About Us - Amazon S3 › howdens-howden-prod › ...over 400,000 kitchens, 2.5 million doors and...
Transcript of About Us - Amazon S3 › howdens-howden-prod › ...over 400,000 kitchens, 2.5 million doors and...
The Joinery Collection
About Us
Howdens Joinery is the UK’s largest manufacturer and supplier of fitted kitchens, appliances and joinery products.
We are a trusted, trade-only business that has been selling to trade professionals since 1995. Last year we supplied
over 400,000 kitchens, 2.5 million doors and 770,000 appliances to UK homes.
Our products are available from stock in over 650 depots throughout the UK, and in each depot, trained designers
are on hand to support you and your builder.
We do not endorse trade professionals directly, but to find a builder near you, talk to your local Howdens Joinery
depot or visit www.howdens.com/about-us/find-a-local-builder
Our product range
We have over 75 door styles to choose from including internal, sliding wardrobe, external, French and garage doors.
We also offer quality joinery products, from hardware and stair parts, to skirting and timber or laminate flooring - plus
the tools, fixings and accessories that you need to install them. There is an enormous choice of joinery products for
all kinds of renovation, refurbishment and new build projects.
To find out more about Howdens Joinery, contact your local builder or visit www.howdens.com
Pricing and Aftersales
To see our Pricing and Aftersales policy, please visit:
www.howdens.com/about-us/howdens-pricing-and-aftersales-policy
Copyright © 2018 Howden Joinery Ltd. All rights reserved.
|01
ContentsFlooring 144
Flooring accessories 165
Hardware 171
Door handles 172
Door furniture 195
Commercial door furniture 205
Door security 211
Fire rated hardware 222
Fixings 227
Tools & accessories 238
Kitchen overview 246
Door regulations 250
Standards & accreditations 252
Doors, hardware & flooring overview 254
Joinery door finishes matrix 266
Fire rated matrix 267
Handles & door furniture matrix 270
Matching Flooring accessories matrix 272
A truly local business 02
Howdens & the history of doors 03
Howdens door visualiser 04
The Burford joinery collection 07
Internal doors 08
Internal moulded panel doors 08
Internal softwood doors 31
Internal primed stile & rail doors 39
Internal hardwood doors 47
Internal flush doors 74
Sliding wardrobe doors 95
Internal storage solutions 100
External doors 102
External hardwood doors 102
External softwood doors 116
External flush doors 120
Garage doors 124
Joinery 130
External door frames 131
Door linings & casings 132
Joinery accessories 134
Stair parts 137
Mouldings 141
Contents
02|
Royal Marines Corporal Phil Eaglesham
Returning to Taunton after six months in Afghanistan with the Royal Marines,
Corporal Phil Eaglesham was diagnosed with Q fever, a rare bacterial infection.
Confined to a wheelchair, he struggled with many practicalities at home -
until three Marines charities teamed up with a construction firm to design
and build him a new home. Local Howdens staff were keen to contribute:
the depot donated a kitchen adapted for wheelchair access, giving Phil the
independence to prepare his own meals.
A truly local businessHowdens Joinery is a local business. We run local customer accounts, not national ones; employees
are engaged locally and our trade account holders rely on our products and services to ensure the
growth and prosperity of their own local businesses.
As a locally driven business, we encourage staff at each of our sites to support and engage with
community activities. They have been responsible for over 3,700 donations to local good causes,
amounting to £1.5m - supporting schools, village halls, care homes, hospices, sports clubs, youth
groups and other community activities. We are proud that our staff take such an active part in giving
something back to their local communities.
To learn more about the relationships that make Howdens Joinery a part of local life all around
Great Britain, visit www.howdens.com/about-us/a-truly-local-business
The team at Howdens’ Rochdale depot
On World Homeless Day, staff from Howdens’ Rochdale depot hosted a
sponsored sleep out. Joined by colleagues from the Manchester depot, they
raised money for local charity, Petrus, which provides residential and day
support services for homeless people. They also asked staff and customers to
donate food and other items - and encouraged local branches of businesses
to get involved: Go Outdoors provided sleeping bags, and Morrisons and Tesco
donated gift cards, to buy more food and toiletries.
A truly local business
|03
Howdens and the history of doors Over the centuries, the way doors are made has developed quite gradually and many classic designs
are still reflected in the Howdens range today.
The door’s role of insulating between a building and the outside world - or between rooms - has given
it great significance in the history of architecture. Front doors in particular have always been seen to
deserve high quality workmanship and attention to detail.
17th century
Doors of all types were usually made from vertical timber
planks held together by horizontal ledges. On higher quality
doors these were concealed by a second layer of planks.
18th century
Panelled doors were more popular, with designs
influenced by architecture of the time, often featuring
many different combinations of mouldings.
19th century
The 6 panel design became standard during the Georgian
period and mouldings became more elaborate. The 4
panel door was introduced and the distinctive Victorian
innovation was glazed panels, often with cut, stained or
acid-etched glass.
21st century
In 2011 Howdens was awarded the John Hedgecock
memorial award for the Burford collection of internal
doors, recognising the very best in design application or
ability in joinery manufacture.
Thanks to this long history, Howdens now offers a wealth
of door designs.
We are constantly developing new products to keep
pace with changing tastes and meet ever more
demanding building regulations. See pages 08 to 129
for our full range of doors.
20th century & beyond
By the 1930s, a modern functional look was becoming
fashionable – facing panelled doors with hardboard to
create a flush door. More recent developments have
focused on creating doors that combine the look of a
traditional panelled timber door with the affordability of
a flush door. The result is today's moulded door.
Howdens & the history of doors
04|
Create different looks with the Howdens door visualiser
Complete the look of your room with the perfect internal door
Make a bold statement with our choice of external doors
The door visualiser on the Howdens website is designed to help you choose your perfect door and
visualise how it will look in your home. Either upload a photo of your home or choose from our gallery
of images.
Make your door truly unique through your choice of paint, lacquer or stain. Colour and finish can
transform the look and feel of a door. Gloss, satin or matt; contemporary or traditional colours;
or natural shades. There are many options to make your door individual to you.
Darker tones of red, blue and green are an established
choice for exterior doors on older properties. Traditional
interiors lend themselves to more muted beige
internal doors.
Doors painted or stained in natural shades work
beautifully as part of a co-ordinated design scheme.
This may be in a rustic cottage, modern family house
or chic loft apartment.
Traditional Natural
Bold and fresh colours characterise contemporary
design. A room may be mainly white, with an ‘accent’
wall or door in a rich, striking shade to create contrast.
There has been a great revival of this colour palette in
recent years. Some shades may appear to be strong
but when used in the right combination, can add
authenticity to a home.
Contemporary Heritage
You can find the door visualiser at www.howdens.com/advice-inspiration/door-visualiser
Or contact your local depot for more information.
Howdens door visualiser
|05
06|
How to get the best out of your doorOur range of joinery products have been carefully selected, offering a comprehensive choice of quality
products at unbeatable prices.
Although the information below has been written specifically for the handling, installation and
decorating of internal and external doors, the general principles of handling apply to all joinery
products and cabinetry.
Our range of doors, joinery and flooring use real timber and veneers. Wood is a naturally grown
material, meaning it is subject to variance in colour and grain.
Storage and handlingOnce purchased, all doors should be handled and stored with care. Doors should never be stored in
an area which is subjected to extremes in temperature or direct sunlight. The building should be well
ventilated and not recently plastered. Care should be taken in a centrally heated or air-conditioned
building where moisture content could build up. When stacking doors, they should be kept flat, on
at least three load bearers in order to distribute weight and remain in their packaging to prevent
damage.
InstallationIt is essential that doors, both internal and external, are fully sealed and any air gaps plugged
immediately after delivery. Doors should be sealed and primed on both faces and all four leading
edges. Refer to pages 92, 93, 127, 128 and 129 for full finishing instructions.
Any surface that has been cut should be sealed prior to hanging (e.g. drilled, cut for letterboxes,
hinges, locks, etc.). This is particularly important when the end grain is exposed. If the door has been
preservative treated, any newly exposed wood must be re-treated.
When trimming a door to size it is important that equal amounts are removed from both edges.
Please refer to individual door fitting instructions for further information.
DecorationProducts should be clean and dry. The instructions of the paint or stain manufacturer must be
adhered to. Please refer to pages 243 and 244 for stains and varnishes.
Failure to carry out the recommended instructions for decoration and sealing can seriously affect the
performance of the door. With a little care and by using good quality decorative products, Howdens
doors will serve well for years to come.
Care and maintenanceRegular maintenance of Howdens doors should be made in accordance with the stain/paint
manufacturer's instructions, to prevent breakdown of the wood finish and to protect the timber from
deterioration. Dusting the door (without polish) and cleaning any dirty marks with a damp cloth
(not wet) will be enough to keep the door looking fresh in the interim period. Harsh chemicals or
abrasive substances should not be used to clean the door.
Some of our glazed doors have glass that is covered in a
protective film which can be removed after the finishing process.
How to get the best out of your door
|07
The Burford joinery collectionFollowing the popularity of our range of Burford kitchens, we offer a collection of doors, joinery and
hardware that is specifically designed to match your Burford kitchen.
The Burford collection of internal doors is exclusive to Howdens and includes 4 panel moulded and
4 panel oak doors. Glazed doors are available in 4 panel oak and moulded.
Howdens’ Burford doors were awarded the Technical Excellence and Innovation Award
(John Hedgecock Memorial Award) in 2011. This award recognises the very best in design,
application or ability in joinery manufacture. The award was set up in memory of John Hedgecock,
the former Technical Director at the BWF, and recognises innovative products or projects and rewards
excellence in our industry.
Designed to match your Burford door is an exclusive range of contemporary and traditional
Burford skirting and architrave, available in primed and oak veneered finishes.
You can complete the look with hardware that has been chosen to match your Burford
kitchen handles.
The Burford joinery collection
Burford 4 Panel Oak Burford 4 Panel Burford 4 Panel Oak glazed
Burford Traditional skirting
and architraveBurford Brushed Stainless Steel
square rose handle
Burford primed contemporary skirting
and architrave
Internal moulded doors
We offer a variety of panel
configurations, designed for
traditional or contemporary interiors,
with either smooth or textured
surfaces.
These doors are made from
hardwearing, one-piece moulded
facings, bonded to a timber frame
and painted with a white base coat.
Bi-fold versions are ideal for small
areas and wardrobes, and we also
offer mobility sizes.
Within the 6 Panel grained door
range we have every door size and
style available.
Internal moulded doors
Fire Regulations:
FD Fire doorsFH Essential fire door hardwareFH Non-essential fire door hardware
Building Regulations:
E Part E doors - sound reducingL Part L doors - warmth and insulation suitable for new buildL Part L doors - warmth and insulation suitable for refurbishment projectsM Part M doors - mobility and access
08|
Internal moulded panel doors
Pre-finished Dordogne smoothThe superior finish on this door saves on finishing time and is perfect
for both classic and modern homes.
• Constructed using softwood timber stile and rail frame
• Fully finished on all surfacesVictorian
Budget Satin Nickel LatchDFU0641
Featured
hardware
H1981mm x W457mm (6’6” x 1’6”)
F Standard DIM1610
H1981mm x W533mm (6’6” x 1’9”)
F Standard DIM1620
H1981mm x W610mm (6’6” x 2’0”)
F Standard DIM1630
H1981mm x W686mm (6’6” x 2’3”)
F Standard DIM1640
P FD E FD30 DFM1640
H1981mm x W711mm (6’6” x 2’4”)
F Standard DIM1650
H1981mm x W762mm (6’6” x 2’6”)
F Standard DIM1660
P FD E FD30 DFM1660
H2032mm x W813mm (6’8” x 2’8”)
F M Standard DIM1680
H1981mm x W838mm (6’6” x 2’9”)
F M Standard DIM1670
P FD E FD30 DFM1670
H2040mm x W626mm
F Standard DIM1730
H2040mm x W726mm
F Standard DIM1740
H2040mm x W826mm
F M Standard DIM1760
H2040mm x W926mm
F M Standard DIM1770
|09
Pre-finished Dordogne smooth glazedThe glazing on this door allows as much light as possible into the
room whilst having a finish which is smoother than can be achieved
by hand.
• Constructed using softwood timber stile and rail frame
• Face fully finished
• Supplied with toughened etched glass
Alento Rose Polished /
Satin ChromeDFU1035
Featured
hardware
H1981mm x W686mm (6’6” x 2’3”)
Glazed DGM2040
H1981mm x W762mm (6’6” x 2’6”)
Glazed DGM2060
H1981mm x W838mm (6’6” x 2’9”)
M Glazed DGM2070
Internal moulded panel doors10|
Pre-finished 6 Panel grainedThe popular six panel grained design will suit a variety of interiors.
• Constructed using softwood timber stile and rail frame
• Face fully finishedPre-finished
Moulded Door Paint Solution
GAR0541
Associated
product
H1981mm x W457mm (6’6” x 1’6”)
Standard DIM1210
H1981mm x W533mm (6’6” x 1’9”)
Standard DIM1220
H1981mm x W610mm (6’6” x 2’0”)
F Standard DIM1230
H1981mm x W686mm (6’6” x 2’3”)
F Standard DIM1240
P FD E FD30 DIF8140
H1981mm x W711mm (6’6” x 2’4”)
Standard DIM1250
H1981mm x W762mm (6’6” x 2’6”)
F Standard DIM1260
P FD E FD30 DIF8160
H2032mm x W813mm (6’8” x 2’8”)
Standard DIM1280
H1981mm x W838mm (6’6” x 2’9”)
F M Standard DIM1270
P FD E M FD30 DIF8170
H2040mm x W626mm
Standard DIM1530
H2040mm x W726mm
F Standard DIM1540
H2040mm x W826mm
F M Standard DIM1560
H2040mm x W926mm
M Standard DIM1570
Internal moulded panel doors |11
Pre-finished 6 Panel grained glazedThe simple grained design of this door will suit many interiors.
• Constructed using softwood timber stile and rail frame
• Face fully finished
• Supplied with toughened glass
H1981mm x W686mm (6’6” x 2’3”)
Glazed DGM1940
H1981mm x W762mm (6’6” x 2’6”)
Glazed DGM1960
H1981mm x W838mm (6’6” x 2’9”)
M Glazed DGM1970
Internal moulded panel doors
Pre-finished Moulded
Door Paint Solution
GAR0541
Associated
product
12|
Burford 4 PanelAn elegantly simple four panel moulded door with clean lines
is shown with matching Burford Primed MDF traditional skirting,
architrave and hardware.
• Constructed using softwood timber stile and rail frame
• Ready for painting
• Matches Burford kitchen ranges
H1981mm x W457mm (6’6” x 1’6”)
F Standard DIC9810
H1981mm x W533mm (6’6” x 1’9”)
F Standard DIC9820
H1981mm x W610mm (6’6” x 2’0”)
F Standard DIC9830
H1981mm x W686mm (6’6” x 2’3”)
F Standard DIC9840
P FD E FD30 DIF2640
H1981mm x W762mm (6’6” x 2’6”)
F Standard DIC9860
P FD E FD30 DIF2660
H1981mm x W838mm (6’6” x 2’9”)
F M Standard DIC9870
P FD E M FD30 DIF2670
H2032mm x W813mm (6’8” x 2’8”)
F M Standard DIC9880
H2040mm x W626mm
F Standard DIC8530
H2040mm x W726mm
F Standard DIC8540
H2040mm x W826mm
F M Standard DIC8560
H2040mm x W926mm
F M Standard DIC8570
Burford Rose Brushed Stainless
SteelDFU0760
Featured
hardware
Internal moulded panel doors |13
Burford 4 Panel 2 light glazedA simple four panel design which complements a variety of interiors.
Shown with matching Burford Primed MDF contemporary skirting,
architrave and hardware.
• Constructed using softwood timber stile and rail frame
• Ready for painting
• Supplied with toughened clear glass
• Matches Burford kitchen ranges
H1981mm x W686mm (6’6” x 2’3”)
F Glazed DIC9140
H1981mm x W762mm (6’6” x 2’6”)
F Glazed DIC9160
H1981mm x W838mm (6’6” x 2’9”)
F M Glazed DIC9170
Burford Rose Brushed Stainless
SteelDFU0760
Featured
hardware
Internal moulded panel doors14|
4 Panel Shaker smoothWith its simple design this door suits both contemporary and
traditional interiors.
• Constructed using softwood timber stile and rail frame
• Ready for painting
H1981mm x W457mm (6’6” x 1’6”)
F Standard DIM1010
H1981mm x W533mm (6’6” x 1’9”)
F Standard DIM1020
H1981mm x W610mm (6’6” x 2’0”)
F Standard DIM1030
H1981mm x W686mm (6’6” x 2’3”)
F Standard DIM1040
P FD FD30 DFM1040
H1981mm x W711mm (6’6” x 2’4”)
F Standard DIM1050
H1981mm x W762mm (6’6” x 2’6”)
F Standard DIM1060
P FD FD30 DFM1060
H2032mm x W813mm (6’8” x 2’8”)
F M Standard DIM1080
H1981mm x W838mm (6’6” x 2’9”)
F M Standard DIM1070
P FD M FD30 DFM1070
H2040mm x W626mm
F Standard DIM1130
P FD FD30 DFM1130
H2040mm x W726mm
F Standard DIM1140
P FD FD30 DFM1140
H2040mm x W826mm
F M Standard DIM1160
P FD M FD30 DFM1160
H2040mm x W926mm
F M Standard DIM1170
P FD M FD30 DFM1170
Garda Rose Chrome
DFU0820
Featured
hardware
Internal moulded panel doors |15
4 Panel Shaker smooth glazedWith four glazed panels, this modern door allows plenty of light to
flood the room.
• Constructed using softwood timber stile and rail frame
• Ready for painting Mitred Lecco Rose LatchLAL1340
Featured
hardware
H1981mm x W686mm (6’6” x 2’3”)
F Standard DGM1840
H1981mm x W762mm (6’6” x 2’6”)
F Standard DGM1860
H1981mm x W838mm (6’6” x 2’9”)
F M Standard DGM1870
Internal moulded panel doors16|
Linear smoothThe smooth finish of this door lends itself to both modern and classic
interiors.
• Constructed using softwood timber stile and rail frame
• Ready for painting
H1981mm x W610mm (6’6” x 2’0”)
F Standard DIM1430
H1981mm x W686mm (6’6” x 2’3”)
F Standard DIM1440
P FD E Standard DFM1440
H1981mm x W762mm (6’6” x 2’6”)
F Standard DIM1460
P FD E Standard DFM1460
H1981mm x W838mm (6’6” x 2’9”)
F M Standard DIM1470
P FD E M Standard DFM1470
Newington Rose
Polished/Satin Chrome
DFU0836
Featured
hardware
Internal moulded panel doors |17
Arched Top grainedThe elegant mouldings and grained finish can be used to create a
modern or classic look.
• Constructed using softwood timber stile and rail frame
• Ready for painting
H1981mm x W457mm (6’6” x 1’6”)
F Standard DIC0728
H1981mm x W533mm (6’6” x 1’9”)
F Standard DIC0729
H1981mm x W610mm (6’6” x 2’0”)
F Standard DIC0730
H1981mm x W686mm (6’6” x 2’3”)
F Standard DIC0740
H1981mm x W762mm (6’6” x 2’6”)
F Standard DIC0760
H1981mm x W838mm (6’6” x 2’9”)
F M Standard DIC0770
Sofia Rose Chrome
DFU0709
Featured
hardware
Internal moulded panel doors18|
Arched Top grained 6 light glazedThe gentle arch and simple moulded panel adds interest to this door
whilst clear glazing allows plenty of light into the room.
• Constructed using softwood timber stile and rail frame
• Ready for painting
• Supplied with toughened clear glass
H1981mm x W686mm (6’6” x 2’3”)
F Glazed DGM1540
H1981mm x W762mm (6’6” x 2’6”)
F Glazed DGM1560
H1981mm x W838mm (6’6” x 2’9”)
F M Glazed DGM1570
Garda Latch Brass
DFU0701
Featured
hardware
Internal moulded panel doors |19
Dordogne smoothThe smooth finish of this door lends itself to both modern and classic
interiors.
• Constructed using softwood timber stile and rail frame
• Ready for painting
H1981mm x W457mm (6’6” x 1’6”)
F Standard DIC8310
H1981mm x W533mm (6’6” x 1’9”)
F Standard DIC8320
H1981mm x W610mm (6’6” x 2’0”)
F Standard DIC8330
H1981mm x W686mm (6’6” x 2’3”)
F Standard DIC8340
P FD E FD30 DIF7340
H1981mm x W711mm (6’6” x 2’4”)
F Standard DIC8350
H1981mm x W762mm (6’6” x 2’6”)
F Standard DIC8360
P FD E FD30 DIF7360
H1981mm x W838mm (6’6” x 2’9”)
F M Standard DIC8370
P FD E M FD30 DIF7370
H2032mm x W813mm (6’8” x 2’8”)
F Standard DIC8380
H2040mm x W626mm
F Standard DIM1330
H2040mm x W726mm
F Standard DIM1340
H2040mm x W826mm
F M Standard DIM1360
H2040mm x W926mm
F M Standard DIM1370
Arva Rose Polished/
Satin ChromeDFU0650
Featured
hardware
Internal moulded panel doors20|
Dordogne smooth glazedThe large and stylish panel used on this door allows for maximum
light to enter the room.
• Constructed using softwood timber stile and rail frame
• Ready for painting
• Supplied with toughened etched glass
H1981mm x W686mm (6’6” x 2’3”)
F Glazed DGM1640
H1981mm x W762mm (6’6” x 2’6”)
F Glazed DGM1660
H1981mm x W838mm (6’6” x 2’9”)
F M Glazed DGM1670
Lugano Rose Satin NickelDFU0725
Featured
hardware
Internal moulded panel doors |21
Dordogne smooth bi-foldThis space saving door is ideal for many interiors.
• Constructed using softwood timber stile and rail frame
• Ready for painting
H1981mm x W762mm (6’6” x 2’6”)
F Bi-Fold DIP1060
Featured
hardware
Internal moulded panel doors
Height includes bi-fold track
Brass Effect knob handle HKB1572
22|
4 Panel smoothThe understated style of this door makes it suitable for many kinds of
interiors and the elegant mouldings work well with most hardware.
