"

Glazed imperial

6'6" x 2'0"

6'6" x 2'3" DGM2040 F UK DGM1940 F UK DIC9140 UK F DGM1840 UK F DGM1540 UK F6'6" x 2'6" DGM2060 F UK DGM1960 F UK DIC9160 UK F DGM1860 UK F DGM1560 UK F6'6" x 2'9" DGM2070 F UK M DGM1970 F UK M DIC9170 UK F M DGM1870 UK F M DGM1570 UK F M6'8" x 2'8"

Glazed metric

2040 x 626

2040 x 726

2040 x 826

2040 x 926

Bi-Fold imperial

6'6" x 2'3"

6'6" x 2'6"

Doors overview256|


Dordognesmooth

4 Panel smooth

6 Panel smooth

4 Panelgrained

6 Panelgrained

Imperial (inch)

6'6" x 1'3" DIC0900 UK F6'6" x 1'6" DIC8310 UK F DIC7410 UK F DIC1010† UK F DIC2010 UK F DIC0910 UK F6'6" x 1'9" DIC8320 UK F DIC7420 UK F DIC1020† UK F DIC2020 UK F DIC0920 UK F6'6" x 2'0" DIC8330 UK F DIC7430 UK F DIC1030 UK F DIC2030 UK F DIC0930 UK F6'6" x 2'3" DIC8340 UK F DIC7440 UK F DIC1040 UK F DIC2040 UK F DIC0940 UK F6'6" x 2'4" DIC8350 UK F DIC2050 UK F DIC0950 UK F6'6" x 2'6" DIC8360 UK F DIC7460 UK F DIC1060 UK F DIC2060 UK F DIC0960 UK F6'6" x 2'9" DIC8370 UK F M DIC7470 UK F M DIC1070 UK F M DIC2070 UK F M DIC0970 UK F M6'6" x 2'10" DIC0990 UK F M6'8" x 2'8" DIC8380 UK F DIC7480 UK F M DIC2080 UK F M DIC0980 UK F M

Metric (mm)

2040 x 526 DIC1921 UK F2040 x 626 DIM1330 UK F DIC1831 UK F DIC1931 UK F2040 x 726 DIM1340 UK F DIC1841 UK F DIC1941 UK F2040 x 826 DIM1360 UK F M DIC1861 UK F M DIC1961 UK F M2040 x 926 DIM1370 UK F M DIC1871 UK F M DIC1971 UK F M

Developer door

imperial

6'6" x 2'0" DIC3930 UK P6'6" x 2'3" DIC3940 UK P6'6" x 2'6" DIC3960 UK P6'6" x 2'9" DIC3970 UK P M

Firecheck FD30

imperialFire door

6'6" x 2'0" DIF2930 UK P E DIF0631 UK P E DIF0531 UK P E6'6" x 2'3" DIF7340 UK P E DIF2940 UK P E DIF1040 UK P E DIF0641 UK P E DIF0541 UK P E6'6" x 2'6" DIF7360 UK P E DIF2960 UK P E DIF1060 UK P E DIF0661 UK P E DIF0561 UK P E6'6" x 2'9" DIF7370 UK P M DIF2970 UK P M E DIF1070 UK P M E DIF0671 UK P M E DIF0571 UK P M E6'8" x 2'8" DIF2980 UK P M E DIF0681 UK P M E DIF0580 UK P M E


Fire door

2040 x 526 DIF0920 UK P E2040 x 626 DIF2330 UK P E DIF0930 UK P E2040 x 726 DIF2340 UK P E DIF0940 UK P E2040 x 826 DIF2360 UK P M E DIF0960 UK P M E2040 x 926 DIF2370 UK P M E DIF0970 UK P M E

Firecheck FD30 35mm

imperialFire door

6'6" x 2'3" DIF5440† UK P6'6" x 2'6" DIF5460 UK P6'6" x 2'9" DIF5470 UK P M6'8" x 2'8" DIF5480 UK P M

Glazed imperial

6'6" x 2'0" DGM1230 UK F6'6" x 2'3" DGM1640 UK F DGM1440 UK F DGM1240 UK F6'6" x 2'6" DGM1660 UK F DGM1460 UK F DGM1260 UK F6'6" x 2'9" DGM1670 UK F M DGM1470 UK F M DGM1270 UK F M6'8" x 2'8" DGM1280 UK F M

Glazed metric

2040 x 626 DGM1330 UK F2040 x 726 DGM1340 UK F2040 x 826 DGM1360 UK F M2040 x 926 DGM1370 UK F M

Bi-Fold imperial

6'6" x 2'3" DIP0240 UK F DIP0140 UK F6'6" x 2'6" DIP1060 UK F DIP0260 UK F DIP0160 UK F

†Subject to availability Doors overview |257


8 Light Clear Pine

glazed

Pattern 10 Clear Pine glazed

Downham Clear Pine glazed

6 PanelClear Pine

4 PanelClear Pine

4 Panel Knotty Pine

Imperial (inch)

6'6" x 1'3"

6'6" x 1'6"

6'6" x 1'9"

6'6" x 2'0" DIS1330 F DIS3430 F DIS2630†

6'6" x 2'3" DIS1340 F DIS3440 F DIS2640†

6'6" x 2'4"

6'6" x 2'6" DIS1360 F DIS3460 F DIS2660†

6'6" x 2'9" DIS1370 F M DIS3470 F M DIS2670† M6'6" x 2'10"

6'8" x 2'8" DIS3480 F M

Metric (mm)

2040 x 526

2040 x 626 DIS1730† F2040 x 726 DIS1740† F DIS3640 F2040 x 826 DIS1780† F M DIS3680 F M2040 x 926

Firecheck FD30

imperialFire door

6'6" x 2'0"

6'6" x 2'3" DFD25406'6" x 2'6" DFD25606'6" x 2'9" DFD25706'8" x 2'8"

Glazed imperial

6'6" x 2'0" DIS3830† F6'6" x 2'3" DIS3840† F DIS3240 F6'6" x 2'6" DIS3860† F DIS2860† F DIS3960† F DIS3260 F6'6" x 2'9" DIS3870† F M DIS2870† F M DIS3970† F M DIS3270 F M6'8" x 2'8" DIS3280 F M

Glazed metric

2040 x 626

2040 x 726 DIS3241 F2040 x 826 DIS3261 F M2040 x 926

Internal primed doors

PrimedDordogne

Primed LinearPrimed 4 panel Shaker

Primed Worcester

Imperial (inch)

6'6" x 1'3"

6'6" x 1'6"

6'6" x 1'9"