• Constructed using softwood timber stile and rail frame
• Ready for painting
H1981mm x W457mm (6’6” x 1’6”)
F Standard DIC7410
H1981mm x W533mm (6’6” x 1’9”)
F Standard DIC7420
H1981mm x W610mm (6’6” x 2’0”)
F Standard DIC7430
P FD E FD30 DIF2930
H1981mm x W686mm (6’6” x 2’3”)
F Standard DIC7440
P FD E FD30 DIF2940
H1981mm x W762mm (6’6” x 2’6”)
F Standard DIC7460
P FD E FD30 DIF2960
H1981mm x W838mm (6’6” x 2’9”)
F M Standard DIC7470
P FD M E FD30 DIF2970
H2032mm x W813mm (6’8” x 2’8”)
F M Standard DIC7480
P FD M E FD30 DIF2980
Victorian Rose Chrome
DFU0072
Featured
hardware
Internal moulded panel doors |23
6 Panel smoothThis six panel door with a smooth surface gives a great opportunity
for a traditional paint finish.
• Constructed using softwood timber stile and rail frame
• Ready for painting
H1981mm x W457mm (6’6” x 1’6”)
F Standard DIC1010†
H1981mm x W533mm (6’6” x 1’9”)
F Standard DIC1020†
H1981mm x W610mm (6’6” x 2’0”)
F Standard DIC1030
H1981mm x W686mm (6’6” x 2’3”)
F Standard DIC1040
P FD E FD30 DIF1040
H1981mm x W762mm (6’6” x 2’6”)
F Standard DIC1060
P FD E FD30 DIF1060
H1981mm x W838mm (6’6” x 2’9”)
F M Standard DIC1070
P FD M E FD30 DIF1070
Victorian Rose Chrome
DFU0072
Featured
hardware
Internal moulded panel doors†Subject to availability
24|
4 Panel grainedThis door is ideal for both traditional and contemporary homes.
• Constructed using softwood timber stile and rail frame
• Ready for painting
H1981mm x W457mm (6’6” x 1’6”)
F Standard DIC2010
H1981mm x W533mm (6’6” x 1’9”)
F Standard DIC2020
H1981mm x W610mm (6’6” x 2’0”)
F Standard DIC2030
P FD E FD30 DIF0631
H1981mm x W686mm (6’6” x 2’3”)
F Standard DIC2040
P FD E FD30 DIF0641
H1981mm x W711mm (6’6” x 2’4”)
F Standard DIC2050
H1981mm x W762mm (6’6” x 2’6”)
F Standard DIC2060
P FD E FD30 DIF0661
H1981mm x W838mm (6’6” x 2’9”)
F M Standard DIC2070
P FD E M FD30 DIF0671
H2032mm x W813mm (6’8” x 2’8”)
F M Standard DIC2080
P FD E M FD30 DIF0681
H2040mm x W626mm
F Standard DIC1831
P FD E FD30 DIF2330
H2040mm x W726mm
F Standard DIC1841
P FD E FD30 DIF2340
H2040mm x W826mm
F M Standard DIC1861
P FD E M FD30 DIF2360
H2040mm x W926mm
F M Standard DIC1871
P FD E M FD30 DIF2370
Chrissi Latch Chrome
DFU0039
Featured
hardware
Internal moulded panel doors |25
4 Panel grained 2 light glazedThe simple decorative etched glazing of this door complements the
mouldings.
• Constructed using softwood timber stile and rail frame
• Ready for painting
• Supplied with toughened frosted glass
H1981mm x W686mm (6’6” x 2’3”)
F Glazed DGM1440
H1981mm x W762mm (6’6” x 2’6”)
F Glazed DGM1460
H1981mm x W838mm (6’6” x 2’9”)
F M Glazed DGM1470
Chrissi Latch Chrome
DFU0039
Featured
hardware
Internal moulded panel doors26|
4 Panel grained bi-foldThe grained surface of this traditional bi-fold door adds subtle texture
to any paint finish.
• Constructed using softwood timber stile and rail frame
• Ready for painting
• Supplied pre-hinged complete with running gear
• Two bi-fold can be hung next to each other
H1981mm x W686mm (6’6” x 2’3”)
F Bi-Fold DIP0240
H1981mm x W762mm (6’6” x 2’6”)
F Bi-Fold DIP0260
Height includes bi-fold track
Internal moulded panel doors
Featured
hardware
Oak Effect knob handleHKB1121
|27
6 Panel grainedOur most popular door is the six panel grained design. This door will suit
a wide variety of interiors and is available in an extensive range of sizes.
• Constructed using softwood timber stile and rail frame
• Ready for painting
H1981mm x W381mm (6’6” x 1’3”)
F Standard (3 Panel) DIC0900
H1981mm x W457mm (6’6” x 1’6”)
F Standard (3 Panel) DIC0910
H1981mm x W533mm (6’6” x 1’9”)
F Standard (3 Panel) DIC0920
H1981mm x W610mm (6’6” x 2’0”)
F Standard DIC0930
P Developer door DIC3930
P FD E FD30 DIF0531
H1981mm x W686mm (6’6” x 2’3”)
F Standard DIC0940
P Developer door DIC3940
P FD FD30 35mm DIF5440
P FD E FD30 DIF0541
H1981mm x W711mm (6’6” x 2’4”)
F Standard DIC0950
H1981mm x W762mm (6’6” x 2’6”)
F Standard DIC0960
P Developer door DIC3960
P FD FD30 35mm DIF5460
P FD E FD30 DIF0561
H1981mm x W838mm (6’6” x 2’9”)
F M Standard DIC0970
P M Developer door DIC3970
P FD M FD30 35mm DIF5470
P FD M E FD30 DIF0571
H1981mm x W864mm (6’6” x 2’10”)
F M Standard DIC0990
H2032mm x W813mm (6’8” x 2’8”)
F M Standard DIC0980
P FD M FD30 35mm DIF5480
P FD M E FD30 DIF0580
H2040mm x W526mm
F Standard (3 panel) DIC1921
P FD E FD30 (3 panel) DIF0920†
H2040mm x W626mm
F Standard DIC1931
P FD E FD30 DIF0930
H2040mm x W726mm
F Standard DIC1941
P FD E FD30 DIF0940
H2040mm x W826mm
F M Standard DIC1961
P FD M E FD30 DIF0960
H2040mm x W926mm
F M Standard DIC1971
P FD M E FD30 DIF0970
Mortice knob Chrome
DFU0063
Featured
hardware
Internal moulded panel doors†Subject to availability
28|
6 Panel grained 6 light glazedThe elegant glazing will brighten any interior whilst the simple design
has a versatile finish to suit any property.
• Constructed using softwood timber stile and rail frame
• Ready for painting
• Supplied with toughened clear glass
H1981mm x W610mm (6’6” x 2’0”)
F Glazed DGM1230
H1981mm x W686mm (6’6” x 2’3”)
F Glazed DGM1240
H1981mm x W762mm (6’6” x 2’6”)
F Glazed DGM1260
H1981mm x W838mm (6’6” x 2’9”)
F M Glazed DGM1270
H2032mm x W813mm (6’8” x 2’8”)
F M Glazed DGM1280
H2040mm x W626mm
F Glazed DGM1330
H2040mm x W726mm
F Glazed DGM1340
H2040mm x W826mm
F M Glazed DGM1360
H2040mm x W926mm
F M Glazed DGM1370
Mortice knob Brass
DFU0050
Featured
hardware
Internal moulded panel doors |29
6 Panel grained bi-foldIdeal where space is limited, this folding door combines
a natural-looking grain finish with practicality.
• Constructed using softwood timber stile and rail frame
• Primed and ready for painting
• Supplied pre-hinged complete with running gear
• Two bi-fold can be hung next to each other
H1981mm x W686mm (6’6” x 2’3”)
F Bi-Fold DIP0140
H1981mm x W762mm (6’6” x 2’6”)
F Bi-Fold DIP0160
Height includes bi-fold track
Internal moulded panel doors
Oak Effect knob handleHKB1121
Featured
hardware
30|
Internal softwood doors
This range features a wide choice of
glazed and panelled designs.
You can also specify mobility sizes
– and if space is an issue, there are
neat bi-fold options.
Glazed doors are supplied with all
glass toughened to BS EN 12600 or
BS EN 12150.
Our softwood doors are ready for
finishing with varnish, stain or paint.
Fire Regulations:
FD Fire doorsFH Essential fire door hardwareFH Non-essential fire door hardware
Building Regulations:
E Part E doors - sound reducingL Part L doors - warmth and insulation suitable for new buildL Part L doors - warmth and insulation suitable for refurbishment projectsM Part M doors - mobility and access
Internal softwood doors |31
Internal softwood doors
8 Light Clear Pine glazed†Perfect for maximising light within your home, this door can be
finished to suit your property (shown as a door pair).
• Constructed using engineered pine stiles and rails
• Ready for finishing with varnish, stain, paint or Osmo Oil
• Supplied with toughened clear glass
• Smaller sizes ideal for use as a door pair
H1981mm x W610mm (6’6” x 2’0”)
F Glazed DIS3830
H1981mm x W686mm (6’6” x 2’3”)
F Glazed DIS3840
H1981mm x W762mm (6’6” x 2’6”)
F Glazed DIS3860
H1981mm x W868mm (6’6” x 2’9”)
F M Glazed DIS3870
Mortice knob Brass
DFU0050
Featured
hardware
†Subject to availability32|
Pattern 10 Clear Pine glazed†This simple contemporary door keeps a home looking light and open.
• Constructed using engineered pine stiles and rails
• Ready for finishing with varnish, stain, paint or Osmo Oil
• Supplied with toughened clear glass
H1981mm x W762mm (6’6” x 2’6”)
F Glazed DIS2860
H1981mm x W838mm (6’6” x 2’9”)
F M Glazed DIS2870
Satin Nickel Flush handle
GIR3031
Featured
hardware
Internal softwood doors†Subject to availability
|33
Downham Clear Pine glazed†The distinctive nine light pine door suits both traditional and
contemporary interiors and can be finished to match any decor.
• Constructed using engineered pine stiles and rails
• Ready for finishing with varnish, stain, paint or Osmo Oil
• Supplied with toughened clear glass
H1981mm x W762mm (6’6” x 2’6”)
F Glazed DIS3960
H1981mm x W838mm (6’6” x 2’9”)
F M Glazed DIS3970
Victorian Latch
ChromeDFU0611
Featured
hardware
Internal softwood doors†Subject to availability
34|
†Subject to availability
6 Panel Clear pinePaint to suit any colour scheme or stain to keep the natural grain
visible for an authentic feel.
• Constructed using engineered pine stiles and rails
• Ready for finishing with varnish, stain, paint or Osmo Oil
H1981mm x W610mm (6’6” x 2’0”)
F Standard DIS1330
H1981mm x W686mm (6’6” x 2’3”)
F Standard DIS1340
H1981mm x W762mm (6’6” x 2’6”)
F Standard DIS1360
H1981mm x W838mm (6’6” x 2’9”)
F M Standard DIS1370
H2040mm x W626mm
F Standard DIS1730†
H2040mm x W726mm
F Standard DIS1740†
H2040mm x W826mm
F M Standard DIS1780†
Chrissi Latch Satin NickelDFU0045
Featured
hardware
Internal softwood doors |35
4 Panel Clear pineThis versatile pine door can benefit any style of room.
• Constructed using engineered pine stiles and rails
• Ready for finishing with varnish, stain, paint or Osmo Oil
H1981mm x W610mm (6’6” x 2’0”)
F Standard DIS3430
H1981mm x W686mm (6’6” x 2’3”)
F Standard DIS3440
FD FD30 DFD2540
H1981mm x W762mm (6’6” x 2’6”)
F Standard DIS3460
FD FD30 DFD2560
H1981mm x W838mm (6’6” x 2’9”)
F M Standard DIS3470
FD FD30 DFD2570
H2032mm x W813mm (6’8” x 2’8”)
F M Standard DIS3480
H2040mm x W726mm
F Standard DIS3640
H2040mm x W826mm
F M Standard DIS3680
Garda Latch Satin NickelDFU0719
Featured
hardware
Internal softwood doors36|
4 Panel Clear pine 2 light glazedTwo glass panes allow plenty of light to enter the room to
complement both contemporary and traditional interiors.
• Constructed using engineered pine stiles and rails
• Ready for finishing with varnish, stain, paint or Osmo Oil
• Supplied with toughened frosted glass
H1981mm x W686mm (6’6” x 2’3”)
F Glazed DIS3240
H1981mm x W762mm (6’6” x 2’6”)
F Glazed DIS3260
H1981mm x W838mm (6’6” x 2’9”)
F M Glazed DIS3270
H2032mm x W813mm (6’8” x 2’8”)
F M Glazed DIS3280
H2040mm x W726mm
F Glazed DIS3241
H2040mm x W826mm
F M Glazed DIS3261
Sofia Rose Chrome
DFU0709
Featured
hardware
Internal softwood doors |37
4 Panel Knotty Pine†Carefully constructed from high quality pine, this classic door will
complement many homes.
• Dowelled construction
• Ready for finishing with varnish, stain, paint or Osmo Oil
• Quality knotty pine timbers with raised and fielded panels
H1981mm x W610mm (6’6” x 2’0”)
Standard DIS2630
H1981mm x W686mm (6’6” x 2’3”)
Standard DIS2640
H1981mm x W762mm (6’6” x 2’6”)
Standard DIS2660
H1981mm x W838mm (6’6” x 2’9”)
M Standard DIS2670
Antique Ornate Latch
BlackDFU0028
Featured
hardware
Internal softwood doors†Subject to availability
38|
Internal primed stile and rail doors
Offering standard and glazed designs,
these primed doors are constructed
using glue and dowel and slab
constructions with HDF skins.
Glazed doors are supplied with all
glass toughened to BS EN 12600 or
BS EN 12150.
Stile and rail doors are supplied
primed, ready for finishing with paint.
Internal primed stile & rail doors
Fire Regulations:
FD Fire doorsFH Essential fire door hardwareFH Non-essential fire door hardware
Building Regulations:
E Part E doors - sound reducingL Part L doors - warmth and insulation suitable for new buildL Part L doors - warmth and insulation suitable for refurbishment projectsM Part M doors - mobility and access
|39
Internal primed stile & rail doors
Primed DordogneThis Dordogne styled door can be used in conjunction with the glazed
version or on its own.
• Constructed using veneered particleboard stiles and rails
• Primed and ready for painting
H1981mm x W610mm (6’6” x 2’0”)
Standard DIR1330
H1981mm x W686mm (6’6” x 2’3”)
Standard DIR1340
FD FD30 DFD1340
H1981mm x W762mm (6’6” x 2’6”)
Standard DIR1360
FD FD30 DFD1360
H1981mm x W838mm (6’6” x 2’9”)
M Standard DIR1370
FD M FD30 DFD1370
Durham Latch Pewter
DFU0740
Featured
hardware
40|
Primed Dordogne glazedThe etched glazing of this door adds interest whilst allowing plenty of
light into the room.
• Constructed using engineered stiles and rails
• Primed and ready for painting
• Supplied with toughened etched glass
H1981mm x W686mm (6’6” x 2’3”)
Glazed DGT1340
H1981mm x W762mm (6’6” x 2’6”)
Glazed DGT1360
H1981mm x W838mm (6’6” x 2’9”)
M Glazed DGT1370
Lugano Rose Satin NickelDFU0725
Featured
hardware
Internal primed stile & rail doors |41
Primed LinearThis contemporary style of door with its clean lines is perfect for any
home.
• Constructed using veneered particleboard slab
• Primed and ready for paintingGarda Latch
BrassDFU0701
Featured
hardware
H1981mm x W610mm (6’6” x 2’0”)
Standard DIR1530
H1981mm x W686mm (6’6” x 2’3”)
Standard DIR1540
FD FD30 DIF8640
H1981mm x W762mm (6’6” x 2’6”)
Standard DIR1560
FD FD30 DIF8660
H1981mm x W838mm (6’6” x 2’9”)
M Standard DIR1570
FD M FD30 DIF8670
Internal primed stile & rail doors42|
Primed 4 Panel ShakerA versatile four panel Shaker style door. Use in conjunction with its
glazed version or on its own.
• Constructed using engineered stiles and rails
• Primed and ready for painting
H1981mm x W610mm (6’6” x 2’0”)
Standard DIR1230
H1981mm x W686mm (6’6” x 2’3”)
Standard DIR1240
FD FD30 DIF8340
H1981mm x W762mm (6’6” x 2’6”)
Standard DIR1260
FD FD30 DIF8360
H1981mm x W838mm (6’6” x 2’9”)
M Standard DIR1270
FD M FD30 DIF8370
Garda Bathroom Chrome
DFU0737
Featured
hardware
Internal primed stile & rail doors |43
Primed 4 Panel Shaker glazedFour clear glass panes add interest and light to modern interiors.
• Constructed using engineered stiles and rails
• Primed and ready for painting
• Supplied with toughened clear glass
H1981mm x W686mm (6’6” x 2’3”)
Glazed DGT1240
H1981mm x W762mm (6’6” x 2’6”)
Glazed DGT1260
H1981mm x W838mm (6’6” x 2’9”)
M Glazed DGT1270
Turin Rose Satin
Stainless Steel
DFU0727
Featured
hardware
Internal primed stile & rail doors44|
Primed WorcesterThis simple, elegant door can be painted to suit any colour scheme.
• Constructed using particleboard stiles and rails
• MDF centre panels
• Primed and ready for painting
H1981mm x W610mm (6’6” x 2’0”)
Standard DIR1130
H1981mm x W686mm (6’6” x 2’3”)
Standard DIR1140
H1981mm x W762mm (6’6” x 2’6”)
Standard DIR1160
H1981mm x W838mm (6’6” x 2’9”)
M Standard DIR1170
Chrissi Latch Chrome
DFU0039
Featured
hardware
Internal primed stile & rail doors |45
Primed Worcester glazedThe minimalist look of the glazed door can enhance many interiors
and allows light to flow from room to room.
• Constructed using engineered stiles and rails
• Primed and ready for painting
• Supplied with toughened clear glass
H1981mm x W686mm (6’6” x 2’3”)
Glazed DGT1140
H1981mm x W762mm (6’6” x 2’6”)
Glazed DGT1160
H1981mm x W838mm (6’6” x 2’9”)
M Glazed DGT1170
Garda Latch Chrome
DFU0705
Featured
hardware
Internal primed stile & rail doors46|
Internal hardwood doors
Internal hardwood doors
Howdens oak and hardwood doors
have an engineered construction and
several fire door versions are available
in different designs.
We offer a varied choice of glazed and
panelled designs, as well as mobility
sizes and bi-fold doors which are ideal
for small spaces and wardrobes.
Within the Dordogne Oak door range
we have every door size and style
available.
Fire Regulations:
FD Fire doorsFH Essential fire door hardwareFH Non-essential fire door hardware
Building Regulations:
E Part E doors - sound reducingL Part L doors - warmth and insulation suitable for new buildL Part L doors - warmth and insulation suitable for refurbishment projectsM Part M doors - mobility and access
|47
Internal hardwood doors
Solid Rustic Oak ledgedThe Solid Rustic Oak Ledged door adds character to your home by
providing an authentic look and feel.
• Tongue and groove joints with glued and nailed ledges
• Ready for finishing with varnish, stain or Osmo Oil
H1981mm x W610mm (6’6” x 2’0”)
Standard DIE3430
H1981mm x W686mm (6’6” x 2’3”)
Standard DIE3440
H1981mm x W762mm (6’6” x 2’6”)
Standard DIE3460
H1981mm x W838mm (6’6” x 2’9”)
M Standard DIE3470
Suffolk Latch Antique Black
LAL0115
Featured
hardware
48|
Pre-finished Linear OakThe contemporary style of this Linear door will fit perfectly into any
modern home.
• All surfaces fully finished
H1981mm x W610mm (6’6” x 2’0”)
Standard DIE7130
H1981mm x W686mm (6’6” x 2’3”)
Standard DIE7140
FD FD30 DIF9540
H1981mm x W792mm (6’6” x 2’6”)
Standard DIE7160
FD FD30 DIF9560
H1981mm x W838mm (6’6” x 2’9”)
M Standard DIE7170
FD M FD30 DIF9570
Lugano Latch Chrome
DFU0905
Featured
hardware
Internal hardwood doors |49
4 Panel OakThe solid oak bolection mouldings and sturdy construction reflect this
door’s superior quality.
• Constructed using veneered particleboard stiles and rails
• Ready for finishing with varnish, stain, paint or Osmo Oil
H1981mm x W610mm (6’6” x 2’0”)
Standard DIE4030
H1981mm x W686mm (6’6” x 2’3”)
Standard DIE4040
FD FD30 DFD4040
H1981mm x W762mm (6’6” x 2’6”)
Standard DIE4060
FD FD30 DFD4060
H1981mm x W838mm (6’6” x 2’9”)
M Standard DIE4070
FD M FD30 DFD4070
H2032mm x W813mm (6’8” x 2’8”)
M Standard DIE4080†
H2040mm x W626mm
Standard DIE4460
H2040mm x W726mm
Standard DIE4470
FD FD30 DFD4470
H2040mm x W826mm
M Standard DIE4480
FD M FD30 DFD4480
H2040mm x W926mm
M Standard DIE4490
FD M FD30 DFD4490
Garda Latch Brass
DFU0701
Featured
hardware
†Subject to availabilityInternal hardwood doors50|
4 Panel Oak 2 light glazedA simple four panel design with solid oak bolection mouldings.
• Constructed using veneered particleboard stiles and rails
• Ready for finishing with varnish, stain or Osmo Oil
• Supplied with toughened, clear bevelled glass
H1981mm x W686mm (6’6” x 2’3”)
Glazed DIE4140
H1981mm x W762mm (6’6” x 2’6”)
Glazed DIE4160
H1981mm x W838mm (6’6” x 2’9”)
M Glazed DIE4170
H2040mm x W726mm
Glazed DIE4570
H2040mm x W826mm
M Glazed DIE4580
Lugano Latch Chrome
DFU0905
Featured
hardware
Internal hardwood doors |51
Linear OakThe contemporary style of this linear door will fit perfectly into any
modern home.
• Constructed using veneered particleboard slab
• Ready for finishing with varnish, stain or Osmo OilBurford Rose
Brushed Stainless
SteelDFU0760
Featured
hardware
H1981mm x W610mm (6’6” x 2’0”)
Standard DIE2230
H1981mm x W686mm (6’6” x 2’3”)
Standard DIE2240
FD FD30 DFD3940
H1981mm x W762mm (6’6” x 2’6”)
Standard DIE2260
FD FD30 DFD3960
H1981mm x W838mm (6’6” x 2’9”)
M Standard DIE2270
FD M FD30 DFD3970
Internal hardwood doors52|
Linear Oak glazedThe distinctive diamond cut grooves in this glazed version of the
Linear Oak door adds interest while allowing plenty of light into the
room.
• Constructed using veneered particleboard stiles and rails
• Ready for finishing with varnish, stain or Osmo Oil
• Supplied with clear toughened diamond cut glass
H1981mm x W762mm (6’6” x 2’6”)
Glazed DIE2860
H1981mm x W838mm (6’6” x 2’9”)
M Glazed DIE2870
Garda Latch Satin NickelDFU0719
Featured
hardware
Internal hardwood doors |53
Worcester OakThis oak engineered door has a stylish design and classic panels that
sit comfortably in both traditional and modern homes.
• Constructed using veneered particleboard stiles and rails
• Constructed using engineered stiles and rails
• Ready for finishing with varnish, stain or Osmo Oil
H1981mm x W610mm (6’6” x 2’0”)
Standard DIC6430
H1981mm x W686mm (6’6” x 2’3”)
Standard DIC6440
FD FD30 DFD6540
H1981mm x W762mm (6’6” x 2’6”)
Standard DIC6460
FD FD30 DFD6560
H1981mm x W838mm (6’6” x 2’9”)
M Standard DIC6470
FD M FD30 DFD6570
Lago Rose Polished Stainless
SteelDFU0729
Featured
hardware
Internal hardwood doors54|
Worcester Oak glazedThe distinctive glazed panels of this door are suited to allow optimum
levels of light to pass from room to room.
• Constructed using veneered particleboard stiles and rails
• Ready for finishing with varnish, stain or Osmo Oil
• Supplied with toughened clear glass
H1981mm x W686mm (6’6” x 2’3”)
Glazed DIC6540
H1981mm x W762mm (6’6” x 2’6”)
Glazed DIC6560
H1981mm x W838mm (6’6” x 2’9”)
M Glazed DIC6570
Riva Rose Satin NickelDFU0470
Featured
hardware
Internal hardwood doors |55
4 Panel Oak ShakerThe simple look of this Shaker oak door, with its flat panels and clean
lines, suits both modern and classic interiors.
• Constructed using veneered particleboard stiles and rails
• Ready for finishing with varnish, stain or Osmo Oil
H1981mm x W610mm (6’6” x 2’0”)
Standard DIE5130
H1981mm x W686mm (6’6” x 2’3”)
Standard DIE5140
FD FD30 DIF7440
H1981mm x W762mm (6’6” x 2’6”)
Standard DIE5160
FD FD30 DIF7460
H1981mm x W838mm (6’6” x 2’9”)
M Standard DIE5170
FD M FD30 DIF7470
Lugano Rose Satin NickelDFU0725
Featured
hardware
Internal hardwood doors56|
4 Panel Oak Shaker glazedThis contemporary engineered oak door with four glazed panels
allows plenty of light to enter a room. The glass design has a clear
border within each frosted pane.
• Constructed using veneered particleboard stiles and rails
• Ready for finishing with varnish, stain or Osmo Oil
• Supplied with toughened frosted glass
H1981mm x W762mm (6’6” x 2’6”)
Glazed DIE5360
H1981mm x W838mm (6’6” x 2’9”)
M Glazed DIE5370
Garda Rose Brass
DFU0819
Featured
hardware
Internal hardwood doors |57
Dordogne OakWith its bold design, the Dordogne Oak adds a sense of heritage
to traditional interiors.
• Constructed using engineered stiles and rails
• Ready for finishing with varnish, stain, paint or Osmo Oil
H1981mm x W381mm (6’6” x 1’3”)
Standard DIE4600
H1981mm x W457mm (6’6” x 1’6”)
Standard DIE4610
H1981mm x W533mm (6’6” x 1’9”)
Standard DIE4620
H1981mm x W610mm (6’6” x 2’0”)
Standard DIE6630
FD FD30 DFD4130
H1981mm x W686mm (6’6” x 2’3”)
Standard DIE6640
FD FD30 35mm DFD2440
FD FD30 DFD5840
H1981mm x W711mm (6’6” x 2’4”)
Standard DIE4650
H1981mm x W762mm (6’6” x 2’6”)
Standard DIE6660
FD FD30 35mm DFD2460
FD FD30 DFD5860
H1981mm x W838mm (6’6” x 2’9”)
M Standard DIE6670
FD M FD30 35mm DFD2470
FD M FD30 DFD5870
H1981mm x W864mm (6’6” x 2’10”)
M Standard DIE4690
H2032mm x W813mm (6’8” x 2’8”)
M Standard DIE4680
FD M FD30 35mm DFD2480
FD M FD30 DFD4180
H2040mm x W626mm
Standard DIE6631
FD FD30 DFD4930
H2040mm x W726mm
Standard DIE6641
FD FD30 DFD4940
H2040mm x W826mm
M Standard DIE6661
FD M FD30 DFD4960
H2040mm x W926mm
M Standard DIE6671
FD M FD30 DFD4970
Garda Rose Chrome
DFU0820
Featured
hardware
Internal hardwood doors58|
Dordogne Oak glazedThis elegant glazed version of the Dordogne Oak allows more light
into your home.
• Ready for finishing with varnish, stain, paint or Osmo Oil
• Supplied with toughened etched glass
H1981mm x W610mm (6’6” x 2’0”)
Glazed DIE5030
H1981mm x W686mm (6’6” x 2’3”)
Glazed DIE5440
H1981mm x W762mm (6’6” x 2’6”)
Glazed DIE5460
H1981mm x W838mm (6’6” x 2’9”)
M Glazed DIE5470
H2032mm x W813mm (6’8” x 2’8”)
M Glazed DIE5080
H2040mm x W626mm
Glazed DIE5230
H2040mm x W726mm
Glazed DIE5240
H2040mm x W826mm
M Glazed DIE5260
H2040mm x W926mm
M Glazed DIE5270
Idro Latch Brass
DFU0601
Featured
hardware
Internal hardwood doors |59
Dordogne Oak bi-foldWith a bold design, this bi-fold door works well in traditional interiors
where space is limited.
• Constructed using veneered particleboard stiles and rails
• Ready for finishing with varnish, stain, paint or Osmo Oil
• Supplied with premium bi-fold door track
• Two bi-folds can be hung next to each other
H1981mm x W686mm (6’6” x 2’3”)
Bi-Fold DIP0940
H1981mm x W762mm (6’6” x 2’6”)
Bi-Fold DIP0960
Brass Effect knob handle HKB1572
Featured
hardware
Height includes bi-fold track
Internal hardwood doors60|
Burford 4 Panel OakThis classic oak door complements traditional and contemporary
interiors, and is fitted with matching Burford Contemporary oak
veneered skirting and architrave.
• Constructed using veneered particleboard stiles and rails
• Ready for finishing with varnish, stain, paint or Osmo Oil
• Matches Burford kitchen ranges
H1981mm x W610mm (6’6” x 2’0”)
Standard DIE7730
H1981mm x W686mm (6’6” x 2’3”)
Standard DIE7740
FD30 DIF5940
H1981mm x W762mm (6’6” x 2’6”)
Standard DIE7760
FD30 DIF5960
H1981mm x W838mm (6’6” x 2’9”)
M Standard DIE7770
M FD30 DIF5970
Burford Rose Brushed Stainless
SteelDFU0760
Featured
hardware
Internal hardwood doors |61
Burford 4 Panel Oak glazedThe two glass panes of this classic door complement a variety of
interiors.
• Constructed using veneered particleboard stiles and rails
• Ready for finishing with varnish, stain, paint or Osmo Oil
• Supplied with toughened clear glass
• Matches Burford kitchen ranges
H1981mm x W686mm (6’6” x 2’3”)
Glazed DIE7840
H1981mm x W762mm (6’6” x 2’6”)
Glazed DIE7860
H1981mm x W838mm (6’6” x 2’9”)
M Glazed DIE7870
Arva Rose Polished/
Satin ChromeDFU0650
Featured
hardware
Internal hardwood doors62|
Victorian 4 Panel OakThe understated style of this door makes it ideal for both traditional
and contemporary homes.
• Constructed using veneered particleboard stiles and rails
• Ready for finishing with varnish, stain or Osmo OilGarda Rose
BrassDFU0819
Featured
hardware
†Subject to availabilityInternal hardwood doors
H1981mm x W838mm (6’6” x 2’9”)
Standard DIE7370†
|63
Victorian 4 Panel Oak glazedA simple four panel design door, supplied with two clear glazed
panels.
• Constructed using veneered particleboard stiles and rails
• Ready for finishing with varnish, stain or Osmo Oil
• Supplied with toughened clear glass
H1981mm x W838mm (6’6” x 2’9”)
M Glazed DIE7470†
Victorian Latch BrassDFU0621
Featured
hardware
Internal hardwood doors†Subject to availability
64|
Westlock OakPerfect for a more contemporary setting, this engineered door is a
great addition to the home.
• Constructed using veneered particleboard stiles and rails
• Ready for finishing with varnish, stain or Osmo Oil
H1981mm x W610mm (6’6” x 2’0”)
Standard DIE2530
H1981mm x W686mm (6’6” x 2’3”)
Standard DIE2540
H1981mm x W762mm (6’6” x 2’6”)
Standard DIE2560
H1981mm x W838mm (6’6” x 2’9”)
M Standard DIE2570
Sofia Rose Chrome
DFU0709
Featured
hardware
Internal hardwood doors |65
Pre-finished Holdenby OakPre-finished with an oak-enhancing lacquer, this classic design will
work well in both contemporary and traditional settings.
• Dowel and glue or slab construction
• All faces fully finished
H1981mm x W610mm (6’6” x 2’0”)
Standard DIE8830
H1981mm x W686mm (6’6” x 2’3”)
Standard DIE8840
FD FD30 DIF9140
H1981mm x W762mm (6’6” x 2’6”)
Standard DIE8860
FD FD30 DIF9160
H1981mm x W838mm (6’6” x 2’9”)
M Standard DIE8870
FD M FD30 DIF9170
Internal hardwood doors
Pre-finished Oak Lacquer Spray
Repair kitGAR0540
Associated
hardware
66|
Pre-finished Genoa OakThe simple yet stylish door is ideal for both classic and contemporary
interiors.
• All faces fully varnished
H1981mm x W610mm (6’6” x 2’0”)
Standard DIE7230
H1981mm x W686mm (6’6” x 2’3”)
Standard DIE7240
FD FD30 DIF8540
H1981mm x W711mm (6’6” x 2’4”)
Standard DIE7250
H1981mm x W762mm (6’6” x 2’6”)
Standard DIE7260
FD FD30 DIF8560
H2030mm x W813mm (6’8” x 2’8”)
M Standard DIE7280
H1981mm x W838mm (6’6” x 2’9”)
M Standard DIE7270
FD M FD30 DIF8570
H2040mmx W726mm
Standard DIE8440
H2040mm x W826mm
M Standard DIE8460
Sofia Rose Satin NickelDFU0726
Featured
hardware
Internal hardwood doors |67
Pre-finished Genoa Oak glazedThe glazed option of the pre-finished Genoa Oak door allows light into
the room whilst working in both classic and contemporary interiors.
• Constructed using veneered particleboard stiles and rails
• All faces fully finished
• Supplied with clear toughened glass with screen printed lines
H1981mm x W762mm (6’6” x 2’6”)
Glazed DIE8560
H1981mm x W838mm (6’6” x 2’9”)
M Glazed DIE8570
Pre-finished Oak Lacquer Spray
Repair kitGAR0540
Internal hardwood doors
Associated
hardware
68|
Holdenby OakWith its cottage style design, the Holdenby Oak fits with both
contemporary and traditional interiors.
• Dowel and glue construction or slab construction
• Ready for finishing with varnish, stain or Osmo Oil
H1981mm x W457mm (6’6” x 1’6”)
Standard DIE6910
H1981mm x W533mm (6’6” x 1’9”)
Standard DIE6920
H1981mm x W610mm (6’6” x 2’0”)
Standard DIE6930
H1981mm x W686mm (6’6” x 2’3”)
Standard DIE6940
FD FD30 DIF7540
H1981mm x W711mm (6’6” x 2’4”)
Standard DIE6950
H1981mm x W762mm (6’6” x 2’6”)
Standard DIE6960
FD FD30 DIF7560
H1981mm x W838mm (6’6” x 2’9”)
M Standard DIE6970
FD FD30 DIF7570
H2032mm x W813mm (6’8” x 2’8”)
M Standard DIE6980
H2040mm x W626mm
P Standard DIE6931
H2040mm x W726mm
Standard DIE6941
H2040mm x W826mm
M Standard DIE6961
H2040mm x W926mm
P M Standard DIE6971
Idro Latch Chrome
DFU0604
Featured
hardware
Internal hardwood doors |69
Holdenby Oak glazedThis classic glazed version of the Holdenby Oak complements
a variety of interiors.
• Slab construction
• Ready for finishing with varnish, stain or Osmo Oil
• Supplied with toughened screen printed glass
H1981mm x W610mm (6’6” x 2’3”)
Glazed DIE8040
H1981mm x W762mm (6’6” x 2’6”)
Glazed DIE8060
H1981mm x W838mm (6’6” x 2’9”)
M Glazed DIE8070
H2040mm x W726mm
Glazed DIE8140
H2040mm x W826mm
M Glazed DIE8160
Capri Rose Polished/
Satin ChromeDFU0454
Featured
hardware
Internal hardwood doors70|
Genoa OakThis simple yet stylish door is ideal for both classic and contemporary
interiors.
• Constructed using veneered particleboard stiles and rails
• Constructed using engineered stiles and rails
• Ready for finishing with varnish, stain or Osmo Oil
H1981mm x W457mm (6’6” x 1’6”)
Standard DIE6410
H1981mm x W533mm (6’6” x 1’9”)
Standard DIE6420
H1981mm x W610mm (6’6” x 2’0”)
Standard DIE6430
H1981mm x W686mm (6’6” x 2’3”)
Standard DIE6440
FD FD30 DFD2840
H1981mm x W711mm (6’6” x 2’4”)
Standard DIE6450
H1981mm x W762mm (6’6” x 2’6”)
Standard DIE6460
FD FD30 DFD2860
H1981mm x W838mm (6’6” x 2’9”)
M Standard DIE6470
FD M FD30 DFD2870
H2032mm x W813mm (6’8” x 2’8”)
M Standard DIE6480
H2040mm x W626mm
Standard DIE6830
H2040mm x W726mm
Standard DIE6840
H2040mm x W826mm
M Standard DIE6860
H2040mm x W926mm
M Standard DIE6890
Idro Latch Chrome
DFU0604
Featured
hardware
Internal hardwood doors |71
Genoa Oak glazedThis glazed option of the Genoa Oak door adds interest and works
well in both modern and classic interiors.
• Constructed using veneered particleboard stiles and rails
• Ready for finishing with varnish, stain or Osmo Oil
• Supplied with clear toughened glass with screen printed lines
H1981mm x W686mm (6’6” x 2’3”)
Glazed DIE6740
H1981mm x W762mm (6’6” x 2’6”)
Glazed DIE6760
H1981mm x W838mm (6’6” x 2’9”)
M Glazed DIE6770
Garda Latch Chrome
DFU0705
Featured
hardware
Internal hardwood doors72|
H1981mm x W686mm (6’6” x 2’3”)
Bi-Fold DIP1449
H1981mm x W762mm (6’6” x 2’6”)
Bi-Fold DIP1469
Genoa Oak bi-foldThe classic cottage style of door is timeless and works well when
there is limited space.
• Constructed using veneered particleboard stiles and rails
• Ready for finishing with varnish, stain or Osmo Oil
Featured
hardware
Height includes bi-fold track
Internal hardwood doors
Brass Effect knob handle HKB1572
|73
Internal flush doors
Howdens offer modern doors in
a range of finishes ideal for both
commercial and contemporary
domestic interiors.
Our range includes mobility sizes,
choice of lightweight standard cores
and fire-rated options, with or without
window apertures.
Our apertured fire doors are supplied
fully glazed and include a number
of options designed to meet the
effective visibility requirements for
Part M mobility doors.
Fire Regulations:
FD Fire doorsFH Essential fire door hardwareFH Non-essential fire door hardware
Building Regulations:
E Part E doors - sound reducingL Part L doors - warmth and insulation suitable for new buildL Part L doors - warmth and insulation suitable for refurbishment projectsM Part M doors - mobility and access
Internal flush doors74|
Oak foil 16G glazedThis internal commercial door complies with Part M regulations on
minimum zones of visibility and is highly functional.
• Constructed using softwood timber stile and rail frame
• Face fully finished
• Supplied with Georgian wired glass
H1981mm x W686mm (6’6” x 2’3”)
FD E FD30 Glazed DFL1540
H1981mm x W762mm (6’6” x 2’6”)
FD E FD30 Glazed DIF3660
H1981mm x W838mm (6’6” x 2’9”)
FD M E FD30 Glazed DIF3670
H2040mm x W826mm
FD M E FD30 Glazed DIF3161
H2040mm x W926mm
FD M E FD30 Glazed DIF3171
Stainless Steel concealed fixing
handleDFU0136
Featured
hardware
Internal flush doors |75
Light Grey Oak foil 20G glazedIdeal for both domestic and commercial interiors whilst the clear
glass allows plenty of light in.
• Constructed using softwood timber stile and rail frame
• Face fully finished
• Supplied with clear glass
H1981mm x W686mm (6’6” x 2’3”)
FD E FD30 Glazed DIF8040
H1981mm x W762mm (6’6” x 2’6”)
FD E FD30 Glazed DIF8060
H1981mm x W838mm (6’6” x 2’9”)
FD M E FD30 Glazed DIF8070
Stainless Steel
fingerplate DFU0094
Featured
hardware
Internal flush doors76|
Ash veneer 16G glazedIdeal for offices and other public spaces, the Ash Veneer 16G Glazed
features natural crown-cut timber veneer. The window style complies
with Part M regulations on minimum zones of visibility.
• Constructed using softwood timber stile and rail frame
• Face fully varnished
• Lipped on two long edges
• Supplied with Georgian wired glass
H1981mm x W762mm (6’6” x 2’6”)
FD E FD30 Glazed DIF3790
H1981mm x W838mm (6’6” x 2’9”)
FD M E FD30 Glazed DIF3750
H2040mm x W826mm
FD M E FD30 Glazed DIF3240
H2040mm x W926mm
FD M E FD30 Glazed DIF3250
Stainless Steel
fingerplate DFU0094
Featured
hardware
Internal flush doors |77
Oak Foil 20G glazedThe clear glass on this door means its design suits homes and
commercial settings whilst allowing light into the space.
• Constructed using softwood timber stile and rail frame
• Face fully finished
• Supplied with clear glass
H1981mm x W686mm (6’6” x 2’3”)
FD E FD30 DIF7840
H1981mm x W762mm (6’6” x 2’6”)
FD E FD30 DIF7860
H1981mm x W838mm (6’6” x 2’9”)
FD M E FD30 DIF7870
H2040mm x W826mm
FD M E FD30 DIF7760
H2040mm x W926mm
FD M E FD30 DIF7770
Stainless Steel
fingerplate DFU0094
Featured
hardware
Internal flush doors78|
Ply 20G glazedThis versatile door is ideal for commercial environments but also it
complies with Part M regulations on minimum zones of visibility.
• Constructed using softwood timber stile and rail frame
• Ready for painting
• Supplied with Georgian wired glass
H1981mm x W686mm (6’6” x 2’3”)
P FD E FD30 DFL1740
H1981mm x W762mm (6’6” x 2’6”)
P FD E FD30 DIF7960
H1981mm x W838mm (6’6” x 2’9”)
P FD M E FD30 DIF7970
H2040mm x W826mm
P FD M E FD30 DFL1860
H2040mm x W926mm
P FD M E FD30 DFL1870
Internal flush doors
Edinburgh Lock
Aluminium DFU0086
Featured
hardware
|79
Ply 16G glazedThis plywood door complies with Part M regulations on minimum
zones of visibility.
• Constructed using softwood timber stile and rail frame
• Ready for painting
• Lipped on two long edges
• Supplied with Georgian wired glass
H1981mm x W686mm (6’6” x 2’3”)
P FD E FD30 Glazed DIF3340
H1981mm x W762mm (6’6” x 2’6”)
P FD E FD30 Glazed DIF3360
H1981mm x W838mm (6’6” x 2’9”)
P FD M E FD30 Glazed DIF3370
H2040mm x W826mm
P FD M E FD30 Glazed DIF9460
H2040mm x W926mm
P FD M E FD30 Glazed DIF9470
Internal flush doors
Stainless Steel
fingerplate DFU0094
Featured
hardware
80|
Ply G/O glazedThe square window of the Ply G/O glazed makes it suitable for many
internal applications.
• Constructed using softwood timber stile and rail frame
• Ready for painting
• Lipped on two long edges
• Supplied with Georgian wired glass
H1981mm x W686mm (6’6” x 2’3”)
P FD E FD30 Glazed DIF4640
H1981mm x W762mm (6’6” x 2’6”)
P FD E FD30 Glazed DIF4660
H1981mm x W838mm (6’6” x 2’9”)
P FD M E FD30 Glazed DIF4670
H2032mm x W813mm (6’8” x 2’8”)
P FD M E FD30 Glazed DIF4680
H2040mm x W826mm
P FD M E FD30 Glazed DIF5280
H2040mm x W926mm
P FD M E FD30 Glazed DIF5290
Stainless Steel
fingerplate DFU0094
Featured
hardware
Internal flush doors |81
Dordogne Inlaid Oak veneerThis Dordogne styled flush door is fully finished on all faces and
inlaid with real walnut.