6'6" x 2'0" DIR1330 DIR1530 DIR1230 DIR11306'6" x 2'3" DIR1340 DIR1540 DIR1240 DIR11406'6" x 2'4"

6'6" x 2'6" DIR1360 DIR1560 DIR1260 DIR11606'6" x 2'9" DIR1370 M DIR1570 M DIR1270 M DIR1170 M6'6" x 2'10"

6'8" x 2'8"

Firecheck FD30

imperialFire door

6'6" x 2'0"

6'6" x 2'3" DFD1340 DIF8640 DIF8340 DIF84406'6" x 2'6" DFD1360 DIF8660 DIF8360 DIF84606'6" x 2'9" DFD1370 M DIF8670 M DIF8370 M DIF8470 M6'8" x 2'8"

Glazed imperial

6'6" x 2'0"

6'6" x 2'3" DGT1340 DGT1240 DGT11406'6" x 2'6" DGT1360 DGT1260 DGT11606'6" x 2'9" DGT1370 M DGT1270 M DGT1170 M6'8" x 2'8"

†Subject to availabilityDoors overview258|


Solid Rustic Oak ledgedPre-finished Linear

Oak4 Panel Oak Linear Oak

Worcester Oak

Imperial (inch)

6'6" x 1'3"

6'6" x 1'6" DIE2210 6'6" x 1'9" DIE2220 6'6" x 2'0" DIE3430 DIE7130 DIE4030 DIE2230 DIC64306'6" x 2'3" DIE3440 DIE7140 DIE4040 DIE2240 DIC64406'6" x 2'4" DIE2250 6'6" x 2'6" DIE3460 DIE7160 DIE4060 DIE2260 DIC64606'6" x 2'9" DIE3470 M DIE7170 M DIE4070 M DIE2270 M DIC6470 M6'6" x 2'10"

6'8" x 2'8" DIE4080† M DIE2280 M

Metric (mm)

2040 x 526

2040 x 626 DIE4460 DIE9130 2040 x 726 DIE4470 DIE9140 2040 x 826 DIE4480 M DIE9160 M2040 x 926 DIE4490 M DIE9170 M

Firecheck FD30

imperial Fire door

6'6" x 2'0"

6'6" x 2'3" DIF9540 DFD4040 DFD3940 DFD65406'6" x 2'6" DIF9560 DFD4060 DFD3960 DFD65606'6" x 2'9" DIF9570 M DFD4070 M DFD3970 M DFD6570 M6'8" x 2'8"


Fire door

2040 x 526

2040 x 626

2040 x 726 DFD44702040 x 826 DFD4480 M2040 x 926 DFD4490 M

Firecheck FD30 35mm

imperialFire door

6'6" x 2'3"

6'6" x 2'6"

6'6" x 2'9"

6'8" x 2'8"

Glazed imperial

6'6" x 2'0"

6'6" x 2'3" DIE4140 DIE2840 DIC65406'6" x 2'6" DIE4160 DIE2860 DIC65606'6" x 2'9" DIE4170 M DIE2870 M DIC6570 M6'8" x 2'8"

Glazed metric

2040 x 626

2040 x 726 DIE4570 DIE92402040 x 826 DIE4580 M DIE9260 M2040 x 926

Bi-Fold imperial

6'6" x 2'3" DIP1349 P6'6" x 2'6" DIP1369 P



4 Panel Shaker Oak

Dordogne Oak

Burford 4 Panel Oak

Victorian 4 Panel Oak

Westlock OakPre-finished Holdenby

Oak

Imperial (inch)

6'6" x 1'3" DIE46006'6" x 1'6" DIE46106'6" x 1'9" DIE46206'6" x 2'0" DIE5130 DIE6630 DIE7730 DIE2530 DIE88306'6" x 2'3" DIE5140 DIE6640 DIE7740 DIE2540 DIE88406'6" x 2'4" DIE46506'6" x 2'6" DIE5160 DIE6660 DIE7760 DIE2560 DIE88606'6" x 2'9" DIE5170 M DIE6670 M DIE7770 M DIE7370† M DIE2570 M DIE8870 M6'6" x 2'10" DIE4690 M6'8" x 2'8" DIE4680 M

Metric (mm)

2040 x 526

2040 x 626 DIE66312040 x 726 DIE66412040 x 826 DIE6661 M2040 x 926 DIE6671 M

Firecheck FD30

imperial Fire door

6'6" x 2'0" DFD41306'6" x 2'3" DIF7440 DFD5840 DIF5940 DIF91406'6" x 2'6" DIF7460 DFD5860 DIF5960 DIF91606'6" x 2'9" DIF7470 M DFD5870 M DIF5970 M DIF9170 M6'8" x 2'8" DFD4180 M


Fire door

2040 x 526

2040 x 626 DFD49302040 x 726 DFD49402040 x 826 DFD4960 M2040 x 926 DFD4970 M

Firecheck FD30 35mm

imperialFire door

6'6" x 2'3" DFD24406'6" x 2'6" DFD24606'6" x 2'9" DFD2470 M6'8" x 2'8" DFD2480 M

Glazed imperial

6'6" x 2'0" DIE50306'6" x 2'3" DIE5440 DIE78406'6" x 2'6" DIE5360 DIE5460 DIE78606'6" x 2'9" DIE5370 M DIE5470 M DIE7870 M DIE7470† M6'8" x 2'8" DIE5080 M

Glazed metric

2040 x 626 DIE52302040 x 726 DIE5240 2040 x 826 DIE5260 M2040 x 926 DIE5270 M

Bi-Fold imperial

6'6" x 2'3" DIP09406'6" x 2'6" DIP0960



Pre-finished Genoa Oak

Holdenby Oak

Genoa Oak

Imperial (inch)

6'6" x 1'3"

6'6" x 1'6" DIE6910 DIE64106'6" x 1'9" DIE6920 DIE64206'6" x 2'0" DIE7230 DIE6930 DIE64306'6" x 2'3" DIE7240 DIE6940 DIE64406'6" x 2'4" DIE7250 DIE6950 DIE64506'6" x 2'6" DIE7260 DIE6960 DIE64606'6" x 2'9" DIE7270 M DIE6970 M DIE6470 M6'6" x 2'10"

6'8" x 2'8" DIE7280 M DIE6980 M DIE6480 M

Metric (mm)

2040 x 526

2040 x 626 DIE6931 DIE68302040 x 726 DIE8440 DIE6941 DIE68402040 x 826 DIE8460 M DIE6961 M DIE6860 M2040 x 926 DIE6971 M DIE6890 M

Firecheck FD30

imperial Fire door

6'6" x 2'0"

6'6" x 2'3" DIF8540 DIF7540 DFD28406'6" x 2'6" DIF8560 DIF7560 DFD28606'6" x 2'9" DIF8570 M DIF7570 M DFD2870 M6'8" x 2'8"


Fire door

2040 x 526

2040 x 626

2040 x 726

2040 x 826

2040 x 926

Firecheck FD30 35mm

imperialFire door

6'6" x 2'3"

6'6" x 2'6"

6'6" x 2'9"

6'8" x 2'8"

Glazed imperial

6'6" x 2'0"

6'6" x 2'3" DIE8040 DIE67406'6" x 2'6" DIE8560 DIE8060 DIE67606'6" x 2'9" DIE8570 M DIE8070 M DIE6770 M6'8" x 2'8"

Glazed metric

2040 x 626

2040 x 726 DIE8140 2040 x 826 DIE8160 M2040 x 926

Bi-Fold imperial

6'6" x 2'3" DIP14496'6" x 2'6" DIP1469

Doors overview |261

Oak Foil16G glazed

Light Grey Oak Foil20G glazed

Ash veneer16G glazed

Oak Foil20G glazed

Ply 20G glazedPly 16G glazed

Firecheck FD30

imperialFire door

6'6" x 2'0"

6'6" x 2'3" DFL1540 UK E DIF8040 UK E DIF7840 UK E DFL1740 UK P E DIF3340 UK P E6'6" x 2'6" DIF3660 UK E DIF8060 UK E DIF3790 UK E DIF7860 UK E DIF7960 UK P E DIF3360 UK P E6'6" x 2'9" DIF3670 UK M E DIF8070 UK M E DIF3750 UK M E DIF7870 UK E DIF7970 UK P M E DIF3370 UK P M E6'8" x 2'8"


Fire door

2040 x 526

2040 x 626

2040 x 726

2040 x 826 DIF3161 UK M E DIF3240 UK M E DIF7760 UK M E DFL1860 UK P M E DIF9460 UK P E2040 x 926 DIF3171 UK M E DIF3250 UK M E DIF7770 UK M E DFL1870 UK P M E DIF9470 UK P M E

Ply G/O glazed

Dordogne inlaid Oak veneer

Oak Veneer Oak Veneer 20G glazedAsh

veneerOak foil

Imperial (inch)

6'6" x 1'3"

6'6" x 1'6"

6'6" x 1'9"

6'6" x 2'0" DIL1830 UK DIC3230 UK6'6" x 2'3" DIL1240 UK DIL1840 UK DIC3240 UK6'6" x 2'4"

6'6" x 2'6" DIL1260 UK DIL1860 UK DIC3260 UK6'6" x 2'9" DIL1270 UK M DIL1870 UK M DIC3270 UK M6'6" x 2'10"

6'8" x 2'8"

Metric (mm)

2040 x 526

2040 x 626

2040 x 726 DIC4941 UK2040 x 826 DIC4961 UK2040 x 926 DIC4971 UK

Firecheck FD30

imperialFire door

6'6" x 2'0" DIF1730† UK E6'6" x 2'3" DIF4640 UK P E DFL1240 UK DIF9640 UK E DIF9340 UK E DIF0740 UK E DIF1740 UK E6'6" x 2'6" DIF4660 UK P E DFL1260 UK DIF9660 UK E DIF9360 UK E DIF0760 UK E DIF1760 UK E6'6" x 2'9" DIF4670 UK P M E DFL1270 UK M DIF9670 UK M E DIF9370 UK M E DIF0770 UK M E DIF1770 UK M E6'8" x 2'8" DIF4680 UK P M E


Fire door

2040 x 526

2040 x 626

2040 x 726 DIF2131† UK E2040 x 826 DIF5280 UK P M DIF9760 UK M E DIF9960 UK M E DIF0240 UK M E DIF2161 UK M E2040 x 926 DIF5290 UK P M DIF9770 UK M E DIF9970 UK M E DIF0250 UK M E DIF2171 UK M E



Light Grey Oak Foil Sapele veneerPrimed unlipped

hardboardPlywood

Imperial (inch)

6'6" x 1'3" DIC1100 UK DIC1300 UK F6'6" x 1'6" DIC1110 UK DIC1310 UK F6'6" x 1'9" DIC1120 UK DIC1320 UK F6'6" x 2'0" DIL1430 UK DIC1430† UK DIC1130 UK DIC1330 UK F6'6" x 2'3" DIL1440 UK DIC1440† UK DIC1140 UK DIC1340 UK F6'6" x 2'4" DIC1150 UK DIC1350 UK F6'6" x 2'6" DIL1460 UK DIC1460† UK DIC1160 UK DIC1360 UK F6'6" x 2'9" DIL1470 UK M DIC1470† UK M DIC1170 UK M DIC1370 UK F M6'6" x 2'10"

6'8" x 2'8" DIC1380 UK F M

Metric (mm)

2040 x 526 DIC3020 UK F2040 x 626 DIC3030 UK F2040 x 726 DIC0641† UK DIC3040 UK F2040 x 826 DIC0661† UK M DIC3060 UK F M2040 x 926 DIC3070 UK F M

Firecheck FD30

imperialFire door

6'6" x 2'0" DIF1430 UK P E 6'6" x 2'3" DFL1440 UK E DIF1440 UK P E6'6" x 2'6" DFL1460 UK E DIF1160† UK E DIF1460 UK P E6'6" x 2'9" DFL1470 UK M E DIF1190† UK M E DIF1470 UK P M E6'8" x 2'8" DIF1480 UK P M E


Fire door

2040 x 526 DIF1520 UK P E2040 x 626 DIF1530 UK P E2040 x 726 DIF1540 UK P E2040 x 826 DIF1560 UK P M E2040 x 926 DIF1570 UK P M E

Firecheck FD30 35mm

imperialFire door

6'6" x 2'3" DIF8940 UK P6'6" x 2'6" DIF8960 UK P6'6" x 2'9" DIF8970 UK P M6'8" x 2'8" DIF8980 UK P M



White edgemirror door

White Shakermirror door

White Shakerpanel door

Oak Shakermirror door

Oak Shakerpanel doord

Metric (mm)

2220 x 610 GIR2011 GIR2015 GIR2044 F GIR2025 GIR2024 F

2220 x 914 GIR2010 GIR2013 GIR2042 F GIR2023 GIR2022 F

White Trackset

L1200mm GIR2036

L1800mm GIR2030

L2700mm GIR2031

L3600mm GIR2032

Silver Trackset

L1200mm GIR2037

L1800mm GIR2033

L2700mm GIR2034

L3600mm GIR2035


Part L Regent Oak

Cottage Oak triple glazed

External Dordogne Oak

External Worcester Oak

External Linear Oak

Georgian glazed

Imperial (inch)