• Constructed using softwood timber stile and rail frame
• All faces fully varnished with walnut inlay
H1981mm x W686mm (6’6” x 2’3”)
Standard DIL1240
FD FD30 DFL1240
H1981mm x W762mm (6’6” x 2’6”)
Standard DIL1260
FD FD30 DFL1260
H1981mm x W838mm (6’6” x 2’9”)
M Standard DIL1270
FD M FD30 DFL1270
Capri Rose Polished/
Satin ChromeDFU0454
Featured
hardware
Internal flush doors82|
Oak VeneerThe natural timber veneer of this door ensures a classic and timeless
feel for a variety of domestic and commercial environments.
• Constructed using softwood timber stile and rail frame
• All faces fully finished
H1981mm x W610mm (6’6” x 2’0”)
Standard DIL1830
H1981mm x W686mm (6’6” x 2’3”)
Standard DIL1840
FD E FD30 DIF9640
H1981mm x W762mm (6’6” x 2’6”)
Standard DIL1860
FD E FD30 DIF9660
H1981mm x W838mm (6’6” x 2’9”)
M Standard DIL1870
FD M E FD30 DIF9670
H2040mm x W826mm
FD M E FD30 DIF9760
H2040mm x W926mm
FD M E FD30 DIF9770
Aluminium Roundbar
Latch DFU0302
Featured
hardware
Internal flush doors |83
Oak Veneer 20G glazedThe clear glazing panel ensures this door complies with Part M
regulations on minimum zones of visibility.
• Constructed using softwood timber stile and rail frame
• All faces fully finished
• Supplied with clear glass
H1981mm x W686mm (6’6” x 2’3”)
FD E FD30 DIF9340
H1981mm x W762mm (6’6” x 2’6”)
FD E FD30 DIF9360
H1981mm x W838mm (6’6” x 2’9”)
FD M E FD30 DIF9370
H2040mm x W826mm
FD M E FD30 DIF9960
H2040mm x W926mm
FD M E FD30 DIF9970
Edinburgh Latch
Aluminium DFU0085
Featured
hardware
Internal flush doors84|
Ash veneerHigh quality, natural timber veneer and concealed timber lippings
make this door a smart choice for many types of interiors.
• Constructed using softwood timber stile and rail frame
• Lipped on two long edges
H1981mm x W686mm (6’6” x 2’3”)
FD E FD30 DIF0740
H1981mm x W762mm (6’6” x 2’6”)
FD E FD30 DIF0760
H1981mm x W838mm (6’6” x 2’9”)
FD M E FD30 DIF0770
H2040mm x W826mm
FD M E FD30 DIF0240
H2040mm x W926mm
FD M E FD30 DIF0250
Victorian Latch
ChromeDFU0611
Featured
hardware
Internal flush doors |85
Oak foilThis door works equally well in domestic interiors and commercial
environments.
• Constructed using softwood timber stile and rail frame
• Face fully finished
H1981mm x W610mm (6’6” x 2’0”)
Standard DIC3230
FD E FD30 DIF1730†
H1981mm x W686mm (6’6” x 2’3”)
Standard DIC3240
FD E FD30 DIF1740
H1981mm x W762mm (6’6” x 2’6”)
Standard DIC3260
FD E FD30 DIF1760
H1981mm x W838mm (6’6” x 2’9”)
M Standard DIC3270
FD M E FD30 DIF1770
H2040mm x W726mm
Standard DIC4941
FD E FD30 DIF2131†
H2040mm x W826mm
Standard DIC4961
FD M E FD30 DIF2161
H2040mm x W926mm
Standard DIC4971
FD M E FD30 DIF2171
Aluminium Roundbar
Latch DFU0302
Featured
hardware
†Subject to availabilityInternal flush doors86|
Light Grey Oak foilThis statement grey door is on trend and is ideal for both domestic
and commercial interiors.
• Constructed using softwood timber stile and rail frame
• All faces fully finishedTurin RoseDFU0727
Featured
hardware
H1981mm x W610mm (6’6” x 2’0”)
Standard DIL1430
H1981mm x W686mm (6’6” x 2’3”)
Standard DIL1440
FD E FD30 DFL1440
H1981mm x W762mm (6’6” x 2’6”)
Standard DIL1460
FD E FD30 DFL1460
H1981mm x W838mm (6’6” x 2’9”)
Standard DIL1470
FD M E FD30 DFL1470
Internal flush doors |87
Sapele veneer†The richer tones of this door can complement many colour schemes
in both domestic and commercial situations.
• Constructed using softwood timber stile and rail frame
• All faces fully varnished
• Lipped on two long edges
H1981mm x W610mm (6’6” x 2’0”)
Standard DIC1430
H1981mm x W686mm (6’6” x 2’3”)
Standard DIC1440
H1981mm x W762mm (6’6” x 2’6”)
Standard DIC1460
FD E FD30 DIF1160
H1981mm x W838mm (6’6” x 2’9”)
M Standard DIC1470
FD M E FD30 DIF1190
H2040mm x W726mm
Standard DIC0641
H2040mm x W826mm
M Standard DIC0661
AluminiumRoundbar
Rose DFU0300
Featured
hardware
†Subject to availabilityInternal flush doors88|
Primed unlipped hardboardThis practical door looks good in modern homes, and performs well in
commercial and contract settings.
• Constructed using softwood timber stile and rail frame
• Primed and ready for painting
H1981mm x W381mm (6’6” x 1’3”)
Standard DIC1100
H1981mm x W457mm (6’6” x 1’6”)
Standard DIC1110
H1981mm x W533mm (6’6” x 1’9”)
Standard DIC1120
H1981mm x W610mm (6’6” x 2’0”)
Standard DIC1130
H1981mm x W686mm (6’6” x 2’3”)
Standard DIC1140
H1981mm x W711mm (6’6” x 2’4”)
Standard DIC1150
H1981mm x W762mm (6’6” x 2’6”)
Standard DIC1160
H1981mm x W838mm (6’6” x 2’9”)
M Standard DIC1170
Victorian Scroll Latch
ChromeDFU0661
Featured
hardware
Internal flush doors |89
PlywoodThis versatile door is available in a wide range of imperial and metric
sizes with both standard and FD30 cores.
• Constructed using softwood timber stile and rail frame
• Ready for painting
• Lipped on two long edges
H1981mm x W381mm (6’6” x 1’3”)
F Standard DIC1300
H1981mm x W457mm (6’6” x 1’6”)
F Standard DIC1310
H1981mm x W533mm (6’6” x 1’9”)
F Standard DIC1320
H1981mm x W610mm (6’6” x 2’0”)
F Standard DIC1330
P FD E FD30 DIF1430
H1981mm x W686mm (6’6” x 2’3”)
F Standard DIC1340
P FD FD30 35mm DIF8940
P FD E FD30 DIF1440
H1981mm x W711mm (6’6” x 2’4”)
F Standard DIC1350
H1981mm x W762mm (6’6” x 2’6”)
F Standard DIC1360
P FD FD30 35mm DIF8960
P FD E FD30 DIF1460
H1981mm x W838mm (6’6” x 2’9”)
F M Standard DIC1370
P FD M FD30 35mm DIF8970
P FD E FD30 DIF1470
H2032mm x W813mm (6’8” x 2’8”)
F Standard DIC1380
P FD FD30 35mm DIF8980
P FD M E FD30 DIF1480
H2040mm x W526mm
F Standard DIC3020
P FD E FD30 DIF1520
H2040mm x W626mm
F Standard DIC3030
P FD E FD30 DIF1530
H2040mm x W726mm
F Standard DIC3040
P FD E FD30 DIF1540
H2040mm x W826mm
F M Standard DIC3060
P FD M E FD30 DIF1560
H2040mm x W926mm
F M Standard DIC3070
P FD M E FD30 DIF1570
Riva Rose Chrome
DFU0460
Featured
hardware
Internal flush doors90|
Internal doorsAn illustrated technical guide
Moulded panel doors
Choose from three core specifications, including Standard, Developer door and FD30
(fire resistant for up to 30 minutes). Glazed doors are another option, with all glass toughened
to BS EN 12600 or BS EN 12150.
These doors are made from hardwearing, one-piece moulded facings, bonded to a timber
frame and painted with a white base coat. Bi-fold versions are ideal for small areas and
wardrobes. We also offer mobility sizes.
Within the 6 Panel grained door range we have every door size and style available.
Standard core
A multi-cell core for light duty, non fire-rated applications.
Actual core construction may vary.
Developer door core
The solid core of the developer door provides additional strength and stability
to the product. It may also reduce noise transmission through the property.
Fire door core
The FD30 core is a high density core material. This proven construction, when
correctly installed with suitable hardware, f/c lining/casing and intumescent
materials, will provide certified fire resistance. Actual core construction may vary.
35mm Fire door core
Constructed with a high density non-reactive core, the door can be used to
upgrade an existing opening to a fire door, without the need to replace the
lining or frame*. Intumescent strips can be fitted directly to the door so it can
be used with an existing frame.
*See detailed product instructions and fire certificate, subject to material type
and dimensions.
Internal door thicknesses
All internal doors conform to the following thicknesses:
• Imperial sizes 35mm
• Metric sizes 40mm
• Fire doors 44mm (excluding 35mm fire doors)
CoreCCC
Core
Core
CoreCCCCorCorCorCoroooCoroooro eeeeeeeeeee
Skin
Skin
Skin
Skin
Intermediate
layers
Internal doors |91
Softwood doors
This range features a wide range of glazed and panelled designs. The 4 Panel Clear Pine is available
as a fire door. You can also specify mobility sizes.
Glazed doors are supplied with all glass toughened to BS EN 12600 or BS EN 12150.
Clear pine doors are manufactured with an engineered construction using selected veneers
and lippings. The scientific benefits of an engineered door are unique; controlling warp,
shrink and twist.
Doors are engineered using a solid internal core of laminated timber lengths. This gives a uniform
stile and crossrail construction that ensures maximum strength and stability.
Knotty pine, redwood and hemlock doors are of a solid construction.
Finishing information
Our softwood doors are ready for finishing with varnish, stain or paint. Please refer to pages 243 and
244 for a full range of finishing products.
The engineered construction:
Internal primed doors
Offering standard and glazed designs, these primed doors are constructed using glue and dowel and
slab constructions with HDF skins.
Glazed doors are supplied with all glass toughened to BS EN 12600 or BS EN 12150.
Finishing information
Stile and rail doors are supplied primed, ready for finishing with paint.
Premium grade
veneer
High strength
laminated core
Stile
Rail35, 40 or 44mm
construction
Engineered stile
MDF centre panel
HDF skin
Timber edge
lipping
Engineered rail
ggggg gggggggg
plplpllp ieieieiei dddddd prprprpppp imimmimmimmededededeed rerereeadadadaddadddyyyyyy fofofofofoforrrr finfinfinfinfinfifinfinfififififififi isisssshihihhihhhh ngngngngngn wwwwwitittithhhhhh pppp
EngEngEngEngEngEngE ggineineineinenenenennnnnnneereereereereereed sd sd sd sd sd dd tiltiltilti eeeeeeee
MDFMDFMDFMDFMMDFMMDFMMMDMDD cececececeeeceennnnnnn
skskskskskinininini
edededededdgegegegegegeegegg
Internal doors92|
Hardwood doors
High quality, engineered construction characterises this range. This includes fire door versions of the
4 Panel Oak, Worcester Oak, Burford 4 Panel Oak, Linear Oak, Genoa Oak, Dordogne Oak and 4 Panel
Shaker Oak designs. We offer a varied choice of glazed and panelled designs, as well as mobility
sizes and bi-fold doors.
The Dordogne Oak door range contains the most door sizes and styles.
Glazed doors are supplied with all glass toughened to BS EN 12600 or BS EN 12150.
Advantages of an engineered construction for hardwood doors include:
1. Superior colour matching within each door
It is far easier to colour match veneers than it is to do so on solid timber
components.
2. Environmentally friendly
The timber used to make 1 solid door would produce enough
veneers to make at least 10 engineered doors.
Our solid oak doors are of a tongue and groove construction with
glued and nailed ledges.
Hardwood door veneers are made from either oak or a combination
of oak and local hardwood inserts.
Finishing Information
Our hardwood doors are ready for finishing with varnish or stain.
Waxes, polishes and oils should not be used on our hardwood
doors as they do not seal the door properly and may cause
veneer delamination. Please refer to pages 243 and 244 for a full
range of finishing products.
Our Solid Rustic Oak ledged door can be finished with varnish, stain, oil or wax.
Flush doors
You have the choice of lightweight standard cores and fire-rated options, with or without window apertures.
Our apertured fire doors are supplied fully glazed and include a number of options designed to meet the
effective visibility requirements for Part M mobility doors. See regulation guidelines on page 251.
Where required, the external solid core blank lightweight door can be used internally. This plywood
faced fire door is extremely versatile and can be customised to create something unique. If required,
a 3rd party approved fire door installer can cut the door to size, make apertures (custom glazing) in
accordance with specific guidelines, and add veneers or other finishes (subject to instructions).
*Aperture dimensions after lining is applied and before the beading is fitted.
Engineered core
Real wood veneer
yyy eee annanananndd
aaaaaaa 3r3r3r3r3r33333333333333333 d d d ddddd papapapapappppappapappppppppppappap rtrtrtrttrtrty y y y y apapapapapappprprprprprprpp ovovovovovovvedededededdededdd fifififififififirerererereere dddddddddooooooooooooor r rrr inininninnnststststststsssstalalalalalallaaaa leleleleleelerr r rr r ccccc
acacacacacca cocococococococcocordrdrdrdrdananananannanannnannnnnnnnncecececececeeeeeee wwwwwwwwwwwwwwwwitititititittitiiiiiiiiiii hhhhhhhhhh spspspspspspppsps ecececececccececccccifiifiifiifiifiifiifiiii c c c ccccc guguguguguggugg ididididddidddeleleleleleeleeeeee inininininini esesesesesssssssssss, , , , ananaaanananaaaaaaaaanaaaaanaaanaaa dddddd
*Ap*Ap*Ap*Ap*ApAAApertertertertertrtureureureureureurerer didididididimenmenmenmenmenmennsiosiosiosiosiosiossss ns ns ns ns nnsnns aftaftaftaftaftaftaftaf er er er er e linlinlinlinlinnlinnnl nnnnnnnninnnnningingingingingiinginginiiiiii isisisissisis apapapapapaaappa plipliplipliliplied ed ed ed ed edd anddandandandanda bebebebebebeebbefofofofofofofoffofoooo
Core
Timber veneer, foil or
paint surface
200mm*
124mm*
127mm*
Internal doors |93
Fire rated doors
Where a fire door is required, Howdens has a selection of styles to choose from. We also offer a wide
variety of fire rated hardware and joinery products to accompany your fire door.
Intumescent seals
- Full perimeter seal (top and
sides of the door)
- Seals made from the correct
material and to the size and
specification required
- Suitable rating and
configuration to match the fire
rating of the door
F/C Certified approved
trenched lining
- Correct material and
dimensions for specific
fire door rating
- Securely fitted to
the aperture, with the
correct fixings and gap
filling materials
Fire rated lock/ latch
& handle
- Suitable for use on
a fire door provided
it is fire rated and CE
marked
- Fitted with the correct
intumescent paper
around the lock/latch/
handle
- Fitted in the correct
location
Fire door signage
Check the correct
signage is fitted in the
correct location
CE Marked fire rated
controlled door closer
- Suitable for use on the
specific fire door
- Adjusted to ensure the
door closes correctly
against the frame and the
door is easy to operate
- Fitted with the correct
intumescent pads and
fixings
Plywood FD30 door
- Tested and certified fire
door with certified label
visible on the top edge of
the door
- Fitted with all the
required ironmongery and
components
- Fitted to ensure there is a
3mm gap between the door
and frame when closed and
up to 8mm at the bottom
Expanding fire rated
foam
- Only use fire rated
foams/ intumescent
mastics to fill any gaps
around the door frame
CE Marked satin stainless
steel grade 13 hinges
- Fitted with the correct
intumescent pads behind
the hinge
- Fitted in the correct
location
- Standard height doors
should have a minimum of
three hinges to prevent the
door from warping in a fire
All fire rated hardware and joinery products should be fitted as detailed on the fire door certificate/ report.
Please refer to the fire doors specific test evidence assessment, or data sheet before fitting any fire doors.
For the full range of fire doors available please refer to door grids on pages 255-265
Internal doors94|
Fire Regulations:
FD Fire doorsFH Essential fire door hardwareFH Non-essential fire door hardware
Building Regulations:
E Part E doors - sound reducingL Part L doors - warmth and insulation suitable for new buildL Part L doors - warmth and insulation suitable for refurbishment projectsM Part M doors - mobility and access
Sliding wardrobe doors
Our sliding wardrobe doors are
available in white and oak finishes, in
both Shaker and mirror styles.
The Shaker style is a versatile door
that suits a variety of interiors and
can be combined with the Shaker
mirror door. The classic mirror door
is a simple design that is ideal for
creating a feeling of space in a room.
In addition to the doors in this
section, any of our range of over 60
internal doors can be used as sliding
doors by simply being fitted with the
Howdens sliding wardrobe door track.
Please refer to page 204 for our
range of sliding door gear.
Sliding wardrobe doors |95
Sliding wardrobe doors
†Subject to availability
White edged mirror doorThis classic mirrored wardrobe door is ideal in many different interiors
and creates a feeling of space in a room.
• Mirrored door supplied with 4mm annealed glass - impact tested
• Supplied with a steel frame construction
H2260mm x W610mm
Mirrored GIR2011
H2260mm x W914mm
Mirrored GIR2010
L1200mm
Silver trackset GIR2037
L1800mm
Silver trackset GIR2033
L2700mm
Silver trackset GIR2034
L3600mm
Silver trackset GIR2035
L1200mm
White trackset GIR2036
L1800mm
White trackset GIR2030
L2700mm
White trackset GIR2031
L3600mm
White trackset GIR2032
Learn more about this product through our sliding wardrobe door
movies at www.howdens.com/advice-inspiration/movies96|
White Shaker panel and mirror doorThe Shaker design is a versatile door that suits a variety of interiors.
The Shaker panel and Shaker mirror doors can be used together or
on their own.
• Mirrored door supplied with 4mm annealed glass - impact tested
• Panel doors constructed using 8mm paper faced chipboard
• Supplied with a steel frame construction
Learn more about this product through our sliding wardrobe door
movies at www.howdens.com/advice-inspiration/movies Sliding wardrobe doors
H2260mm x W610mm
Mirrored GIR2015
H2260mm x W914mm
Mirrored GIR2013
H2260mm x W610mm
F Standard GIR2044
H2260mm x W914mm
F Standard GIR2042
L1200mm
White trackset GIR2036
L1800mm
White trackset GIR2030
L2700mm
White trackset GIR2031
L3600mm
White trackset GIR2032
L1200mm
Silver trackset GIR2037
L1800mm
Silver trackset GIR2033
L2700mm
Silver trackset GIR2034
L3600mm
Silver trackset GIR2035
|97
Oak Shaker panel and mirror doorThe Shaker design is a versatile door that suits a variety of interiors.
The Shaker panel and Shaker mirror doors can be used together or
on their own.
• Mirrored door supplied with 4mm annealed glass - impact tested
• Panel doors constructed using 8mm paper faced chipboard
• Supplied with a steel frame construction
H2260mm x W610mm
Mirrored GIR2025
H2260mm x W914mm
Mirrored GIR2023
L1200mm
White trackset GIR2036
L1800mm
White trackset GIR2030
L2700mm
White trackset GIR2031
L3600mm
White trackset GIR2032
H2260mm x W610mm
F Standard GIR2024
H2260mm x W914mm
F Standard GIR2022
L1200mm
Silver trackset GIR2037
L1800mm
Silver trackset GIR2033
L2700mm
Silver trackset GIR2034
L3600mm
Silver trackset GIR2035
Learn more about this product through our sliding wardrobe door
movies at www.howdens.com/advice-inspiration/moviesSliding wardrobe doors98|
Sliding wardrobe doors
In addition to our sliding door range, Howdens offers a variety of wardrobe door solutions using our
existing range of over 60 internal door styles. Many of our doors can be finished to suit your individual
style and also fitted to match your existing internal doors.
Sliding door gear converts our existing joinery doors into sliding doors. It can accommodate two or
more doors, allowing them to be fitted flush within an opening. If space is limited, the door gear is
also suitable for use with single doors.
Please refer to page 204 for our range of sliding door gear.
Sliding wardrobe doors |99
Internal storage solutions
Many of the bespoke internal storage solutions shown with our sliding wardrobe doors have been
created using our standard product.
For full details visit our website at www.howdens.com
Top storage shelf Chrome oval tube and fittings
Shoe rack 4 Drawer base unit
Wide 2 drawer base unit Bespoke internal shelving
Internal Storage Solutions100|
Sliding wardrobe doorsAn illustrated technical guide
Sliding wardrobe door thickness
All sliding wardrobe doors conform to the following thicknesses:
Standard 610mm Standard 914mm
Finishing information
All our wardrobe doors are pre-finished.
Sliding wardrobe door construction
All doors are supplied with a steel frame construction. Shaker panel doors are constructed using
8mm paper faced chipboard, and mirror doors are supplied with 4mm annealed glass that is
impact tested.
Centre panel /
chipboard or mirror
Stile
Bottom rail
Sliding door gear
Sliding door gear allows joinery doors to be hung and act as sliding doors, ideal for when door swing
space is limited.
For single doors (GIR0030):
Face fixed to the wall above the door opening, this track accommodates a single door Max door weight: 55Kg Max door thickness: 900mm
Door thickness: 32-50mm
For multiple doors (GIR3010 and GIR3011):
Allows for doors to be fitted flush within an opening and can accommodate 2 or more doors Max door weight: 45Kg (per door) Max door thickness: 900mm Door thickness: 16-40mm
Track
Top plate
Guide
Stop
Adjuster bolt
Guide channel
Track
Truck
Floor guide
Door stop
0m0m0m0m0m0mmmmmmmmmmmmmm
mmmmmmmmmmmmm
0101010 00000000 ddddd GIGIGGGIGGGG R3R33301010101111)1)1
fifififitttttttttededededededededde flflflflusususushhh wiwwiww ththhhthinininn aaaannnnn opopopopppo eneeneneneeeeneeee ininng g g g gg ananannannd dd cacacaccacannnn acaccacccoccooccoommmmmmmmododododododaaaaaa
(p(p(p(p(p(perererererrer dddddddoooooooooooooo r)r)r)r)rr
00000000m0m0m0m0m0m0 mmmmmmmmm
mmmmmmmmmmmmm
Sliding wardrobe doors |101
External hardwooddoors
Howdens external hardwood doors
are of an engineered construction,
with a hardwood veneer to increase
stability.
We offer oak and hardwood doors
with double and triple glazing. There
is a decorative centre layer in the
triple glazed panels. This sealed
weatherproof unit increases the
thermal performance of the window,
and makes the design easy to clean.
Our hardwood doors are ready for
finishing with varnish or stain.
External hardwood doors
Fire Regulations:
FD Fire doorsFH Essential fire door hardwareFH Non-essential fire door hardware
Building Regulations:
E Part E doors - sound reducingL Part L doors - warmth and insulation suitable for new buildL Part L doors - warmth and insulation suitable for refurbishment projectsM Part M doors - mobility and access
102|
Part L Regent Oak†This popular design combines style with simplicity to suit a wide
variety of exteriors.
• Engineered construction
• Ready for finishing with varnish or stain
H2032mm x W813mm (6’8” x 2’8”)
F L L M Standard DXP1981
Garda Lock Chrome
DFU0704
Featured
hardware
U-Value 1.8
†Subject to availabilityExternal hardwood doors |103
Cottage Oak triple glazed†The design of this door is perfect for creating a traditional rural style.
• Engineered construction
• Ready for finishing with varnish or stain
• Supplied triple glazed
H2032mm x W813mm (6’8” x 2’8”)
M Glazed DXP2380
Garda Lock Brass
DFU0700
Featured
hardware
†Subject to availabilityExternal hardwood doors104|
External Dordogne OakThe contemporary looking external Dordogne Oak door is perfectly
suited for the modern home.
• Engineered construction
• Ready for finishing with varnish or stain
H1981mm x W838mm (6’6” x 2’9”)
M Standard DXP2670
H2032mm x W813mm (6’8” x 2’8”)
M Standard DXP2680
Door knocker
Satin NickelDFU0166
Featured
hardware
External hardwood doors |105
External Dordogne Oak glazedWith its unique four panel glazed design, this door is perfectly suited
for classic or contemporary looking homes.
• Engineered construction
• Ready for finishing with varnish or stain
• Supplied with frosted double glazing
H1981mm x W838mm (6’6” x 2’9”)
M Glazed DXP2970
H2032mm x W813mm (6’8” x 2’8”)
M Glazed DXP2980
Lugano Lock Chrome
DFU0904
Featured
hardware
External hardwood doors106|
External Worcester Oak†The contemporary looking external Worcester Oak door is perfectly
suited to any modern home.
• Engineered construction
• Ready for painting or staining
H1981mm x W838mm (6’6” x 2’9”)
M Standard DXP3170
H2032mm x W813mm (6’8” x 2’8”)
M Standard DXP3180
Garda Lock Chrome
DFU0704
Featured
hardware
†Subject to availabilityExternal hardwood doors |107
External Worcester Oak glazedWith its distinctive centre panel glazing, this door is perfect for the
more contemporary looking home.
• Engineered construction
• Ready for finishing with varnish or stain
• Supplied with frosted double glazing
H1981mm x W838mm (6’6” x 2’9”)
M Glazed DXP3270
H2032mm x W813mm (6’8” x 2’8”)
M Glazed DXP3280
Idro Lock Chrome
DFU0603
Featured
hardware
External hardwood doors108|
External Linear Oak†The external Linear Oak door creates a modern look to the entrance
of any home.
• Engineered construction
• Ready for finishing with varnish or stain
H1981mm x W838mm (6’6” x 2’9”)
M Standard DXP1570
H2032mm x W813mm (6’8” x 2’8”)
M Standard DXP1580
Escutcheon Chrome round
coveredDFU0206
Featured
hardware
External hardwood doors†Subject to availability
|109
Georgian glazedThis door lets in plenty of light to create an airy feel.
• Engineered construction
• Ready for painting or staining
• Supplied with clear double glazing
H1981mm x W762mm (6’6” x 2’6”)
Glazed DXP5960†
H1981mm x W838mm (6’6” x 2’9”)
M Glazed DXP5970
H2032mm x W813mm (6’8” x 2’8”)
M Glazed DXP5980
Antique Lock Black
DFU0033
Featured
hardware
External hardwood doors†Subject to availability
110|
|111
Bosworth glazedThis door lets in plenty of light to create an airy feel.
• Engineered construction
• Ready for painting or staining
• Pre-beaded
• Supplied with clear double glazing
H1981mm x W762mm (6’6” x 2’6”)
Glazed DXP5860†
H1981mm x W838mm (6’6” x 2’9”)
M Glazed DXP5870
H1981mm x W813mm (6’8” x 2’8”)
M Glazed DXP5880
Chrissi Lock Satin NickelDFU0044
Featured
hardware
External hardwood doors†Subject to availability
|111
Richmond glazedThe vertical glazing panels in this door allow light to flood into any
home.
• Engineered construction
• Ready for painting or staining
• Supplied with frosted double glazing
H1981mm x W762mm (6’6” x 2’6”)
Glazed DXP5460
H1981mm x W838mm (6’6” x 2’9”)
M Glazed DXP5470
H2032mm x W813mm (6’8” x 2’8”)
M Glazed DXP5480
Garda Lock Satin NickelDFU0720
Featured
hardware
External hardwood doors112|
Carolina glazedThis popular design can be used to add character and style to all
properties.
• Engineered construction
• Ready for painting or staining
• Supplied with toughened clear glass
H1981mm x W762mm (6’6” x 2’6”)
Glazed DXP4660†
H1981mm x W838mm (6’6” x 2’9”)
M Glazed DXP4670
H2032mm x W813mm (6’8” x 2’8”)
M Glazed DXP4680
Mortice knob Brass
DFU0050
Featured
hardware
External hardwood doors†Subject to availability
|113
H2XG glazedThis door lets in plenty of light to create an airy feel.
• Engineered construction
• Ready for painting or staining
• Pre-beaded
• Supplied with clear double glazing
H1981mm x W762mm (6’6” x 2’6”)
Glazed DXP5160
H1981mm x W838mm (6’6” x 2’9”)
M Glazed DXP5170
H2032mm x W813mm (6’8” x 2’8”)
M Glazed DXP5180
Victorian Scroll Lock
ChromeDFU0660
Featured
hardware
External hardwood doors114|
RegentThis six panel hardwood door arrives unstained and lends itself to a
variety of settings and colour schemes.
• Engineered construction
• Ready for painting or staining
H1981mm x W762mm (6’6” x 2’6”)
Standard DXP4360
H1981mm x W838mm (6’6” x 2’9”)
M Standard DXP4370
H2032mm x W813mm (6’8” x 2’8”)
M Standard DXP4381
Chrissi Lock Satin NickelDFU0044
Featured
hardware
External hardwood doors |115
External softwooddoors
These products are suitable for
a range of applications. They are
supplied ready for finishing on site
to your particular specification.
FL&B and L&B doors have loose
pinned ledges and braces which
can be moved and pinned to the
opposite side of the door. This gives
flexibility when choosing which way
round the door is hung.
All our softwood doors are suitable
for paint finish only.
Fire Regulations:
FD Fire doorsFH Essential fire door hardwareFH Non-essential fire door hardware
Building Regulations:
E Part E doors - sound reducingL Part L doors - warmth and insulation suitable for new buildL Part L doors - warmth and insulation suitable for refurbishment projectsM Part M doors - mobility and access
External softwood doors116|
2XG/2XGG HemlockThis simple, functional door admits plenty of light as a single top
glazing panel (XG). It also has a loose pinned bottom panel that
offers the option of a second glazing panel (XGG).
• Constructed using Stub Mortice and Tenon frame
• Ready for painting
• Supplied unglazed. Suitable for double glazing,
single glazing options available for 2XG only
H1981mm x W762mm (6’6” x 2’6”)
P Standard DXT0160
H1981mm x W838mm (6’6” x 2’9”)
P M Standard DXT0170
H2032mm x W813mm (6’8” x 2’8”)
P M Standard DXT0180
Victorian Lock Chrome
DFU0610
Featured
hardware
External softwood doors |117
FL&BThis versatile door is an ideal choice for entrances to the garden and
outbuildings.
• Framed, Ledged and Braced construction using selected redwood
timber
• Ready for painting
• Redwood board and braces loose pinned
H1981mm x W610mm (6’6” x 2’0”)
F Standard DXC0530
H1981mm x W686mm (6’6” x 2’3”)
F Standard DXC0540
H1981mm x W762mm (6’6” x 2’6”)
F Standard DXC0560
H1981mm x W838mm (6’6” x 2’9”)
F M Standard DXC0570
H2032mm x W813mm (6’8” x 2’8”)
F M Standard DXC0580
Antique Latch BlackDFU0034
Featured
hardware
External softwood doors118|
L&BThis plain door made of a tongue and groove construction,
is ideal for outbuildings and other utilitarian entrances.
• Ledged and Braced construction using selected redwood timber
• Ready for painting
• Redwood board and braces loose pinned
H1981mm x W686mm (6’6” x 2’3”)
F Standard DXC0640
H1981mm x W762mm (6’6” x 2’6”)
F Standard DXC0660
H1981mm x W838mm (6’6” x 2’9”)
F M Standard DXC0670
Pull handle Antique Black
DFU0137
Featured
hardware
External softwood doors |119
Fire Regulations:
FD Fire doorsFH Essential fire door hardwareFH Non-essential fire door hardware
Building Regulations:
E Part E doors - sound reducingL Part L doors - warmth and insulation suitable for new buildL Part L doors - warmth and insulation suitable for refurbishment projectsM Part M doors - mobility and access
External flush doors
Versatile and practical, our external
flush doors come in a range of
options.
You can choose between solid doors
and versions with glazed window
apertures, and we offer FD30 and
FD60 models, fire resistant for up to
30 and 60 minutes respectively.
The external solid core blank
lightweight door can be cut to suit
different shape openings and sizes.
All our external flush doors are
suitable for a paint finish only.
External flush doors120|
Ply G/O glazedA basic plywood door with a square aperture, the Ply G/O glazed is
well suited to commercial settings.
• Constructed using softwood timber stile and rail frame
• Ready for painting
• Lipped on two long edges
• Supplied with Georgian wired glass
H1981mm x W762mm (6’6” x 2’6”)
P FD FD30 Glazed DXF1360
H1981mm x W838mm (6’6” x 2’9”)
P FD M FD30 Glazed DXF1370
H2032mm x W813mm (6’8” x 2’8”)
P FD FD30 Glazed DXF1380
H2040mm x W826mm
P FD M FD30 Glazed DXF1440
H2040mm x W926mm
P FD M FD30 Glazed DXF1450
Briton security push
padSCF0081
Featured
hardware
External flush doors |121
Solid core blank lightweightThis plywood faced fire door is extremely versatile and can be
customised to create something unique.
• Constructed using three layers of laminate core
• Ready for painting
• Can be cut to size (see guidelines for details)
• Also suitable for internal use
• Part L compliant when fitted with a Howdens door frame
H2135mm x W915mm (7’0” x 3’0”)
FD L L M E FD30 DFD0041
FD L L M E FD60 DFD0044
H2440mm x W1220mm (8’0” x 4’0”)
FD L L M E FD30 DFD0053
Briton single panic bolt SCF0078
Featured
hardware
U-Value 1.2
U-Value 1.1
U-Value 1.2
External flush doors122|
PlywoodThis door is particularly suitable for commercial locations where
functionality is important.
• Constructed using softwood timber stile and rail frame
• Ready for painting
• Lipped on two long edges
H1981mm x W686mm (6’6” x 2’3”)
P FD FD30 DXF0140
H1981mm x W762mm (6’6” x 2’6”)
Standard DXL0560
P FD FD30 DXF0160
FD FD60 DXF0262
H1981mm x W838mm (6’6” x 2’9”)
M Standard DXL0570
P FD M FD30 DXF0170
FD M FD60 DXF0272
H2032mm x W813mm (6’8” x 2’8”)
P FD FD30 DXF0180
H2040mm x W826mm
P FD M FD30 DXF0460
H2040mm x W926mm
P FD M FD30 DXF0470
Briton double rebated
panic setSCF0076
Featured
hardware
External flush doors |123
Garage doors
Garage Doors
Our garage doors will enhance the
exterior of your property.
The redwood garage doors are made
from Group 1 European timber, and
are rebated for right hand opening.
All our garage doors are suitable for
a paint finish only.
Fire Regulations:
FD Fire doorsFH Essential fire door hardwareFH Non-essential fire door hardware
Building Regulations:
E Part E doors - sound reducingL Part L doors - warmth and insulation suitable for new buildL Part L doors - warmth and insulation suitable for refurbishment projectsM Part M doors - mobility and access
124|
Softwood FL&B†This practical tongue and groove garage door will enhance the exterior
of your property.
• Constructed using selected softwood timber
• Ready for painting
H1981mm x W2134mm (6’6” x 7’0”)
F Standard DXG0110
H2134mm x W2134mm (7’0” x 7’0”)
F Standard DXG0220
Antique Lock Black
DFU0033
Featured
hardware
Garage doors†Subject to availability
|125
External doorsAn illustrated technical guide
External door thicknesses
All external doors conform to the following thicknesses: Standard 44mm FD30 44mm FD60 54mm
External door essentials
We offer a complete range of door essentials to accompany your external door.
External door frame
(please refer to p131-p134)
Hinges
(please refer to p229-p232)Lock
(please refer to p213-p219)
Nightlatch
(please refer to p217-p218)
Handle
(please refer to p174-p190)
External door
(please refer to p102-p125)
Weather bar
(please refer to p134)
Letterplate
(please refer to p201)
LocLocLocLocLoccccLLoL k k kkk kkkkkk
222222222222222222219)19)19)19)19)1919)9)
tltltllatcatcatcatcatcatcat hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
22222218)18)18)18)18)1118)18181818)181
ananananandledledledledleddd e
111111190)90)90)90)0)90))9
LetLetLetLetLettLetteeeeee tertererterteret plaplaplaplaplaplalp te te tetete tee
External doors126|
Hardwood doors
All our external hardwood doors are of an engineered construction, with a hardwood veneer to
increase stability.
Our external hardwood doors are constructed using either variants of the mortice and tenon joints,
dowell joints or slab construction.
Our oak doors consist of an engineered core and real oak veneer.
We offer oak and hardwood doors with double and triple glazing. There is a decorative centre layer
in the triple glazed panels (which can be clear, obscure or bevelled and with zinc leading) which is
protected by two outer layers of 4mm toughened glass. This sealed weatherproof unit increases the
thermal performance of the window, and makes the design easy to clean.
Finishing information
Our hardwood doors are ready for finishing with varnish or stain. Waxes, polishes and oils should
not be used on our hardwood doors as they do not seal the door properly and may cause veneer
delamination. Please refer to page 243 and 244 for a full range of finishing products.
Part L external doors
Part L doors are constructed with an internal insulation panel to provide improved thermal efficiency.
When fitted with an approved frame, our Part L doors achieve a ‘U’ value of 1.8W/m2K or better.
Please refer to pages 103 and 122 for our full range of Part L doors.
1.2mm Oak veneer
Insulation panel
Core
Engineered construction
InsInsInsnsn ulaulaulaulaulalatiotiotiotiotit
CorCorCoCorCorCorCCo eeeeee
Veneer
Engineered Timber Core
Centre
Panel
rrrrrrrrr
EngEngEngEngEngEnggEngEnEEEnn ineineneineineinennneereereererrereererereeed Td Td Td Td Tdd Td Timimimimmm
CCCCCCCCCCCCC
PPPP
External doors |127
Frame
Ledge
Brace
Softwood doors
These products are suitable for a range of applications. They are supplied ready for finishing on site
to your particular specification.
FL&B and L&B doors have loose pinned ledges and braces which can be moved and pinned to the
opposite side of the door. This gives flexibility when choosing which way round the door is hung.
Finishing information
All our softwood doors are suitable for a paint finish only.
Flush doors
Here you can choose between solid doors and versions with glazed window apertures, and we offer FD30
and FD60 models.
The external solid core blank lightweight door is constructed using three layers of laminate core.
This means it can be cut to suit different shape openings, cut to size, apertures can be made in
accordance with guidelines, and veneers or other finishes can be added.
Finishing information
All our external flush doors are suitable for a paint finish only.
FL&B construction L&B construction
Plywood veneer
Solid core blank lightweight
Tri-laminate core
Ledge
Brace
nenenenneeerererererrererrrrrrrrr
External doors128|
Garage doors
Our redwood garage doors are made from Group 1 European timber, and are rebated for right hand
opening as this illustration shows.
Finishing information
All our garage doors are suitable for a paint finish only.
Double & French doors
Howdens offer a good choice of double and French doors. Softwood doors are available with a solid
timber stub mortice and tenon or dowel construction. Bottom panels in the softwood doors are
engineered construction. Hardwood doors are also available within this range with an engineered
mortice and tenon construction.
All double and French doors are rebated for right hand opening.
Finishing information
All our softwood double and French doors are suitable for a paint finish only. Hardwood double and
French doors are suitable for finishing with varnish, paint or stain.
Door side
Mortice wedges
M&T construction
Rail
Stile
Tenon
External doors |129
Joinery
We offer a wide range of joinery
products to help professional fitters
get the best results in domestic
and commercial interiors. If you are
building or repairing a staircase,
we have stair parts in a choice of
styles. For a final touch that adds or
preserves character, there is a great
variety of redwood, oak and MDF
mouldings which can be finished to
your individual style.
Fire Regulations:
FD Fire doorsFH Essential fire door hardwareFH Non-essential fire door hardware
Building Regulations:
E Part E doors - sound reducingL Part L doors - warmth and insulation suitable for new buildL Part L doors - warmth and insulation suitable for refurbishment projectsM Part M doors - mobility and access
Joinery130|
External door frames
External door frames
Door frames are used to hang external doors. Our range includes a variety of softwood, hardwood and oak
veneered options which can be trimmed to the specific size of the door. We also offer a door frame length and
30 or 60 minute fire door frames, pre-grooved for intumescent strips which are included.
All softwood door frames are made from pine. Our oak veneered frames are made from a hardwood core with an
oak veneer applied and our hardwood door frames are made using Meranti timber.
* Timber is a natural material and therefore is subject to movement from changes in temperature and humidity. Each installation should be assessed individually on site
and brick opening sizes calculated referencing the physical frame size at that time. The brick opening sizes indicated above are a guide only.
To fit door To fit door Approx brick opening Approx brick opening
height x width (mm) height x width sizes* (mm) sizes* (inches)
(inches)
External softwood door frames
External hardwood door frames
To fit door To fit door Approx brick opening Approx brick opening
height x width (mm) height x width sizes* (mm) sizes* (inches)
(inches)
Unassembled softwood FD30 door frames, opens in or out (no sill)H1981mm x W762mm 6’6” x 2’6” H2033mm x W856mm 6’8” x 2’9.5” UK F DFR0111
H1981mm x W838mm 6’6” x 2’9” H2033mm x W935mm 6’8” x 3’0.5” UK F DFR0112
H2040mm x W926mm 6’6” x 3’0” H2088mm x W1015mm 6’10” x 3’4” UK F DFR0116
Unassembled softwood door frames, opens in or out (no sill)
H1981mm x W762mm 6’6” x 2’6” H2033mm x W856mm 6’8” x 2’9.5” UK F DFR0315
H1981mm x W838mm 6’6” x 2’9” H2033mm x W935mm 6’8” x 3’0.5” UK F DFR0314
Assembled softwood door frames, opens in (with hardwood sill)
H1981mm x W762mm 6’6” x 2’6” H2079mm x W856mm 6’9.5” x 2’9.5” UK F DFR0207
H1981mm x W838mm 6’6” x 2’9” H2079mm x W935mm 6’9.5” x 3’0.5” UK F DFR0206
H2032mm x W813mm 6’8” x 2’8” H2130mm x W907mm 6’11.5” x 2’11.5” UK F DFR0205
Assembled softwood door frames, opens out (with hardwood sill)H1981mm x W762mm 6’6” x 2’6” H2079mm x W856mm 6’9.5” x 2’9.5” UK F DFR0217
H1981mm x W838mm 6’6” x 2’9” H2079mm x W935mm 6’9.5” x 3’0.5” UK F DFR0216
Softwood door frame length2.4m H2400mm x W56mm UK F DFR0900
Unassembled oak veneered door frames, opens in or out (with oak sill)H1981mm x W838mm 6’6” x 2’9” H2071mm x W932mm 6’9.5” x 3’0.5” DFR0018
H2032mm x W813mm 6’8” x 2’8” H2121mm x W907mm 6’11.5” x 2’11.5” DFR0019
Unassembled hardwood door frames, opens in or out (with hardwood sill)H1981mm x W762mm 6’6” x 2’6” H2071mm x W856mm 6’9.5” x 2’9.5” DFR0560
H1981mm x W838mm 6’6” x 2’9” H2071mm x W932mm 6’9.5” x 3’0.5” DFR0570
H2032mm x W813mm 6’8” x 2’8” H2121mm x W907mm 6’11.5” x 2’11.5” DFR0580
Unassembled hardwood FD60 door frames, opens in or out (no sill)H1981mm x W762mm 6’6” x 2’6” H2034mm x W858mm 6’8” x 2’9.5” DFR0599
H1981mm x W838mm 6’6” x 2’9” H2034mm x W934mm 6’8” x 3’0.5” DFR0590
H2032mm x W813mm 6’8” x 2’8” H2091mm x W914mm 6’8.6” x 3’0” DFR0117
External hardwood door sills (suitable for use with softwood and hardwood door frames)1.2m DFR0903
2.4m DFR0902
Weather seal roll8m UK DFR0901
|131
Assembled double softwood door frame, opens out (with hardwood sill)H1981mm x W1168mm 6’6” x 3’10” H2079mm x W1262mm 6’9.5” x 4’1.5” UK F DFR0302
Unassembled double hardwood door frame, opens out (with hardwood sill)H1981mm x W1168mm 6’6” x 3’10” H2070mm x W1264mm 6’9.3” x 4’1.5” DFR0305
Unassembled Garage Softwood, Opens outH2133mm x W2133mm 7’0” x 7’0” H2205mm x W2271mm 7’3” x 7’5” UK F DFR0342
Door linings and casingsDoor linings and casings are made from pine, primed MDF or oak veneered MDF (where stated).