6'6" x 2'0"

6'6" x 2'3"

6'6" x 2'6"

6'6" x 2'9" DXP2670 M DXP3170† M DXP1570† M

6'8" x 2'8" DXP1981† F L L M DXP2680 M DXP3180† M DXP1580† M

6'10" x 2'10"

Glazed imperial

6'6" x 2'0"

6'6" x 2'3"

6'6" x 2'6" DXP5960†

6'6" x 2'9" DXP2970 M DXP3270 M DXP5970 M

6'8" x 2'8" DXP2380† M DXP2980 M DXP3280 M DXP5980 M

Bosworth glazed

Richmond glazed

Carolina glazed

H2XG glazed

Regent

Imperial (inch)

6'6" x 2'0"

6'6" x 2'3"

6'6" x 2'6" DXP4360

6'6" x 2'9" DXP4370 M

6'8" x 2'8" DXP4381 M

6'10" x 2'10"

Glazed imperial

6'6" x 2'0"

6'6" x 2'3"

6'6" x 2'6" DXP5860† DXP5460 DXP4660† DXP5160

6'6" x 2'9" DXP5870 M DXP5470 M DXP4670 M DXP5170 M

6'8" x 2'8" DXP5880 M DXP5480 M DXP4680 M DXP5180 M


†Subject to availabilityDoors overview


Imperial sizes 35mm, Metric sizes 40mm, Fire doors 44mm (excluding 35mm Fire doors).

All external doors conform to the following thicknesses: Standard and FD30 44mm, FD60 54mm.

264|

External softwood doors


Ply G/O glazed

Solid core blank lightweight

Plywood

Imperial (inch)

6'6" x 2'0"

6'6" x 2'3"

6'6" x 2'6" DXL0560 UK6'6" x 2'9" DXL0570 UK M6'6" x 2'10"

6'8" x 2'8"

Firecheck FD30 imperial

Fire door

6'6" x 2'3" DXF0140 UK P6'6" x 2'6" DXF1360 UK P DXF0160 UK P6'6" x 2'9" DXF1370 UK P M DXF0170 UK P M6'8" x 2'8" DXF1380 UK P M DXF0180 UK P M7'0" x 3'0" DFD0041 M E8'0" x 4'0" DFD0053 M E


Fire door

2040 x 826 DXF1440 UK P M DXF0460 UK P M

2040 x 926 DXF1450 UK P M DXF0470 UK P M

Firecheck FD60 imperial

Fire door

6'6" x 2'6" DXF0262 UK P6'6" x 2'9" DXF0272 UK P M7'0" x 3'0" DFD0044 M E

Garage doors

Softwood FL&B

Imperial (inch)

6'6" x 7'0" DXG0110† UK F7'0" x 7'0" DXG0220† UK F

2XG/2XGG Hemlock

FL&B L&B

Imperial (inch)

6'6" x 2'0" DXC0530 F6'6" x 2'3" DXC0540 F DXC0640 F6'6" x 2'6" DXT0160 P DXC0560 F DXC0660 F6'6" x 2'9" DXT0170 P M DXC0570 F M DXC0670 F M6'8" x 2'8" DXT0180 P M DXC0580 F M6'10" x 2'10"

Glazing Metric

1019 x 599 DGL01011019 x 675 DGL0121


Joinery door finishes matrix

Internal moulded door

Internal softwood clear

Pine door

Internal softwood

Knotty Pine door

Internal primed

Internal hardwood

veneered door

Internal hardwood solid door

Internal flush ply &

hardboard primed door

Internal flush foil &

veneered door

Sadolin English

Oak interior

stain (750ml)GAR0536 *

Sadolin interior

varnish satin

(1 litre)GAR0539 *

Primer/

Undercoat

(2.5 litre)STN0805 *

Rustin's

Danish oil

(1 litre)GAR0125

Osmo oil

(1 litre)GAR0542

Internal doors

External doors

External hardwood

door

External softwood

door

External ply flush

doorGarage door†

Sadolin Clear exterior base

coat (1 litre)GAR0530

Sadolin Mahogany exterior

stain (1 litre)GAR0531

Sadolin Dark Oak exterior stain

(1 litre)GAR0532

Sadolin Heritage Oak exterior

stain (1 litre)GAR0533

Sadolin Walnut exterior stain

(1 litre)GAR0534

Sadolin clearcoat exterior

varnish satin (1 litre)GAR0510

Sadolin clearcoat exterior

varnish gloss (1 litre)GAR0511

Finish suitable for door range. * To be finished on edges only.

All Howdens doors are suitable for paint finishes. Exterior stains are not suitable for internal applications as they do not adequately protect the door against knocks, scratches

and dents. Interior stains and varnishes are not suitable for external applications as they are not flexible enough to cope with the movement of external doors and do not

protect against UV light. Some finishes may cause the grain to raise slightly. A light sand between coats is recommended.

†Subject to availabilityJoinery door finishes matrix266|

Fire rated matrix

Fire Rating

Aluminium Roundbar latch 19mm DFU0302

Aluminium Roundbar lock 19mm DFU0301

Aluminium Roundbar bathroom 19mm

DFU0303

Aluminium Roundbar Euro profile 19mm

DFU0304

Aluminium Roundbar oval profile 19mm

DFU0305

FD30 FH FH FH FH FH

FD60 FH FH FH FH FH

FD120

Fire Rating

Aluminium Roundbar rose 19mm DFU0300

Lecco Satin Stainless Steel

DFU0471

Cadeby Chrome Effect DFU0835

Turin Satin Stainless Steel

DFU0727

Lago Polished Stainless Steel

DFU0729

FD30 FH FH FH FH FH

FD60 FH FH FH FH FH

FD120

Fire Rating

Stainless Steel Roundbar 19mm

DFU0260

Stainless Steel concealed fixing 12"

DFU0136

FD30 FH FH

FD60 FH FH

FD120

Fire Rating

Edinburgh Chrome Effect latch

DFU0840

Edinburgh Chrome Effect lock

DFU0841

Edinburgh Chrome Effect bathroom

DFU0842

Edinburgh Chrome Effect privacy

DFU0842

Edinburgh Chrome Effect Euro profile

DFU0843

FD30 FH FH FH FH FH

FD60 FH FH FH FH FH

FD120

Fire Rating

Edinburgh Aluminium latch

DFU0085

Edinburgh Aluminium lock

DFU0086

Edinburgh Aluminium bathroom

DFU0087

Edinburgh Aluminium privacy

DFU0087

Edinburgh Aluminium Euro profile

DFU0088

FD30 FH FH FH FH FH

FD60 FH FH FH FH FH

FD120

FH = Essential fire door hardware

p.187

p.187

p.187

p.187

p.187

p.187

p.187

p.187

p.190

Handles

p.190

p.186 p.186 p.186 p.190 p.190

p.186 p.175 p.175 p.176 p.176

p.186 p.207

Fire rated matrix |267

Panic hardware

Fire Rating

Briton double rebated panic set

SCF0076

Briton single panic bolt SCF0078

Briton rim panic latch SCF0077

Briton security push pad SCF0081

Briton outside access device - lever

SCF0074

FD30 FH FH FH FH FH

FD60 FH FH FH FH FH

FD120

Door closers

Fire Rating

Union Retro 3 door closer fixed size

3 Silver DCL0017

Briton 2003.SES door closer fixed size

3 Silver DCL0007

Briton 1110.SES door closer adjustable size

2-4 Silver DCL0012

Eclipse 73 door closer fixed size 3 Silver DCL0019

Briton 121 CE.SES door closer fixed size

3 Silver DCL0001

Concealed closer EB DCL0002

Concealed closer NP DCL0022

4" Satin Stainless Steel self closing

hinge pack HNG0430

FD30 FH FH FH FH FH FH FH

FD60 FH FH FH FH FH FH FH

FD120 FH FH FH FH FH

Locks & latches

Fire Rating

Premium tubular mortice latch 2.5" PB/PSS

LAL0075

Premium tubular mortice latch 3" PB/PSS LAL0076

3" Bathroom bolt with dual striking plate EB/NP

LAL0130

2.5” Bathroom bolt with dual striking plate EB/NP LAL0127

Union StrongBOLT mortice sashlock BS 2.5" EB LAL0042

Union StrongBOLT mortice sashlock BS 3" EB

LAL0043

Union StrongBOLT mortice sashlock BS 2.5" SCP

LAL0044

Union StrongBOLT mortice sashlock BS 3" SCP

LAL0045

Union StrongBOLT mortice deadlock BS 2.5" EB

LAL0046

Union StongBOLT mortice deadlock BS 2.5" SCP

LAL0047

FD30 FH FH FH FH FH

FD60 FH FH FH FH FH

FD120

p.213

p.209

p.208p.207 p.208p.207 p.208p.207 p.208

p.213

p.209

p.215

p.209

p.215

p.209

p.216

p.209

Fire rated matrix

FH = Essential fire door hardware

268|

Fingerplates & kickplates

Fire Rating

Brass 12" x 3" fingerplate DFU0146

Stainless Steel 15" x 3" fingerplate DFU0095

Polished Stainless Steel 12" x 3" fingerplate

DFU0145

Aluminium 12" x 3" fingerplate DFU0107

30"/ H150mm x L762mm SAA kickplate

DFU0157

33"/ H150mm x L838mm SAA kickplate

DFU0106

FH FH FH FH FH

Intumescent accessories

Fire Rating

10mm x 4mm x L2.1m fire & smoke strip Brown

ITS0007

10mm x 4mm x L2.1m fire & smoke strip White

ITS0008


ITS0011

15mm x 4mm x L2.1m fire & smoke strip White

ITS0012


ITS0013

20mm x 4mm x L2.1m fire & smoke strip White ITS0014

10mm x 4mm x L2.1m fire strip Brown

ITS0005

10mm x 4mm x L2.1m fire strip White

ITS0006

15mm x 4mm x L2.1m fire strip Brown

ITS0009

15mm x 4mm x L2.1m fire strip White

ITS0010

Astro Flame White intumescent mastic 310ml

ITS0020

Everbuild hand held B1 fire rated expanding

foam 750ml GIR0088

4" Intumescent hinge pads (pack of 6)

ITS0030

Intumescent paper pack ITS0050

FD30 FH FH FH FH FH

FD60 FH FH FH

FD120 FH

Hinges

Fire Rating

3" EB Stainless Steel grade

7 washered hinge HNG0111

3" Satin Stainless Steel grade 7 washered hinge

HNG0068

3" Polished Stainless Steel grade 7 washered

hinge HNG0161

4" EB Stainless Steel grade 7 washered hinge

HNG0112

4" Satin Stainless Steel grade 7 washered hinge

HNG0069

4" Polished Stainless Steel grade 7 washered

hinge HNG0160

3" EB Stainless Steel grade 7 ball bearing

hinge HNG0371

3" Satin Stainless Steel grade 7 ball bearing

hinge HNG0370

3" Polished Stainless Steel grade 7 ball

bearing hinge HNG0085

3" Black Nickel Finish 7 ball bearing hinge

HNG0372

4" EB Stainless Steel grade 13 ball bearing

hinge HNG0065


hinge HNG0066

4" Polished Stainless Steel grade 11 ball bear-

ing hinge HNG0086

4" EB Stainless Steel Grade 11 ball bearing

hinge HNG0027


hinge HNG0025

4" Satin Chrome Steel grade 11 ball bearing

hinge HNG0029

3” Polished Stainless Steel Grade 7 HNG0077

3” Satin Stainless Steel Grade 7 HNG0076

4” Satin Chrome Steel Grade 11 HNG0078

4” Satin Stainless Steel Grade 13 HNG0079

FD30 FH FH FH FH FH FH

FD60 FH FH FH FH

FD120

p.231p.230p.230 p.230p.230p.230

p.133 p.133 p.133 p.133 p.133

p.198 p.198 p.198 p.198 p.198

Fire rated matrix

FH = Non-essential fire door hardware, not FD30/FD60/FD120 specific FH = Essential fire door hardware

|269

Victorian Chrissi

Scroll Brass

page 184

Scroll Chrome

page 184

Brass

page 185

Chrome

page 185

Satin Nickel

page 185Chrome

page 179Satin Nickel page 180

Door handles

Latch DFU0631 DFU0661 DFU0621 DFU0611 DFU0641 DFU0039 DFU0045

Lock DFU0630 DFU0660 DFU0620 DFU0610 DFU0640 DFU0038 DFU0044

Bathroom DFU0632 DFU0662 DFU0622 DFU0612 DFU0642 DFU0031 DFU0032

Privacy DFU0633 DFU0663 DFU0623 DFU0613 DFU0643 DFU0040 DFU0046

Rose DFU0071 DFU0615 DFU0072

Bathroom turn* DFU0441 DFU0442 DFU0442

Euro/oval DFU0616

Matching external

door furniture

Door knocker DFU0165 DFU0164 DFU0165 DFU0164 DFU0166 DFU0164 DFU0166

Cylinder pull DFU0108 DFU0205 DFU0108 DFU0205 DFU0140 DFU0205 DFU0140

Letterplate DFU0100 DFU0233 DFU0100 DFU0233 DFU0099 DFU0233 DFU0099

Door tidy DFU0150 DFU0159 DFU0150 DFU0159 DFU0158 DFU0159 DFU0158

Door chain SCF0005 SCF0008 SCF0005 SCF0008 SCF0008

Door viewer SCF0007 SCF0009 SCF0007 SCF0009 SCF0009

Escutcheon* DFU0207 DFU0206/0777 DFU0207 DFU0206/0777 DFU0215/0775 DFU0206/0777 DFU0215/0775