Door liningsLinings are used to hang internal doors and come with a separate door stop which can be fitted once the door has
been installed. Softwood trenched linings have a reversible head to allow for two door sizes. We have a range of
FD30 and oak veneered linings and a lining length for double doors. When used with an intumescent strip the oak
veneered and primed MDF linings can be used with the internal moulded, flush and Dordogne Oak fire doors.
External double door frames
Garage door frame
* Timber is a natural material and therefore is subject to movement from changes in temperature and humidity. Each installation should be assessed individually on site
and brick opening sizes calculated referencing the physical frame size at that time. The brick opening sizes indicated above are a guide only.
*1 Finished size
To fit door To fit door Approx brick opening Approx brick opening
height x width (mm) height x width sizes* (mm) sizes* (inches)
(inches) (inches)
Oak veneered MDF linings, untrenchedH2070mm x W838mm 6’9” x 2’9” 138mm x 30mm*1 DFR0600
H2070mm x W838mm 6’9” x 2’9” 115mm x 30mm*1 DFR0620
Oak veneered MDF lining lengthsL2050mm 138mm x 30mm*1 DFR2140
L2070mm 115mm x 30mm*1 DFR2130
To fit door size up to To fit door size up to Nominal sizes of timber
height x width (mm) height x width (inches) after machining
Primed MDF door linings, trenchedH1981mm x W762mm 6’6” x 2’6” 115mm x 30mm F DFR2350
H1981mm x W762mm 6’6” x 2’6” 138mm x 30mm F DFR2360
H1981mm x W838mm 6’6” x 2’9” 115mm x 30mm F DFR2330
H1981mm x W838mm 6’6” x 2’9” 138mm x 30mm F DFR2340
Door linings, trenchedH1981mm x W610mm/686mm 6’6” x 2’0”/2’3” 108mm x 27.5mm UK F DFR0004
H1981mm x W610mm/686mm 6’6” x 2’0”/2’3” 132mm x 27.5mm UK F DFR0005
H1981mm x W762mm/838mm 6’6” x 2’6”/2’9” 108mm x 27.5mm UK F DFR0014
H1981mm x W762mm/838mm 6’6” x 2’6”/2’9” 132mm x 27.5mm UK F DFR0015
CLS Door linings, trenchedH1981mm x W762mm/838mm 6’6” x 2’6”/2’9” 120mm x 27.5mm UK P DFR0016
H1981mm x W762mm/838mm 6’6” x 2’6”/2’9” 94mm x 27.5mm UK P DFR0017
Door linings, untrenchedH2040mm x W926mm 108mm x 27.5mm UK P DFR2015
H2040mm x W926mm 132mm x 27.5mm UK P DFR2025
H2040mm x W926mm 145mm x 27.5mm UK P DFR2035
Lining lengthsL2040mm 108mm x 27.5mm DFR2110
L2040mm 132mm x 27.5mm DFR2120
F/C Certifire approved linings FD30, trenchedH1981mm x W762mm/838mm 6’6” x 2’6”/2’9” 108mm x 30mm UK F DFR3110
H1981mm x W762mm/838mm 6’6” x 2’6”/2’9” 132mm x 30mm UK F DFR3120
H2060mm x W826mm/926mm 108mm x 30mm UK P DFR3135
H2060mm x W826mm/926mm 132mm x 30mm UK P DFR3145
Door linings & casings
To fit door To fit door Approx brick opening Approx brick opening
height x width (mm) height x width (inches) sizes* (mm) sizes* (inches)
132|
Door linings & casings
Door casings, trenched
H1981mm x W762mm 106mm x 33mm UK F DFR0030
H1981mm x W762mm 131mm x 33mm UK F DFR0070
H1981mm x W838mm 131mm x 33mm UK F DFR0013
Door casings, untrenched
H1981mm x W838mm 106mm x 33mm UK P DFR1015
H1981mm x W838mm 132mm x 33mm UK P DFR1025
H1981mm x W838mm 145mm x 33mm UK P DFR1035
F/C Certifire approved casings, FD30, untrenched
H2040mm x W838mm 108mm x 57mm UK P DFR3215
H2040mm x W838mm 132mm x 57mm UK P DFR3225
H2040mm x W838mm 145mm x 57mm UK P DFR3235
Door casingsCasings are used to hang internal doors. The head and jambs (sides) are rebated to form the door stops and
trenched casings are available pre-grooved for a quicker installation.
To fit door size up to Nominal sizes of timber
height x width (mm) after machining
Astro flame white 310ml FD30/FD60/FD120 FH ITS0020
Everbuild hand held B1 fire rated expanding foam 750ml FD30/FD60/FD120 FH GIR0088
4” Intumescent hinge pads (pack of 6) FH ITS0030
Intumescent paper pack FH ITS0050
Acoustic door seal pack FH GIR0400
Intumescent stripsIntumescent strips should be used in fire door applications.
Acoustic door sealConstant noise can be as disruptive as louder sounds. Our acoustic door seal pack increases the acoustic
performance of Part E compliant doors.
Intumescent and acoustic products
Intumescent accessories
(Can also be used as a smoke seal when a separate fire strip is fitted)
Fire and smoke strip Brown10mm x 4mm x L2.1m FD30 UK FH ITS0007
15mm x 4mm x L2.1m FD30 UK FH ITS0011
20mm x 4 mm x L2.1m FD30/FD60 UK FH ITS0013
Fire and smoke strip White
10mm x 4mm x L2.1m FD30 UK FH ITS0008
15mm x 4mm x L2.1m FD30 UK FH ITS0012
20mm x 4 mm x L2.1m FD30/FD60 UK FH ITS0014
Fire strip Brown
Fire strip White
10mm x 4mm x L2.1m FD30 UK FH ITS0005
15mm x 4mm x L2.1m FD30 UK FH ITS0009
10mm x 4mm x L2.1m FD30 UK FH ITS0006
15mm x 4mm x L2.1m FD30 UK FH ITS0010
|133
Joinery accessories
Fire check32mm x 25mm L2.1m UK F MOD0064
Metric32mm x 12mm L2.04m UK F MOD0067
Standard32mm x 25mm L2.1m UK F MOD0065
Square edged 45mm x 20mm L3m UK F MOD0406
Solid oak dowel plugs 12mm (bag of 10) UK MOD0060
Hardwood Lipping45mm x 8mm x L2.4m UK MOD0071
46mm x 18mm x L2.1m MOD0061
Hardwood hockey stick F/C beading26mm x 21mm x L2.1m MOD0062
Oak foil hockey stick F/C beading26mm x 21mm x L2.4m UK MOD0069
Ash veneer hockey stock F/C beading26mm x 21mm x L2.4m UK MOD0070
Weather barsOak 36” F DXE0002
Weather barsHardwood 36” DXE0001
Weather barsHemlock 36” UK DXT0900
Weather barsRedwood 36” UK DXC0900
Glazing panels
H1019mm x W599mm (to suit DXT0160) UK DGL0101
H1019mm x W675mm (to suit DXT0170) UK DGL0121
Joinery accessories
Door pair makersHowdens door pair makers are available in either oak veneer or pine and enable our internal doors to be used in
a double door configuration.
Door stops
Optional glazingSuitable for use with external softwood Hemlock 2XG/2XGG doors. Please refer to page 117.
Solid oak dowel plugs
Beading & lippingSuitable for use with firecheck doors
Weather bars
Oak1981mm x 35mm UK DFR0910
Pine1981mm x 35mm UK P DFR0930
134|
The rebated timber
forms the door stop
Trenched head
Loose door stop
Door lining Door casing
Stair parts
Howdens has a range of newel and spindle designs, all crafted in high quality pine or spruce or
engineered white oak. Our staircases, in Scandinavian whitewood with MDF treads and risers, are
manufactured to BS 585: 1989, and should be fitted following approved Document K. For quick and
simple fixing of stair parts please see our Slipfix connectors on page 235.
Going 223mm/225mm
13 Risers 9mm
Half newel post
12 Treads 22mm
Rise 200mm
Nosing 69mm x 22mm
Pitch line 42º
99mm max
Handrail
Newel post
Spindle
Baserail
Outer string 218mm (wide)
2676mm/2700mm
26
00
mm
Standard stairs with risers
Stair width 855mm/ 905mm
JoineryAn illustrated technical guide.
Door frames, linings and casings
Door linings come with a loose door stop which can be secured once the lining is installed in
the opening.
Door casings are rebated for the door stop.
Lining lengths which can be cut to fit any opening.
We offer casings and linings both assembled and unassembled. They have trenched or untrenched
heads which are reversible to accommodate different widths.
Finishing information
All stair parts can be painted, stained or varnished.
Joinery
Stair components, Balluster components and maximum spindle spacing in accordance with
approved document K.
|135
Intumescent strips & accessories
Intumescent strips
Intumescent strips should be used in fire door applications. Available in two types: intumescent only
and intumescent with smoke seal, in both brown and white. The 10mm and 15mm intumescent strips are
30 minute rated, the 20mm versions are 60 minute rated. All intumescent strips have Certifire approval
CF543, passed at BS 476 part 22 and 31.1, and have NHBC approval. All timber fire doors must be fire
stopped with intumescent strip. The key benefits of passive fire protection are:
Prevent the spread of fire, smoke and hot gases through a building by containing it in the
compartment of origin
Maintain the integrity of escape routes from a building
Reduce loss or damage to property from the effect of fire and smoke
Maintain pressure differential between compartments and ventilation channels
Fire strip
Our intumescent fire door strips are
for use where no smoke sealing is
required, fire only. In the event of a
fire the seal expands (intumesces)
to many times its original volume and
seals the gap around the door
to provide a safe and effective barrier
against the passage of fire.
Fire & smoke strip
Intumescent fire and smoke strips are
used as a safe and effective barrier
against fire, cold smoke and hot
gases. In the event of a fire the seal
expands (intumesces) to many times
its original volume and seals the gap
around the door to provide a safe
and effective barrier against the
passage of fire, smoke and hot gases.
Intumescent hinge pads
Our intumescent hinge pads suit most fire door
dimensions and can be easily cut to fit behind hinges.
Intumescent paper packs
Intumescent paper packs suit most fire door dimensions
and can be easily cut to fit behind hinges, door closers
and plates.
Joinery136|
Stair parts
Square spindles
Edwardian spindles
Oak spindles
Spindles
Stair parts
These stair parts are produced from the finest
quality timber.
For quick and simple fixing of stair parts please see our
Slipfix connectors on page 235.
Spindles can be painted or stained (see pages 243-244).
1 2 3 4 5 6 7 8
Redwood spindles
Primed spindles
Oak spindle
1
2
3
4
5
6
7
8
Victorian
32mm x 32mm x L900mm UK F SPN0240
41mm x 41mm x L900mm UK F SPN0026
Edwardian
32mm x 32mm x L900mm UK F SPN0008
41mm x 41mm x L900mm UK F SPN0028
Stop Chamfered
32mm x 32mm x L900mm UK F SPN0230
41mm x 41mm x L900mm UK F SPN0231
Square
32mm x 32mm x L900mm UK F SPN0010
41mm x 41mm x L900mm UK F SPN0100
Edwardian
32mm x 32mm x L900mm F SPN0248
41mm x 41mm x L900mm F SPN0246
Square
32mm x 32mm x L900mm F SPN0245
41mm x 41mm x L900mm F SPN0247
Stop Chamfered
41mm x 41mm UK SPN0030
Stop Chamfered
32mm x 32mm x L900mm F SPN0251
41mm x 41mm x L900mm F SPN0250
|137
Stair parts
1 2 3 4 5 6 7 8
9 10 11 12 13 14
Edwardian full
92mm x 92mm x L1413mm UK F NWL0011
Edwardian half
Square full with cap
Square half with cap
92mm x 45mm x L1413mm UK F NWL0013
90mm x 90mm x L1500mm UK NWL0041
90mm x 43mm x L1500mm UK NWL0042
Stop Chamfered full
90mm x 90mm x L1490mm UK F NWL0080
Stop Chamfered half
90mm x 41mm x L1490mm UK F NWL0081
90mm x 90mm x L1490mm UK NWL0037
90mm x 43mm x L1490mm UK NWL0038
Square full with cap
Square half with cap
Edwardian full
91mm x 91mm x L1490mm F NWL0086
Edwardian half
91mm x 41mm x L1490mm F NWL0085
Square full
91mm x 91mm x L1490mm F NWL0090
Square half
91mm x 41mm x L1490mm F NWL0091
Stop Chamfered full
91mm x 91mm x L1490mm F NWL0052
Stop Chamfered half
91mm x 41mm x L1490mm F NWL0053
Redwood newel posts
Newel posts
Primed newel posts
Oak newel posts
1
2
3
4
5
6
7
8
9
10
11
12
13
14
Newel post with ball newel cap
Square newel post with cap
Stop Chamfered spindles
138|
Stair parts
Newel caps
Redwood newel caps
Oak newel caps
Primed newel caps
1 2 3 4 5 6
7 8 9 10
1 Ball full
90mm x L150mm UK F NWL0015
2 Ball half
45mm x L150mm UK F NWL0016
3 Pine pattrice full
110mm x 110mm UK NWL0022
4 Pine pattrice half
110mm x 51mm UK NWL0023
5 Square full oak veneer
125mm x 125mm UK NWL0008
6 Square half oak veneer
125mm x 53mm UK NWL0009
Ball full
86mm x 150mm F NWL0088
7
Ball half
42mm x 150mm F NWL0087
8
Square full
110mm x 110mm F NWL0093
9
Square half
110mm x 51mm F NWL0092
10
Rails
Redwood rails
Handrail (with fillet)
L2.4m with 41mm groove UK F SRA0202
L2.4m with 32mm groove UK F SRA0203
L3.9m with 41mm groove UK F SRA0002
L3.9m with 32mm groove UK F SRA0003
Baserail (with fillet)
L2.4m with 41mm groove UK F SRA0212
L2.4m with 32mm groove UK F SRA0213
L3.9m with 41mm groove UK F SRA0012
L3.9m with 32mm groove UK F SRA0013
Primed ball newel cap
Baserail
Pine pattrice newel cap
|139
Stair parts
Laminated mopstick handrailL4.2m UK F SRA0250
Pigs ear handrailL4.2m UK F MOD0209
Staircase
855mm (2’10” wide) UK STA0011
Staircase
915mm (3’0” wide Scotland) UK STA0020
Rails
Staircases
Standard staircases available in Scandinavian whitewood
with MDF treads and risers ready for finishing on-site.
The Howdens staircase is manufactured to BS 585 1989.
Please see page 233 for handrail brackets.
Please see page 135 for further details on our staircases.
Handrail (with fillet)L4.2 with 41mm groove F SRA0260
L4.2 with 32mm groove F SRA0262
Baserail (with fillet)L4.2 with 41mm groove F SRA0261
L4.2 with 32mm groove F SRA0263
Handrail (with fillet)L3.9m with 41mm groove UK SRA0004
Baserail (with fillet)L3.9m with 41mm groove UK SRA0005
Oak rails
Please see page 233 for handrail brackets.
Primed rails
Please see page 233 for handrail brackets.
Laminated mop stick handrail with Brass handrail brackets
Pigs ear handrail
Staircase
140|
Mouldings
Pencil Round architrave and skirting
Quadrant moulding
Angle moulding
Decorative mouldings
Mouldings
The Howdens range includes a number of moulding
options to suit your individual requirements. MDF
mouldings are available either primed or with an oak
veneer, and timber mouldings are manufactured from
high-grade scandinavian redwood.
Quadrant12mm x 12mm x L2.4m UK P MOD0081
18mm x 18mm x L2.4m UK P MOD0082
16mm x 16mm x L2.4m UK P MOD0710
Scotia21mm x 21mm x L2.4m UK P MOD0711
Angle
Dowel
PSE
D-Section
35mm x 35mm x L2.4m UK P MOD0083
20mm x 20mm x L2.4m UK P MOD0712
9mm x 9mm x L2.4m P MOD0713
12mm x 12mm x L2.4m P MOD0714
9mm x 9mm x L2.4m P MOD0715
34mm x 12mm x L2.4m P MOD0716
25mm x 6mm x L2.4m P MOD0717
Primed MDF mouldings
Primed and ready for painting
Chamfered architrave
45mm x 15mm x L4.2m UK F MOD0806
Chamfered skirting96mm x 15mm x L4.2m UK F MOD0801
Pencil Round architrave45mm x 14.5mm x L4.2m UK F MOD0811
69mm x 14.5mm x L4.2m UK F MOD0815
Pencil Round skirting96mm x 14.5mm x L4.2m UK F MOD0810
120mm x 14.5mm x L4.2m UK F MOD0816
|141
Mouldings
Torus architrave70mm x 18mm x L4.2m UK F MOD0808
Torus skirting120mm x 18mm x L4.2m UK F MOD0802
170mm x 18mm x L4.2m UK F MOD0803
152mm x 18mm x L4.2m UK F MOD0813
Burford Traditional architrave70mm x 14.5mm x L4.2m UK F MOD0835
Burford Traditional skirting120mm x 15mm x L4.2m UK F MOD0834
152mm x 14.5mm x L4.2m UK F MOD0840
Burford Contemporary architrave70mm x 15mm x L4.2m UK F MOD0837
Burford Contemporary skirting120mm x 15mm x L4.2m UK F MOD0836
152mm x 14.5mm x L4.2m UK F MOD0841
Square architrave44mm x 14.5mm x L4.2m UK F MOD0821
Square skirting96mm x 14.5mm x L4.2m UK F MOD0820
Newbridge architrave70mm x 18mm x L4.2m UK F MOD0839
Newbridge skirting120mm x 14.5mm x L4.2m UK F MOD0838
Window board25mm x 295mm x L2.7m UK F MOD0814
Ogee architrave70mm x 18mm x L4.2m UK F MOD0807
Ogee skirting120mm x 18mm x L4.2m UK F MOD0804
170mm x 18mm x L4.2m UK F MOD0805
152mm x 18mm x L4.2m UK F MOD0812
Torus architrave and skirting
Burford Traditional architrave and skirting
Square architrave and skirting
142|
Pencil Round architrave70mm x 15mm x L4.2m MOD0603
Pencil Round skirting120mm x 15mm x L4.2m MOD0602
Ogee architrave70mm x 18mm x L4.2m MOD0601
Ogee skirting120mm x 18mm x L4.2m MOD0600
Burford Traditional architrave70mm x 15mm x L4.2m MOD0531
Burford Traditional skirting120mm x 15mm x L4.2m MOD0530
Burford Contemporary architrave70mm x 15mm x L4.2m MOD0533
Burford Contemporary skirting120mm x 15mm x L4.2m MOD0532
MDF Tongue and Groove panel
Primed Shaker Wall panelling
509mm x 915mm x 6mm UK F MOD2100
509mm x 1522mm x 6mm UK F MOD2101
800mm x 445mm x 6mm UK F MOD2102
Oak veneered MDF mouldings
Can be stained or varnished (see pages 243-244)
Wall panelling
Can be painted, stained or varnished (see pages 243-244)
Mouldings
Ogee architrave
Burford Traditional architrave
MDF Tongue and Groove wall panelling
|143
Flooring
We offer a variety of flooring to suit
every style and budget, from solid
oak and laminate flooring to natural
stone effect laminate tiles.
Our range includes a choice of
colours, such as oak, bamboo,
American pecan and walnut, as well
as different finishes, from timber
effect to limestone and slate.
Our selection provides products
suitable for a wide range of
applications throughout the home
and in commercial properties.
Howdens also supplies a variety
of flooring accessories for a
professionally fitted floor, including
underlay, damp proof membrane,
flooring spacers,
colour-matched scotias, pipe rose
and floor profiles.
For more details on all our flooring
and flooring accessories, please visit
www.howdens.com/flooring-collection
Flooring144|
Consider the size and shape of your room as well as lighting. Light floors will give you a greater feeling of
space and can brighten smaller spaces, whilst darker tones create warmth. Think about the needs of your
floor; is it likely to get wet or damp? Do you need underfloor heating? Do you prefer the look of wood or tiles?
Choose a style that suits your needs
Choosing the right floor for your home
Choose a suitable floor for your room
Different rooms in your home will have different levels of traffic on a daily basis. To get the most from your
floor, you will want to choose a floor that is suitable for the level of traffic. 2
1 Consider the size and shape of your room as well as lighting. Light floors will give you a greater feeling of
space and can brighten smaller spaces, whilst darker tones create warmth. Think about the needs of your
floor; is it likely to get wet or damp? Do you need underfloor heating? Do you prefer the look of wood or tiles?
Choose a style that suits your needs
Choosing the right floor for your home
2
1 Consider the size and shape of your room as well as lighting. Light floors will give you a greater feeling of
space and can brighten smaller spaces, whilst darker tones create warmth. Think about the needs of your
floor; is it likely to get wet or damp? Do you need underfloor heating? Do you prefer the look of wood or tiles?
Choose a style that suits your needs
Choosing the right floor for your home
Choose a suitable floor for your room
2
1
Suitability Key:
A Howdens Solid wood H
Howdens Professional Fast Fit V Groove tile
B Howdens Real wood (Engineered) I
Howdens Professional Random Effect tile
C Howdens Professional Click Fit Vinyl J
Howdens Professional Fast Fit tile
D Howdens Professional Fast Fit V Groove K
Howdens Decorative
E Howdens Professional L
Quick-Step Impressive Laminate
F Howdens
M Quick-Step Livyn Vinyl
G Howdens Professional Continuous tile
Flooring
A
A B
F
F H
B
B D
G
G
J
I
E
C
C E
C
H
H
H J
F
D
D F
D
I
I
I
G
E
E G
J
A
A B
F
F H
B
B D
G
G
J
I
E
C
C E
C
H
H
H J
L L
L
L
K
K
K
K
F
D
D F
D
I
I
I
G
E
E G
J
A
F
B
G
J
C
H
K L
M M
D
I
E
A
F
B
G
J
C
H
LK
D
I
E
M
M
M
M
A
F
B
G
J
C
H
LK
D
I
E
|145
AC4 and AC5 laminates can be used for domestic use, however please be aware that as the ranking increases the roughness of the flooring also increases.
The AC Rating tests the durability levels of laminate flooring
Suitable for heavy domestic/light commercial use.
Laminate flooring classification - Abrasion Classification (AC) Rating
Suitable for medium commercial use.
Suitable for medium to heavy commercial use.AC3 AC5
AC4
Aqua Block specifications
The Aqua Block logo indicates that when joints are sealed using flooring joint sealer (SDH0099), laminate flooring with Aqua Block becomes suitable for use in bathrooms and other areas prone to high moisture levels (excluding wet rooms).
Flooring specificationsPlease see below for flooring specifications, providing an essential guide on how to buy flooring specific to your needs.
V groove Planks have micro to deep bevelled edges to create a V groove.
Square profile Square profiled planks create a seamless look.
Continuous pattern Gives the appearance of a natural stone or slate floor with seamless joins.
Random pattern Offers a realistic slate finish.
Suitable for use with underfloor heating See fitting instructions for maximum temperature.
Characteristics of Howdens flooring
3Choose the right underlay
4 in 1 foil back underlay
This 4 in 1 underlay combines a foil backed foam for excellent thermal insulation properties, a damp proof
membrane. Suitable for use with Solid and Real wood.
Foam underlay
This foam underlay has excellent thermal insulation properties, as well as being easy to fit. Suitable for use
with Solid and Real wood.
High performance underlay (XPS)This underlay has many benefits including excellent levelling properties, compression strength and impact.
Suitable for use with Solid and Real wood.
SELITBLOC vinyl underlayThis foam underlay has many benefits including excellent thermal insulation properties, as well as being
able to help with sound reduction. Suitable for use with vinyl.
Damp proof membraneThis underlay has many benefits including excellent levelling properties, compression strength and impact.
Suitable for use with Solid, Real wood and laminate on concrete based sub-floors only.
Paintable damp proof membraneThis underlay has many benefits including excellent levelling properties, compression strength and impact.
Suitable for use with Solid, Real wood and laminate on concrete based sub-floors only.
Bitumen moisture barrier paperThis paper forms a protective barrier to help prevent moisture getting through to the flooring. Suitable for
use with Solid wood when nailing it down to a timber sub-floor.
AC3 AC5
AC4
Micro bevel Planks have shallow bevelled edges to create a seamless look.
Fully restorable Flooring can be restored to capture the finish and performance of the product when first installed. Real wood flooring can be re-finished up to 3 times.
Flooring146|
W120mm x D15mm 1.29m/sq UK P SDH2201
W120mm x D14mm 1.76m/sq F SDH2203
W150mm x D15mm 1.71m/sq UK P SDH2202
W140mm x D14mm 2.05m/sq F SDH2204
The natural beauty of oak is available in solid bevelled
planks. Benefits include greater sound absorption over
laminate flooring and warmth underfoot, varying lengths
create a traditional look. Solid Oak flooring is oiled
to give a smooth finish. Solid wood floors may contain
knots, shakes and natural colour and grain variation.
Dead knots are filled with brown filler to ensure a
smooth floor finish.
Howdens Solid Wood Pre-finished
Pre-finished Solid Oiled Oak
15 Yearguarantee
15Squareprofile
Fullyrestorable
Strand woven bamboo is a great alternative to traditional
oak. This flooring is both stylish and warm, which makes
it a striking feature in any room. Bamboo is hardwearing
and environmentally friendly. This flooring has a matt
lacquered finish.
Howdens Solid Wood Fast Fit
Pre-finished Solid Bamboo
25 Yearstructural guarantee
255 Year
finish & wear guarantee
5V groove Fully
restorable
SDH2300
Panel size: 1.85m x 125mm x 14mm
Pack size: 1.39m/sq
AFor room suitability
please see page 145
AFor room suitability
please see page 145
W120mm x D14mm 1.786m/sq SDH3071
W140mm x D14mm 2.058m/sq F SDH3070
Pre-finished Solid Oak Glossy
Flooring
Howdens Pre-Finished Solid Oiled Oak
Howdens Pre-Finished Solid Oak Glossy
Howdens Pre-Finished Fast Fit Solid Bamboo
|147
SDH3638
Light White Oak single plank wide
Panel size: 2.2m x 180mm x 11mm
Pack size: 2.38m/sq
P SDH3630
Oak single plank wide
Panel size: 2.2m x 180mm x 11mm
Pack size: 2.38m/sq
15 Yearguarantee
15Micro Bevel
SDH3612
Oak single plank
Panel size: 2.2m x 130mm x 14mm
Pack size: 2m/sq
20 Yearguarantee
20
The elegant look of Real wood (engineered) flooring can
add warmth and character to any room in the home. Our
range of Real wood flooring is available in three different
profiles; square, micro bevel and V groove. Real wood
floors contain knots and natural colour variations. Dead
knots are filled with a brown filler to ensure a smooth
finish.
Howdens Real Wood Pre-finished Fast Fit
For room suitability
please see page 145
B
15 Yearguarantee
15
V groove Fullyrestorable
Suitable foruse with
underfloorheating
Flooring
Howdens Real Wood Light White Oak Single Plank
Howdens Real Wood Pre-Finished Oak 3 Strip
Howdens Real Wood Pre-Finished Oak Single Plank Wide
148|
SDH3636
Light Grey Oak single plank wide
Panel size: 2.2m x 180mm x 11mm
Pack size: 2.77m/sq
SDH3635
Light Grey Oak 3 strip
Panel size: 2.2m x 207mm x 14mm
Pack size: 3.18m/sq
SDH3637
Dark Oak single plank wide
Panel size: 2.2m x 180mm x 11mm
Pack size: 2.38m/sq
P SDH3631
Chestnut Oak single plank wide
Panel size: 2.2m x 180mm x 11mm
Pack size: 2.38m/sq
15 Yearguarantee
15Micro Bevel
15 Yearguarantee
15
15 Yearguarantee
15Squareprofile
15 Yearguarantee
15
F SDH3220
Oak 3 strip
Panel size: 2.2m x 207mm x 14mm
Pack size: 3.18m/sq
20 Yearguarantee
20Squareprofile
Flooring
Howdens Real Wood Light Grey Oak single plank NEW
Howdens Real Wood Chestnut Oak single plank
Howdens Real Wood Dark Oak single plank NEW
|149
SDH3689
Canyon Oak Beige
Panel size: 1.25m x 187mm x 4.5mm
Pack size: 2.105m/sq
This flooring comes with a range of benefits, such as,
scratch and stain guard technology for easy maintenance,
water resistant qualities and is compatible with underfloor
heating*. Quick-Step Livyn also has a click fit system
which reduces fitting time
SDH3685
Light Oak Natural
Panel size: 1.25m x 187mm x 4.5mm
Pack size: 2.105m/sq
SDH3683
Vintage Chestnut Natural
Panel size: 1.25m x 187mm x 4.5mm
Pack size: 2.105m/sq
SDH3680
Classic Oak Natural
Panel size: 1.25m x 187mm x 4.5mm
Pack size: 2.105m/sq
Quick-Step Livyn Vinyl
Aqua Block AC rating
AC4
MFor room suitability
please see page 145
20 Year finish & wear
guarantee
2010 Yearmedium
commercialguarantee
10Squareprofile
Suitable foruse with
underfloorheating
*Refer to fitting instructions for details
Flooring
Quick-Step Livyn Canyon Oak Beige
Quick-Step Livyn Light Oak Natural
Quick-Step Livyn Vintage Chestnut Natural
150|
Quick-Step Livyn Canyon Oak Grey
Quick-Step Livyn Silk Oak Dark Grey
Quick-Step Livyn Cottage Oak Dark Brown
Flooring
SDH3681
Canyon Oak Grey
Panel size: 1.25m x 187mm x 4.5mm
Pack size: 2.105m/sq
SDH3682
Silk Oak Dark Grey
Panel size: 1.25m x 187mm x 4.5mm
Pack size: 2.105m/sq
SDH3684
Cottage Oak Dark Brown
Panel size: 1.25m x 187mm x 4.5mm
Pack size: 2.105m/sq
Scratch guard technology -‘Scratch Guard’ layer ensures
superior resistance to scratches.
Stain guard technology - Quick-Step Livyn has a fully
sealed top layer with stain guard technology, offering
protection against stains and dirt.
Water resistant - Can be fitted in bathrooms and kitchen
(not wet rooms).
Installed as a floating floor - Ensuring a faster fit time.
Clickfit system - Easy fast fitting.
Compatible with underfloor heating*.
Benefits of Quick-Step Livyn
*Refer to fitting instructions for details
|151
SDH3688
Light Grey Travertine
Panel size: 1.3m x 320mm x 4.5mm
Pack size: 2.08m/sq
SDH3686
Black Slate
Panel size: 1.3m x 320mm x 4.5mm
Pack size: 2.08m/sq
SDH3687
Cream Travertine
Panel size: 1.3m x 320mm x 4.5mm
Pack size: 2.08m/sq
As with the Quick-Step Livyn vinyl planks, these tiles come
with a range of benefits, such as, scratch and stain guard
technology for easy maintenance, water resistant qualities
and is compatible with underfloor heating. Quick-Step
Livyn also has a click fit system which reduces fitting time.
Quick-Step Livyn Vinyl tile
Aqua Block AC rating
AC4
MFor room suitability
please see page 145
20 Year finish & wear
guarantee
2010 Yearmedium
commercialguarantee
10Squareprofile
Suitable foruse with
underfloorheating
Flooring
Quick-Step Livyn Cream Travertine Tile
Quick-Step Livyn Light Grey Travertine Tile
Quick-Step Livyn Black Slate Tile
152|
SDH3641
Oak
Panel size: 1.31m x 191mm x 4.5mm
Pack size: 1.76m/sq
SDH3640
Light Oak
Panel size: 1.31m x 191mm x 4.5mm
Pack size: 1.76m/sq
SDH3643
Light
Panel size: 0.65m x 324mm x 4.5mm
Pack size: 1.49m/sq
Get the natural look of wood or stone flooring with our
range of vinyl flooring. A textured finish on selected vinyl
flooring allows you to see and feel the grains and grooves
just like real wood.
Howdens Professional Click Fit Vinyl
20 Yearresidentialguarantee
2010 Yearmedium
commercialguarantee
10
For room suitability
please see page 145
CSquareprofile
Suitable foruse with
underfloorheating
Flooring
Howdens Professional Click Fit Vinyl Oak plank
Howdens Professional Click Fit Vinyl Light tile
Howdens Professional Click Fit Vinyl Light Oak plank
|153
SDH2401
Grey Oak
Panel size: 1.38m x 190mm x 8mm
Pack size: 1.8350m/sq
Our Quick-Step Impressive laminate range adds an
element of style to your home. It’s laminate finish with
scratch-resistant coating ensures it is warm underfoot
and easy to maintain. You can easily cover your stairs with
Quick-Step Laminate using the Quick-Step Incizo profile.
The only condition is that the steps of your staircase must
be straight and not rounded.
Quick-Step Impressive
SDH2402
Oak
Panel size: 1.38m x 190mm x 8mm
Pack size: 1.8350m/sq
LFor room suitability
please see page 145
25 Yearstructural guarantee
25
Incizos are multi-purpose finishing strips which can be
easily trimmed using the cutting tool included to create
threshold strips, ramp strips or edge trims.
Colour matched to Quick-Step Impressive Grey Oak and
Oak laminate.
Length – 2.15m
Quick-Step Incizo Benefits
V groove Suitable foruse with
underfloorheating
Aqua Block AC rating
AC4
Quick-Step Impressive Grey Oak NEW
Quick-Step Impressive Oak NEW
Quick-Step Incizo
Flooring154|
F SDH3583
Tawny Chestnut Oak
Panel size: 1.29m x 192mm x 8mm
Pack size: 2.22m/sq
Available in textured and registered embossed finishes,
this premium laminate flooring has the natural, authentic
look of real wood, enhanced by a four sided V groove. The
quick fit, push down laminate flooring system increases fit
speed by up to 30%. The flooring can be laid one piece at
a time rather than row by row.
Howdens Professional Fast Fit V Groove
20 Year finish & wear
guarantee
205 Year
medium commercial guarantee
5V groove Suitable for
use withunderfloor
heating
AC rating
AC4
Aqua Block
For room suitability
please see page 145
D
P SDH3592
Light Oak
Panel size: 1.29m x 192mm x 8mm
Pack size: 2.22m/sq
F SDH3576
Oak
Panel size: 1.29m x 192mm x 8mm
Pack size: 2.22m/sq
Howdens Professional Fast Fit V Groove Tawny Chestnut Oak
Howdens Professional Fast Fit V Groove Light Oak
Howdens Professional Fast Fit V Groove Oak
Flooring |155
F SDH3577
American Pecan
Panel size: 1.29m x 192mm x 8mm
Pack size: 2.22m/sq
UK F SDH3575
P SDH3590
Hickory
White Washed Oak
Panel size: 1.29m x 192mm x 8mm
Pack size: 2.22m/sq
Panel size: 1.29m x 192mm x 8mm
Pack size: 2.22m/sq
SDH3578
Light Grey Oak
Panel size: 1.29m x 192mm x 8mm
Pack size: 2.22m/sq
SDH3582
Dark Grey Oak
Panel size: 1.29m x 192mm x 8mm
Pack size: 2.22m/sq
Howdens Professional Fast Fit V Groove White Washed Oak
Howdens Professional Fast Fit V Groove Dark Grey Oak
Howdens Professional Fast Fit V Groove American Pecan
Flooring156|
SDH3581
Rustic Chestnut Oak
Panel size: 1.29m x 192mm x 8mm
Pack size: 2.22m/sq
UK F SDH3584
Smoky Hickory
Panel size: 1.29m x 192mm x 8mm
Pack size: 2.22m/sq
P SDH3591
P SDH3595
P SDH3596
Grey Oak
Dark Oak
Black Oak
Panel size: 1.29m x 192mm x 8mm
Pack size: 2.22m/sq
Panel size: 1.29m x 192mm x 8mm
Pack size: 2.22m/sq
Panel size: 1.29m x 193mm x 8mm
Pack size: 1.99m/sq
Howdens Professional Fast Fit V Groove Grey Oak
Howdens Professional Fast Fit V Groove Smoky Hickory
Howdens Professional Fast Fit V Groove Rustic
Chestnut Oak
Flooring |157
With a textured finish, the elegant wood tones of this two
strip laminate flooring can be used to create a modern or
classic look in a variety of settings.
Howdens Professional
Squareprofile
Suitable foruse with
underfloorheating
AC rating
AC4
Aqua Block
For room suitability
please see page 145
E
F SDH3722
Grey Oak
Panel size: 1.29m x 192mm x 8mm
Pack size: 2.22m/sq
F SDH3573
Light Oak
Panel size: 1.29m x 192mm x 8mm
Pack size: 2.22m/sq
SDH3588
Light Grey Oak
Panel size: 1.29m x 192mm x 8mm
Pack size: 2m/sq
20 Year finish & wear
guarantee
205 Yearlight
commercial guarantee
5
Howdens Professional Grey Oak
Howdens Professional Light Grey Oak
Howdens Professional Light Oak
Flooring158|
Panel size: 1.29m x 192mm x 8mm
Pack size: 2.22m/sq
F SDH3574
Dark Grey Oak
Panel size: 1.29m x 192mm x 8mm
Pack size: 2.22m/sq
F SDH3720
Rustic Hickory
Panel size: 1.29m x 192mm x 8mm
Pack size: 2.22m/sq
F SDH3572
Oak
Panel size: 1.29m x 192mm x 8mm
Pack size: 2.22m/sq
F SDH3570
F SDH3721
Walnut
Dark Brown Oak
Panel size: 1.29m x 192mm x 8mm
Pack size: 2.22m/sq
Howdens Professional Walnut Laminate
Howdens Professional Oak
Howdens Professional Rustic Hickory
Flooring |159
P SDH2094
Oak
Panel size: 1.29m x 192mm x 6mm
Pack size: 2.73m/sq
SDH2098
3 Strip Oak
Panel size: 1.29m x 192mm x 6mm
Pack size: 3m/sq
P SDH2093
Light Oak
Panel size: 1.29m x 192mm x 6mm
Pack size: 2.73m/sq
P SDH3587
3 Strip Grey Oak
Panel size: 1.29m x 193mm x 6mm
Pack size: 2.73m/sq
P SDH2112
3 Strip White Washed Oak
Panel size: 1.29m x 193mm x 6mm
Pack size: 2.73m/sq
Howdens laminate flooring has a smooth finish and is
suitable for most areas in the home, except bathrooms.
Howdens
Squareprofile
Suitable foruse with
underfloorheating
AC rating
AC3 F
7 Yearfinish & wear
guarantee
7
7 Yearfinish & wear
guarantee
7
7 Yearfinish & wear
guarantee
7
10 Year finish & wear
guarantee
10
10 Year finish & wear
guarantee
10
For room suitability
please see page 145
Howdens Oak
Howdens Light Oak
3 Strip White Washed Oak
Flooring160|
P SDH2082
Natural Stone
Tile size: 1.18m x 395mm x 8mm
Pack size: 2.32m/sq
P SDH2083
Limestone
Tile size: 1.18m x 395mm x 8mm
Pack size: 2.32m/sq
P SDH2088
Light Stone
Tile size: 1.18m x 395mm x 8mm
Pack size: 2.32m/sq
P SDH2084
Black Slate
Tile size: 1.18m x 395mm x 8mm
Pack size: 2.32m/sq
The registered embossed finish is designed to give the
appearance of a natural stone or slate floor. The joins in
this laminate tile are almost seamless, resulting in a floor
that looks very natural.
Howdens Professional Continuous tile
30 Yearfinish & wear
guarantee
305 Year
medium to heavy commercial guarantee
5Continuous
patternSuitable for
use withunderfloor
heating
AC rating
AC5
Aqua Block
GFor room suitability
please see page 145
Howdens Professional Continuous Light Stone tile
Howdens Professional Continuous Black Slate tile
Howdens Professional Continuous Natural Stone tile
Flooring |161
P SDH3668
Light Travertine
Tile size: 1.29m x 327mm x 8mm
Pack size: 2.52m/sq
P SDH3586
Marble
Tile size: 1.29m x 327mm x 8mm
Pack size: 2.53m/sq
SDH3598
White Slate
Tile size: 1.29m x 327mm x 8mm
Pack size: 2.52m/sq
SDH3599
Concrete
Tile size: 1.29m x 327mm x 8mm
Pack size: 2.52m/sq
This product is ideal for kitchens, giving warmth underfoot
with practicality and easy maintenance. The quick fit,
push down laminate flooring system increases fit speed
by up to 30%.
Howdens Professional Fast Fit V Groove
tile
20 Year finish & wear
guarantee
205 Year
medium commercial guarantee
5V groove 2 Tile Suitable for
use withunderfloor
heating
AC rating
AC4
Aqua Block
HFor room suitability
please see page 145
P SDH3585
Grey Slate
Tile size: 1.29m x 327mm x 8mm
Pack size: 2.53m/sq
Howdens Professional Fast Fit V Groove White Slate tile
Howdens Professional Fast Fit V Groove Concrete tile
Howdens Professional Fast Fit V Groove Grey Slate tile
Flooring162|
Our chevron laminate flooring combines this stylish
French chateaux look with convenience and affordability
to provide a great alternative to solid wood. It is suitable
for kitchens, living areas and conservatories and the quick
fit glueless system makes it easier to fit.
P SDH2075
Oak Chevron
Tile size: 1.18m x 239.4mm x 8mm
Pack size: 2.08m/sq
SDH3600
Midnight Slate
Tile size: 1.29m x 327mm x 8mm
Pack size: 2.53m/sq
SDH3670
SDH3601
P SDH2076
Basalt Slate tile
Grey Stone
Grey Chevron
Tile size: 1.29m x 327mm x 8mm
Pack size: 2.52m/sq
Tile size: 1.29m x 327mm x 8mm
Pack size: 2.53m/sq
Tile size: 1.18m x 239.4mm x 8mm
Pack size: 2.08m/sq
Decorative tiles
30 Yearfinish & wear
guarantee
305 Year
medium to heavy commercial guarantee
5Suitable for
use withunderfloor
heating
Aqua Block
KFor room suitability
please see page 145
Howdens Professional Oak Chevron tile
Howdens Professional Grey Chevron tile
Howdens Professional Fast Fit V Groove Basalt Slate tile
Flooring |163
P SDH3652
Slate
Tile size: 1.29m x 326mm x 8mm
Pack size: 2.53m/sq
F SDH2089
Slate
Tile size: 1.28m x 327mm x 8mm
Pack size: 2.5m/sq
This random effect tile is textured and offers a realistic
slate finish, which is suitable for a variety of locations in
your property.
Howdens Professional Random Effect tile
20 Year finish & wear
guarantee
205 Year
medium commercial guarantee
5Squareprofile
Randompattern
Suitable foruse with
underfloorheating
AC rating
AC4
Aqua Block
This fast fit tile is quick to fit, offering a realistic slate
finish throughout your home.