Matching door

accessories

Coat hook GIR0364 GIR0363 GIR0364 GIR0363 GIR0365 GIR0363 GIR0365

Cabin hook LAL0116/7 LAL0113/4 LAL0116/7 LAL0113/4 LAL0118/9 LAL0113/4 LAL0118/9

Door stop GIR0340/2 GIR0345/6 GIR0340/2 GIR0345/6 GIR0357/8 GIR0345/6 GIR0357/8

BoltSCF0046/

47/48/140/171SCF0141/

47/58/59/63/73SCF0046/

47/48/140/171SCF0141/47

58/59/63/73SCF0166/67

68/69/70SCF0141/47

58/59/63/73SCF0166/67

68/69/70

Pull handle DFU0147 DFU0138 DFU0147 DFU0138 DFU0139 DFU0138 DFU0139

Fingerplate DFU0146 DFU0146

Kickplate

Lock & latch pack LAL1120/30 LAL1102/10/12 LAL1060/70/80/90

Budget lock & latch pack LAL0752 LAL0756

Idro Lugano Garda

Brass

page 181

Chrome

page 181

Satin Nickel

page 181

Chrome

page 183Brass

page 182

Chrome

page 182

Satin Nickel

page 182

Door handles



Bathroom DFU0738 DFU0737 DFU0736

Privacy DFU0602 DFU0605 DFU0832 DFU0906 DFU0702 DFU0706 DFU0721

Rose DFU0907 DFU0819 DFU0820 DFU0821

Bathroom turn* DFU0445 DFU0441 DFU0442 DFU0431

Euro/oval

Matching external

door furniture

Door knocker DFU0165 DFU0164 DFU0166 DFU0164 DFU0165 DFU0164 DFU0166

Cylinder pull DFU0108 DFU0205 DFU0140 DFU0205 DFU0108 DFU0205 DFU0140

Letterplate DFU0100 DFU0233 DFU0099 DFU0233 DFU0100 DFU0233 DFU0099

Door tidy DFU0150 DFU0159 DFU0158 DFU0159 DFU0150 DFU0159 DFU0158

Door chain SCF0005 SCF0008 SCF0008 SCF0005 SCF0008

Door viewer SCF0007 SCF0009 SCF0009 SCF0007 SCF0009

Escutcheon* DFU0207 DFU0206/0777 DFU0215/0775 DFU0206/778 DFU0207 DFU0206/0777 DFU0215/0775

Matching door

accessories

Coat hook GIR0364 GIR0363 GIR0365 GIR0363 GIR0364 GIR0363 GIR0365

Cabin hook LAL0116/7 LAL0113/4 LAL0118/9 LAL0113/4 LAL0116/7 LAL0113/4 LAL0118/9

Door stop GIR0340/2 GIR0345/6 GIR0357/8 GIR0345/6 GIR0340/2 GIR0345/6 GIR0357/8

BoltSCF0046/

47/48/140/171 SCF0141/47

58/59/63/73SCF0166/67

68/69/70SCF0141/47

58/59/63/73SCF0046/

47/48/140/171SCF0141/47

58/59/63/73SCF0166/67

68/69/70

Pull handle DFU0147 DFU0138 DFU0139 DFU0138 DFU0147 DFU0138 DFU0139


Kickplate

Lock & latch pack LAL2020/30/50/92 LAL2060/70/80

Budget lock & latch pack

Handles and matching door furniture

* Dimensions may differ from rose handle.Handles & matching door furniture270|

Handles and matching door furniture

Durham Pewter Edinburgh Aluminium Antique Sofia

Pewter

page 177

Pewter Effect

page 178

Chrome Effect

page 187

Aluminium

page 187

Roundbar

page 186

Black

page 188

Ornate Black

page 188

Black Nickel

page 174

Door handles



Bathroom DFU0743 DFU0842 DFU0087 DFU0303

Privacy DFU0842 DFU0087

Rose DFU0742 DFU0755 DFU0300

Bathroom turn* DFU0731 DFU0756 DFU0313 DFU0313 DFU0035 DFU0035 DFU0482

Euro/oval DFU0843 DFU0088 DFU0304/5

Matching external

door furniture

Door knocker

Cylinder pull

Letterplate DFU0233 DFU0239 DFU0239 DFU0096 DFU0096

Door tidy

Door chain

Door viewer

Escutcheon* DFU0732 DFU0776 DFU0777 DFU0773 DFU0773 DFU0216

Matching door

accessories

Coat hook GIR0363 GIR0367 GIR0367 GIR0366 GIR0366

Cabin hook LAL0110 LAL0110

Door stop GIR0345/46 GIR0343/4 GIR0343/4

BoltSCF0141/

58/59/63/73SCF0041/

45/172SCF0041/

45/172 SCF0067 SCF0067

Pull handle DFU0138 DFU0141/44 DFU0141/42/43 DFU0137 DFU0137


Kickplate DFU0106/157 DFU0106/157

Lock & latch pack LAL0166/68

Budget lock & latch pack

Ledro Newington Mortice Knobs Commercial

Black Nickel

page 174

Polished/Satin

Chrome page 175

Brass

page 189

Chrome

page 189

Satin Nickel

page 189

Stainless Steel

page 206

Door handles

Latch DFU0050 DFU0063 DFU0751

Lock

Bathroom

Privacy

Rose DFU0260

Bathroom turn* DFU0482 DFU0432 DFU0441 DFU0442 DFU0431 DFU0270

Euro/oval

Matching

external

door

furniture

Door knocker DFU0165 DFU0164 DFU0166

Cylinder pull DFU0108 DFU0205 DFU0140

Letterplate DFU0100 DFU0233 DFU0099

Door tidy DFU0150 DFU0159 DFU0158

Door chain SCF0005 SCF0008

Door viewer SCF0007 SCF0009

Escutcheon* DFU0216 DFU0781 DFU0207 DFU0206/0777 DFU0215/0775 DFU0774

Matching

door

accessories

Coat hook GIR0364 GIR0363 GIR0365

Cabin hook LAL0116/7 LAL0113/4 LAL0118/9

Door stop GIR0340/2 GIR0345/6 GIR0357/8

BoltSCF0046/47/

48/140/171SCF0141/47

58/59/63/73SCF0166/67

68/69/70

Pull handle DFU0147 DFU0138 DFU0139 DFU0136

Fingerplate DFU0146 DFU0094/145

Kickplate

Lock & latch pack

Budget lock &

latch pack

Handles & matching door furniture |271

Matching flooring accessories

Whatever type of flooring you choose from our range, we offer all the accessories you need for the perfect finish.

Scotia trim creates a neat edge to skirting boards; pipe roses make tidy work of radiator pipes; L sections help

you deal with steps or hearths; threshold strips cover the join from room to room; and ramp strips smooth the

transition between different types of flooring.

Scotia

(1.85m)

Scotia

(2.1 - 2.4m)

Pipe Rose

(Pack of 4)

Threshold Strip

(900 - 910mm)

Threshold Strip

(970mm)

Threshold Strip

(2.1m)

Ramp Strip

(900 - 970mm)

L Section

(910mm)

L Section

(970mm)

Howdens Solid

Wood

Pre-finished

Solid Oiled Oak SDH2201

SDH3052 P SDH3090 P SDH5520 UK P SDH5521 UK P

SDH5530 UK P

SDH5540 UK PSolid Oiled Oak SDH2202



Solid Oiled Oak SDH2300 SDH4314 SDH4311 SDH4312 SDH4313

Solid Oak (17% Gloss) SDH3052 P SDH3090 P SDH5520 UK P SDH5521 UK P SDH5530 UK P SDH5540 UK P

Howdens

Real Wood

Pre-finished

Fast Fit Oak 3 Strip

SDH3220

SDH3052 P SDH3090 P SDH3021 F SDH3023 F SDH3031 F SDH3041 FFast Fit Oak single plank

wide SDH3630

Fast Fit Oak single plank

SDH3612

Fast Fit Chestnut Oak

single plank wide SDH3631SDH6550 F SDH3090 P SDH6520 UK F SDH6521 UK F SDH6530 UK F SDH6540 UK P

Light Grey Oak 3 Strip

SDH3635

Dark Oak 180mm SDH3637

Light White Oak 180mm

SDH3638

Light Grey Oak 180mm

SDH3636

4 in 1 backed

underlayFoam underlay

High

performance

underlay (XPS)

Damp proof

membrane

Paintable

damp proof

membrane

Bitumen

moisture barrier

paper

Howdens Solid

Wood

Pre-finished






Solid Oak (17% Gloss)

Howdens

Real Wood

Pre-finished

Fast Fit Oak 3 Strip

SDH3220

SDH0915 SDH0900 UK SDH0909 UK SDH0910 UK SDH0931 UK SDH0932 UK


wide SDH3630


SDH3612

Fast Fit Chestnut Oak

single plank wide SDH3631

Light Grey Oak 3 Strip

SDH3635

Dark Oak 180mm SDH3637

Light White Oak 180mm

SDH3638

Light Grey Oak 180mm

SDH3636

Matching flooring accessories272|


Scotia

(2.4m)

Pipe Rose

(Pack of 4)

Sealant

(310ml)Hydro Foam Kit Quickstep Incizo

Threshold Strip

(900mm &

2.7m)

Ramp Strip

(900mm)Profile A Profile B

Quickstep Livyn

Click Fit Vinyl

Classic Oak Natural

SDH3680

Canyon Oak Grey SDH3681

Silk Oak Dark Grey SDH3682


SDH3683


SDH3684

Oak Light Natural SDH3685

Canyon Oak Beige SDH3689

Black Slate SDH3686

Cream Travertine SDH3687


SDH3688

Howdens

Professional Click

Fit Vinyl

Oak SDH3641

Light Oak SDH3640

Light Tile SDH3643

Quickstep

Impressive

Oak SDH2402 SDH2412SDH0088 SDH0089

SDH2410SDH0940 SDH0942

Grey Oak SDH2401 SDH2413 SDH2411

Howdens

Professional Fast

Fit V Groove

Oak SDH3576 SDH4960 P

SDH0290 UK SDH0091SDH8021 P* SDH8030 P

SDH0940 SDH0942

Tawny Chestnut Oak

SDH3583SDH0961 P

American Pecan SDH3577 SDH7150 P SDH7120 P SDH7130 P

Rustic Chestnut SDH3581 SDH7350 P SDH0490 UK GAR0106 UK SDH7320 P SDH7330 P

Hickory SDH3575 SDH8050 P SDH0290 UK SDH0091 SDH8030 P

Smoky Hickory SDH3584 SDH0961 P

SDH0895

GAR0106 UKDark Grey Oak SDH3582 SDH6150 P SDH6120 P SDH6130 P

Light Grey Oak SDH3578

SDH6250 P

SDH0097 UK

SDH6220 P SDH6230 PWhite Washed Oak

SDH3590SDH0091

Grey Oak SDH3591 SDH0097 UK

Light Oak SDH3592 SDH0090

Dark Oak SDH3595

GAR0106 UKBlack Oak SDH3596


* Code SDH8021 strips are 2.7m in length.

|273


Profile FClear Edge

T-Bar

4 in 1 backed

underlay*

Foam

underlay

High

Performance

underlay

(XPS)*

Selitbloc Vinyl

underlay

Damp proof

membrane

Paintable damp

proof

membrane

Bitumen

moisture

barrier

paper

Quickstep Livyn

Click Fit Vinyl

Classic Oak Natural

SDH3680

SDH4120 SDH0926 SDH0931 UK SDH0932 UK

Canyon Oak Grey SDH3681

Silk Oak Dark Grey SDH3682


SDH3683


SDH3684

Oak Light Natural SDH3685

Canyon Oak Beige SDH3689

Black Slate SDH3686

Cream Travertine SDH3687


SDH3688

Howdens

Professional Click

Fit Vinyl

Oak SDH3641

SDH4120 SDH0926 SDH0931 UK SDH0932 UKLight Oak SDH3640

Light Tile SDH3643

Quickstep

Impressive

Oak SDH2402

SDH0945 SDH0915 SDH0900 UK SDH0909 UK SDH0910 UK SDH0931 UK SDH0932 UKGrey Oak SDH2401

Howdens

Professional Fast

Fit V Groove

Oak SDH3576

SDH0945 SDH0915 SDH0900 UK SDH0909 UK SDH0910 UK SDH0931 UK SDH0932 UK

Tawny Chestnut Oak

SDH3583

American Pecan SDH3577

Rustic Chestnut SDH3581

Hickory SDH3575

Smoky Hickory SDH3584

Dark Grey Oak SDH3582


White Washed Oak

SDH3590

Grey Oak SDH3591

Light Oak SDH3592

Dark Oak SDH3595

Black Oak SDH3596

* Not suitable for use with underfloor heating.Matching flooring accessories274|

Scotia

(2.4m)

Pipe Rose

(Pack of 4)

Sealant

(310ml)

Threshold Strip

(900mm)

Threshold Strip

(2.4m)

Threshold Strip

(2.7m)

Ramp Strip

(900mm)

Ramp Strip

(2.4m)

Black

skirting

(L2.4m)

Howdens

Professional

Oak SDH3572 SDH4961 P SDH0290 UK SDH0091 SDH8020 P SDH8021 P SDH8030 P

Light Oak SDH3573 SDH6350 P SDH0290 UK GAR0106 UK SDH6320 P SDH6330 P

Dark Grey Oak SDH3574 SDH6150 P SDH0895 SDH0097 UK SDH6120 P SDH6130 P

Light Grey Oak SDH3588 SDH6450 P SDH0896 UK SDH0097 UK SDH6420 P SDH6430 P

Walnut SDH3570 SDH7350 P SDH0490 UK SDH0095 SDH7320 P SDH7330 P

Rustic Hickory SDH3720 SDH4960 P SDH0290 UK SDH0091 SDH8020 P SDH8021 P SDH8030 P

Grey Oak SDH3722 SDH6150 P SDH0895 SDH0097 UK SDH6120 P SDH6130 P

Dark Brown SDH3721 SDH0290 UK GAR0106 UK

Howdens

Oak SDH2094 SDH7450 P SDH0290 UK SDH0091 SDH7420 P SDH7430 P

3 Strip Oak SDH2096 SDH7450 P SDH0290 UK SDH0091 SDH7420 P SDH7430 P

Light Oak SDH2093 SDH6350 P SDH0190 GAR0106 UK SDH6320 P SDH6330 P

3 Strip Oak SDH3587 SDH6250 P SDH0895 SDH0097 UK SDH6220 P SDH6230 P


SDH2112SDH6450 P SDH0896 UK GAR0106 UK SDH6420 P SDH6430 P

Howdens

Professional

Continuous Tiles

Natural Stone SDH2082

SDH0961 PGAR0106 UK

Limestone SDH2083

Light Stone SDH2088

Black Slate SDH2084 SDH7950 P SDH7920 P SDH7930 P MOD0540

Howdens

Professional Fast

Fit V Groove Tile

Light Travertine SDH3668

SDH0961 P

GAR0106 UK

Marble SDH3586

Grey Slate SDH3585

Travertine SDH3667

Basalt Slate SDH3670 SDH7950 P SDH7920 P SDH7930 P MOD0540

White Slate SDH3598

SDH0961 PConcrete SDH3599

Midnight Slate SDH3600 SDH7950 P SDH7920 P SDH7930 P MOD0540

Grey Stone SDH3601 SDH0961 P

Howdens

Professional

Decorative Tiles

Grey Chevron SDH2076 SDH6150 P SDH0895 SDH0097 UK SDH6220 P SDH6230 P

Oak Chevron SDH2075 SDH4961 P SDH0290 UK SDH0091 SDH6320 P SDH6330 P

Random Effect

TileSlate SDH3689 SDH7950 P GAR0106 UK SDH7920 P SDH7930 P MOD0540

Fast Fit Tile Slate SDH2089 SDH7950 P GAR0106 UK SDH7920 P SDH7930 P MOD0540


Matching flooring accessories |275

Profile A Profile B Profile F4 in 1 backed

underlay*Foam underlay

High

performance

underlay

(XPS)*

Damp proof

membrane

Paintable

damp proof

membrane

Bitumen

moisture

barrier

paper

Howdens

Professional

Oak SDH3572

SDH0940 SDH0942 SDH0945 SDH0915 SDH0900 UK SDH0909 UK SDH0910 UK SDH0931 UK SDH0932 UK

Light Oak SDH3573

Dark Grey Oak SDH3574


Walnut SDH3570

Rustic Hickory SDH3720

Grey Oak SDH3722

Dark Brown SDH3721

Howdens

Oak SDH2094


3 Strip Oak SDH2096

Light Oak SDH2093

3 Strip Oak SDH3587


SDH2112

Howdens

Professional

Continuous Tiles

Natural Stone SDH2082

SDH0940 SDH0942 SDH0945 SDH0915 SDH0900 UK SDH0909 UK SDH0910 UK SDH0931 UK SDH0932 UKLimestone SDH2083

Light Stone SDH2088

Black Slate SDH2084

Howdens

Professional Fast

Fit V Groove Tile

Light Travertine SDH3668


Marble SDH3586

Grey Slate SDH3585

Travertine SDH3667

Basalt Slate SDH3670

White Slate SDH3598

Concrete SDH3599

Midnight Slate SDH3600

Grey Stone SDH3601

Howdens

Professional

Decorative Tiles

Grey Chevron SDH2076

SDH0940 SDH0942 SDH0945 SDH0915 SDH0900 UK SDH0909 UK SDH0910 UK SDH0931 UK SDH0932 UKOak Chevron SDH2075

Random Effect

TileSlate SDH3689 SDH0940 SDH0942 SDH0945 SDH0915 SDH0900 UK SDH0909 UK SDH0910 UK SDH0931 UK SDH0932 UK

Fast Fit Tile Slate SDH2089 SDH0940 SDH0942 SDH0945 SDH0915 SDH0900 UK SDH0909 UK SDH0910 UK SDH0931 UK SDH0932 UK


* Not suitable for use with underfloor heating.Matching flooring accessories276|

Cottage Oak triple glazed door Burford architrave & skirting

Quick fit bathroom boltHowdens Professional Marble tile

Edinburgh latch handle

Square spindles

Product information correct at time of publication in February 2018

The company has a policy of continuous product development and reserves the right

to change any products and specifications given in this brochure. Subject to the Terms

and Conditions of Trading, a copy of the Howdens Joinery Terms and Conditions is

available upon request. Photography is for illustration purposes only, some products

may differ from those shown. The colours in this brochure are as accurate as printing

processes allow. Natural wood products may vary slightly in tone.

February 2018 ISSUE (XBR8674)

Howden Joinery Ltd, First Floor, 40 Portman Square, London, W1H 6LT.Registered in England 526923

www.howdens.com

This brochure is printed on FSC® certified paper

About Us - Amazon S3 › howdens-howden-prod › ...over 400,000 kitchens, 2.5 million doors and...

Documents

Transcript of About Us - Amazon S3 › howdens-howden-prod › ...over 400,000 kitchens, 2.5 million doors and...