Howdens Professional Fast Fit tile
20 Year finish & wear
guarantee
205 Year
medium to heavy commercial guarantee
5Squareprofile
Randompattern
Suitable foruse with
underfloorheating
AC rating
AC4
Aqua Block
I
J
For room suitability
please see page 145
For room suitability
please see page 145Howdens Professional Random Effect Slate tile
Howdens Professional Fast Fit Slate tile
Howdens Professional Random Effect Slate tile
Flooring164|
4 in 1 foil backed underlay
1m x 10m x 3mm SDH0915
Foam underlay
1m x 15m x 2mm UK SDH0900
High performance underlay (XPS)
1m x 600mm x 5mm UK SDH0909
SelitBloc® Vinyl underlay
1.18m x 8.5m x 1.5mm SDH0926
Damp proof membrane
3m x 4m x 0.2mm UK SDH0910
Paintable damp proof membrane
5 Litres UK SDH0931
Bitumen moisture barrier paper
1m x 25m UK SDH0932
Bitumen moisture barrier paper tape
45m x 75mm UK GAR0410
Underlay
Moisture barriers
Flooring accessories
Howdens supplies a variety of flooring accessories for a professionally fitted floor. The right underlay is essential
for use with floating floors. It provides thermal insulation and reduces the transmission of sound. A damp proof
membrane can be used on stone or concrete based sub-floors before laying the underlay. Use flooring spacers
around the edge of the floor to allow a gap for expansion and contraction, colour-matched scotias can then be
used to cover the gaps left around the edge.
Quick-Step accessories
Hydro Foam sealant Hydro Foam kit Incizo
310ml SDH0088 20m x 10mm SDH0089 Oak L2.15m SDH2410
Grey L2.15m SDH2411
Flooring accessories |165
Chamfered
900mm x 140mm x 18mm UK SDH0959
Square profile
900mm x 140mm x 18mm UK SDH0958
Hardwood threshold strips
Howdens Joinery hardwood threshold strips are available in either a chamfered or square profile.
They are ideal for replacing thresholds and supplied unfinished, allowing them to be painted or varnished to
exact requirements.
Flooring accessories
Ramp strip Threshold stripWhite scotia
L2.4m P SDH0961
L2.4m UK P MOD0711
Sold by range Pages 272-275Sold by range Pages 272-275
Solid Oak L section
L970mm F SDH3041
Chrome pipe rose
Pack of 4 SDH0895
White pipe rose
Pack of 4 UK SDH0896
Profile A - L2.7m x W32mm
Laminate to laminate,
aluminium SDH0940
Profile B - L2.7m x W38mm
Laminate to carpet,
aluminium SDH0942
Profile F - L2.7m x W30mm
Edge profile for flooring
7mm to 9mm, aluminium SDH0945
Clear edge T-Bar SDH4120
Redwood scotia
Floor profiles
For complete installation, Howdens offers a range of aluminium and hardwood floor profiles in addition to a
range of colour matched accessories. For more information please refer to product ranges on pages 272-276
166|
Sealants
310ml Beech Sold by range
Flooring joint sealer
125ml SDH0099
Wood floor adhesive
13kg tub SDH3176
Lumberjack adhesive applicator gun
SDH3182
Laminate flooring fitting kit
UK SDH0970
Flooring adhesive trowel
SDH0912
Heavy duty pull bar SDH9011 Knocking block Vinyl floor roller UK SDH9010 NEW SDH9013
Flooring care kit SDH0715 Oil refresher SDH9020 Combi-cleaner SDH9021
Lumberjack adhesive pack for gun
12 x 600ml cartridges UK SDH3181
Laminate flooring spacers
Pack of 20 SDH0980
Sealants & adhesives
Flooring tools
Flooring aftercare
Flooring accessories |167
Flooring care and maintenance guide
Cleaning and care
Stain & treatment tips
Care and regular maintenance will ensure flooring lasts for
many years. Below are some helpful tips to maintain flooring:
Fruit, berries, juice, milk, cream, soft drink, beer, wine,
tea, coffee, urine - Mild cleaning agent
Rubber, tar, ink, asphalt, lipstick - White spirit or
acetone (wipe with a damp cloth)
Chocolate, shoe polish, oil, grease - Methylated spirits
(wipe with a damp cloth)
Blood - Cold water
Use a soft brush or vacuum cleaner to remove any
surface dust
For regular cleaning use a cloth or mop, ensuring it is
well wrung. It is important not to apply excess moisture
to the floor
We recommend the use of felt pads under furniture to
protect the floor. Moveable furniture/chairs should be on
soft castors or placed on a plastic mat
Door mats should be used inside and outside all
external doorways to prevent grit from being carried
across floor, protecting surfaces from excessive wear
and tear
The flooring care kit can be used to disguise minor
scratches and dents to floors and other areas subjected
to high levels of wear and tear. Suitable for use with
Solid timber, Real wood (Engineered) and wood effect
laminate flooring
Do not use steam mops or cleaners
Do not use abrasive cleaners, steel wool or scouring
pads, as they will damage your floor
Restoring Solid & Real wood floors
Over time, the surface of Solid and Real wood flooring will wear.
When this happens, flooring can be restored in order to capture
the finish and performance of the product when first installed.
We recommend that Real wood flooring is not re-finished more
than three times.
Refinishing guidelines
1. Surface preparation
Remove the existing layer of lacquer/oil with a disk
sander, extract and clear any dust.
2. Finishing
Finish with suitable flooring lacquer/oil. Always follow
the lacquer/oil manufacturer’s instructions. We recommend
testing the finish on a hidden area or off cut, before applying
to the full floor.
Flooring care & maintenance168|
Solid Bamboo flooring
Our strand woven carbonised Bamboo flooring, is resistant to stains, offers a 25 year structural
guarantee and 5 year finish and wear guarantee. Solid Bamboo boards are a quick fit, drop and
lock fast fit system, this increases fit speed by 30%, compared to traditional tongue and groove
profile flooring.
Not suitable for use with underfloor heating.
Recommended fitting method for concrete sub-floors - glue down
Click joint
Recommended fitting method for timber sub-floors - secret nail
Secret
45º nailTongue &
Groove joint
Bitumen moisture
barrier paper & tape
Sub-floor
Tongue &
Groove joint
Paintable damp proof
membrane & flooring
adhesive
Sub-floor
Flooring underlay is essential for use with a floating floor. It provides a cushion for the flooring to sit
on, and will provide thermal insulation and reduce the emission and transmission of sound.
All underlay can be found on page 165.
Real wood (engineered) floors are popular due to their resistance to expansion and contraction from
temperature change and moisture, and also their adaptability. Engineered wood is produced using
oak veneer layers with each layer oriented in different directions for strength. The top layer can be sanded
and re-laquered up to 3 times. The Chestnut Oak flooring will need to be re-stained with a tinted lacquer,
once sanded back to maintain colour. Subject to fitting instructions, Real wood flooring can be used in
conjunction with underfloor heating.
Real wood flooring
Recommended fitting method for timber or concrete sub-floors - floating
Click joint
Bitumen moisture
barrier paper or
damp proof membrane
Sub-floor
Timber substrate
Foam underlay or
high performance underlay
2.5mm Oak veneer
Foam, high performance
or 4 in 1 underlay
Bitumen moisture
barrier or damp
proof membrane
Sub-floor
FlooringAn illustrated technical guide
Solid Oiled Oak flooring
For those who demand a high quality, natural product, our Solid Oiled Oak flooring is the
perfect choice.
Manufactured from A/B/C rustic grade timber, it is UV oiled and comes with a 15 year guarantee
against any manufacturing defects. Solid Oak boards can be: secret nailed to timber sub-floors
(see diagram below); or glued with a suitable adhesive to solid, dry, flat screeded or concrete
sub-floors. This flooring is fully restorable and will last for many years.
Not suitable for use with underfloor heating.
Flooring
454545 nanann illl GroGroGroGroGrooveoveov
G oG oG oG o eo eo eoo e jjj
|169
Aqua Block
On selected ranges, our Aqua Block specification makes Howdens flooring suitable for bathrooms and
other areas prone to high moisture levels (excluding wet rooms), if the joints are sealed using flooring
joint sealer. Standing water should not be left on any laminate flooring. When cleaning laminate flooring,
always ensure that where a mop is used, it is well wrung out.
The right underlay and sub-floor preparationFlooring underlay is essential for use with a floating floor. It provides a cushion for the flooring to sit on and will provide thermal insulation and reduce the emission and transmission of sound.
Foam underlay
Popular because it is easy to fit, it also has an excellent thermal insulation. Foam underlay can be used in conjunction with a damp proof membrane, paintable damp proof membrane or Bitumen moisture barrier paper. Sheets must be joined together using multi-purpose tape.
High performance underlay (XPS) This underlay has many benefits including excellent levelling properties, compression strength and impact noise reduction. It is also lightweight and easy to handle. It can be used in conjunction with damp proof membrane, paintable damp proof membrane or Bitumen moisture barrier paper.
4 in 1 foil backed underlay
This 4 in 1 underlay combines a foil backed foam for excellent thermal insulation properties, a damp proof membrane and tape, removing the need for any additional products. Easy to fit and suitable for use on concrete sub-floors.
Damp proof membrane
It can be used on mineral based sub-floors. Details of where and how to use damp proof membrane can be found in the relevant flooring installation guidelines. Use in conjunction with multi-purpose tape.
Bitumen moisture barrier paper Required when fitting flooring on a timber based sub-floor. Use in conjunction with Bitumen moisture barrier paper tape (GAR0410).
Paintable damp proof membrane – SDH0931
Is suitable for use with Howdens flooring on cement based sub-floors. Paintable damp proof membrane is used as a moisture barrier on sub-floors when damp proof membrane (SDH0910) is not suitable.
Standard click system Fast Fit click systemClick joint
Bitumen moisture
barrier paper or
damp proof membrane
Apply flooring joint sealer
along all edges of planks
when laying
Sub-floor
Foam, high
performance or
4 in 1 underlay
Sub-floor
Laminate flooring
Howdens quality laminate flooring has a tried and tested locking system for fast, secure installation.
It features a HDF core and edge sealing which ensures the absolute minimum amount of moisture is
absorbed. The quick fit, push down laminate fast fit system that features on our Fast Fit products increases
fit speed by up to 30%. The flooring can be laid one piece at a time rather than row by row. All of our
laminate flooring is suitable for use with underfloor heating up to a maximum temperature of 27°.
Flooring
SS flfl SubSubSubS bSubbb-flo-floflo-flofl orororo
170|
Hardware
Door furniture, security products
and fixings are ranges where it
is important to have the widest
possible choice, and Howdens has
all the options you need to complete
your projects.
Everything we supply is designed
and manufactured to the highest
standards. All our hardware products,
where appropriate, meet British
Standards, building regulations
and insurance requirements for
both domestic and commercial
applications.
From essentials such as hinges and
screws to finishing touches such as
door stops and draught excluders,
we have fixings for every job.
We also supply a complete range of
sealants, adhesives, varnishes and
finishes, as well as a range of tools
and other hardware accessories.
Hardware
Fire Regulations:
FD Fire doorsFH Essential fire door hardwareFH Non-essential fire door hardware
Building Regulations:
E Part E doors - sound reducingL Part L doors - warmth and insulation suitable for new buildL Part L doors - warmth and insulation suitable for refurbishment projectsM Part M doors - mobility and access
|171
Choosing the right handle
Latch handlesAre for internal use and usually mounted on a backplate. They are used
in conjunction with a tubular mortice latch. Suitable for use with doors
that are of 35-44mm thickness.
Bathroom handlesAre used in conjunction with a bathroom mortice sashlock. All
Howdens bathroom handles have a thumbturn on the inside of the
door and a release slot on the outside of the door for unlocking in an
emergency, this complies with building regulations for bathroom locks
in commercial applications. Suitable for use with doors that are of 35-
44mm thickness.
Privacy handlesAre used on bathroom doors and in conjunction with a tubular mortice
latch. On the inside of the door there is a thumbturn and on the outside
of the door there is a release slot which can be used to unlock the door
in an emergency. Suitable for use with doors that are
of 35-44mm thickness.
Lock handlesHave a keyhole cut for use where a lock is required and are used in
conjunction with mortice sashlocks. Suitable for use with doors that are
of 35-54mm thickness.
Choosing the right handle172|
Choosing the right handle
Rose handlesAn alternative to a latch handle, rose handles are mounted on a
small round or square backplate. Rose handles can be fitted on their
own with a tubular mortice latch or with a matching bathroom turn or
escutcheon. Suitable for use with doors that are 35-54mm thickness.
Euro/Oval profile handlesAre used mainly in commercial settings. They have an enlarged euro
or oval profile keyhole shape cut out of the backplate which is used
to house a key operated cylinder. They are used in conjunction with a
cylinder lock.
Disabled access handleAre used on bathroom doors. On the inside of the door there is a lever
and on the outside of the door there is a release slot which can be
used to unlock the door in an emergency. Suitable for use with doors
that are of 40-54mm thickness.
Mortice knob handlesMortice knobs are mounted on a round backplate and usually fitted in
conjunction with a tubular mortice latch. These can also be paired with
a bathroom turn or escutcheon. Suitable for use with doors that are
35-44mm thickness.
Choose the right handle |173
Rose handles
See matching door furniture on pages 195-210
Victorian Scroll RoseBrass DFU0071
Chrome DFU0615
H62mm x W62mm x D9mm
Victorian RoseChrome DFU0072
H62mm x W62mm x D9mm
Lugano RoseChrome DFU0907
Satin Nickel DFU0725
H52mm x W52mm x D8mm
Sofia RoseChrome DFU0709
Satin Nickel DFU0726
Black Nickel NEW DFU1040
H52mm x W52mm x D10mm
Garda RoseBrass DFU0819
Chrome DFU0820
Satin Nickel DFU0821
H47mm x W47mm x D10mm
Ledro RoseBlack DFU0482
H52mm x W52mm x D10mm
Mitred Lecco RoseSatin Stainless Steel FH DFU1030
H45mm x W45mm x D10mmFD30/FD60
Durham Pewter RosePewter UK DFU0742
H54mm x W54mm x D10mm
Victorian Rose Chrome handle
Ledro Rose Black handle
Mitred Lecco Rose Satin Stainless Steel handle
Rose handles174|
Rose handles
See matching door furniture on pages 195-210
Lecco RoseSatin Stainless Steel FH DFU0471
H45mm x W45mm x D10mmFD60
Newington RosePolished/Satin Chrome DFU0836
H53mm x W53mm x D10mmFD30/
Cadeby RoseChrome Effect FH DFU0835
H52mm x W52mm x D9mmFD30/FD60
Lamport RosePolished/Satin Chrome DFU0837
H51mm x W51mm x D10mm
1010 yearoperationalwarranty
Adina RosePolished/Satin Chrome DFU0458
H47mm x W47mm x D10mm
Riva RoseChrome DFU0460
Satin Nickel DFU0470
H45mm x W45mm x D10mm
Capri RosePolished/Satin Chrome DFU0454
H50mm x W50mm x D8mm
Arva RosePolished/Satin Chrome DFU0650
H50mm x W50mm x D10mm
Rose handles
Lamport Rose Polished Satin Chrome handle
Riva Rose Chrome handle
Capri Rose Polished/Satin Chrome handle
|175
Rose handles
Turin RoseSatin Stainless Steel FH DFU0727
H50mm x W50mm x D10mmFD30/FD60
Lago RosePolished Stainless SteelFH DFU0729
H54mm x W54mm x D10mmFD30/FD60
Burford RoseBrushed Stainless Steel DFU0760
H53mm x W53mm x D10mm
Pewter Effect Scroll RosePewter DFU0755
H50mm x W50mm x D10mm
Roundbar RoseAluminium FH DFU0300**
Stainless Steel FH DFU0260*
H50mm x W50mm x D10mmFD30/FD60
1010 yearoperationalwarranty**
5 yearoperationalwarranty*
5
Alento RosePolished/ Satin Chrome DFU1035
H53mm x W53mm x D10mm
Turin Rose Satin Stainless Steel handle
Pewter Effect Scroll Rose handle
Alento Rose Satin/Polished handle NEW
Rose handlesSee matching door furniture on pages 195-210
176|
Durham LatchPewter UK DFU0740
H150mm x W50mm x D7mm
Durham LockPewter UK DFU0741
H150mm x W50mm x D7mm
Durham BathroomPewter UK DFU0743
H150mm x W50mm x D7mm
Durham RosePewter UK DFU0742
H54mm x W54mm x D10mm
Durham
Durham Pewter Lock handle
Durham Pewter Rose handle
Durham handles
Durham Pewter Latch handle
See matching door furniture on pages 195-210|177
Pewter Effect LatchPewter DFU0833
H155mm x W41mm x D10mm
Pewter Effect LockPewter DFU0834
H155mm x W41mm x D10mm
Pewter Effect RosePewter DFU0755
H50mm x W50mm x D10mm
Pewter Effect
Pewter Effect Scroll Lock handle
Pewter Effect Scroll Latch handle
Pewter Effect handles
Pewter Effect Scroll Rose handle
See matching door furniture on pages 195-210178|
Chrissi Chrome
Chrissi LatchChrome DFU0039
H140mm x W43mm x D9mm
Chrissi LockChrome DFU0038
H205mm x W50mm x D8mm
Chrissi BathroomChrome DFU0031
H205mm x W50mm x D8mm
Chrissi PrivacyChrome DFU0040
H140mm x W43mm x D9mm
Chrissi Chrome handles
Chrissi Chrome Lock handle
Chrissi Chrome Latch handle Chrissi Chrome Privacy handle
See matching door furniture on pages 195-210|179
Chrissi Satin Nickel
Chrissi Satin Nickel Latch handle
Chrissi Satin Nickel Bathroom handle
Chrissi LatchSatin Nickel DFU0045
H115mm x W40mm x D10mm
Chrissi LockSatin Nickel DFU0044
H151mm x W42mm x D8mm
Chrissi BathroomSatin Nickel DFU0032
H151mm x W42mm x D8mm
Chrissi PrivacySatin Nickel DFU0046
H115mm x W43mm x D9mm
Chrissi Satin Nickel handles
Chrissi Satin Nickel Lock handle
See matching door furniture on pages 195-210180|
Idro
Idro LatchBrass DFU0601
Chrome DFU0604
Satin Nickel DFU0830
H185mm x W40mm x D9mm
Idro LockBrass DFU0600
Chrome DFU0603
Satin Nickel DFU0831
H185mm x W40mm x D9mm
Idro PrivacyBrass DFU0602
Chrome DFU0605
Satin Nickel DFU0832
H185mm x W40mm x D9mm
Idro Chrome Latch handle
Idro Brass Privacy handle
Idro handles
Idro Satin Nickel Lock handle
See matching door furniture on pages 195-210|181
Garda
Garda Chrome Bathroom handle
Garda Satin Nickel Lock handle
Garda LatchBrass DFU0701
Chrome DFU0705
Satin Nickel DFU0719
H179mm x W50mm x D10mm
Garda LockBrass DFU0700
Chrome DFU0704
Satin Nickel DFU0720
H179mm x W50mm x D10mm
Garda BathroomBrass DFU0738
Chrome DFU0737
Satin Nickel DFU0736
H179mm x W50mm x D10mm
Garda PrivacyBrass DFU0702
Chrome DFU0706
Satin Nickel DFU0721
H179mm x W50mm x D10mm
Garda RoseBrass DFU0819
Chrome DFU0820
Satin Nickel DFU0821
H47mm x W47mm x D10mm
Garda handles
Garda Brass Lock handle
See matching door furniture on pages 195-210182|
Lugano LatchChrome DFU0905
H160mm x W40mm x D9mm
Lugano LockChrome DFU0904
H160mm x W40mm x D9mm
Lugano PrivacyChrome DFU0906
H160mm x W40mm x D9mm
Lugano RoseChrome DFU0907
Satin Nickel DFU0725
H52mm x W52mm x D8mm
Lugano
Lugano Chrome Lock handle
Lugano Chrome Rose handle
Lugano handles
Lugano Chrome Latch handle
See matching door furniture on pages 195-210|183
Victorian Scroll
Victorian Scroll Chrome Privacy handle
Victorian Scroll Brass Latch handle
Victorian Scroll LatchBrass DFU0631
Chrome DFU0661
H118mm x W42mm x D9mm
Victorian Scroll LockBrass DFU0630
Chrome DFU0660
H154mm x W41mm x D10mm
Victorian Scroll BathroomBrass DFU0632
Chrome DFU0662
H155mm x W41.5mm x D10mm
Victorian Scroll PrivacyBrass DFU0633
Chrome DFU0663
H118mm x W41.5mm x D9.5mm
Victorian Scroll RoseBrass DFU0071
Chrome DFU0615
H62mm x W62mm x D9mm
Victorian Scroll handles
Victorian Scroll Brass Rose handle
See matching door furniture on pages 195-210184|
Victorian LatchBrass DFU0621
Chrome DFU0611
Satin Nickel DFU0641
H117mm x W40mm x D10mm
Victorian BathroomBrass DFU0622
Chrome DFU0612
Satin Nickel DFU0642
H154mm x W41mm x D10mm
Victorian LockBrass DFU0620
Chrome DFU0610
Satin Nickel DFU0640
H154mm x W41mm x D10mm
Victorian PrivacyBrass DFU0623
Chrome DFU0613
Satin Nickel DFU0643
Chrome DFU1014
Satin Nickel DFU1015
H118mm x W42mm x D9mm
Victorian Rose Budget Victorian LatchChrome DFU0072
H62mm x W62mm x D9mm
H100mm x W38mm x D8mm
Victorian / Budget Victorian
Victorian Satin Nickel Bathroom handle
Victorian Chrome Latch handle
Victorian / Budget Victorian handles
Victorian Brass Privacy handle
See matching door furniture on pages 195-210|185
Roundbar LatchAluminium FH DFU0302
H150mm x W40mm x D10mmFD30/FD60
Roundbar LockAluminium FH DFU0301
H150mm x W40mm x D10mmFD30/FD60
Roundbar BathroomAluminium FH DFU0303
H150mm x W40mm x D10mmFD30/FD60
Roundbar RoseAluminium FH DFU0300**
Stainless Steel FH DFU0260*
H50mm x W50mm x D10mmFD30/FD60
Roundbar Aluminium
Roundbar Aluminium Bathroom handle
Roundbar Aluminium Rose handle
1010 yearoperationalwarranty
1010 yearoperationalwarranty
1010 yearoperationalwarranty
1010 yearoperationalwarranty**
5 yearoperationalwarranty*
5
Roundbar Aluminium handles
Roundbar Aluminium Latch handle
See matching door furniture on pages 195-210186|
Edinburgh LatchAluminium FH DFU0085
Chrome FH DFU0840
H103mm x W32mm x D9mmFD30/FD60
Edinburgh LockAluminium FH DFU0086
Chrome FH DFU0841
H154mm x W32mm x D9mmFD30/FD60
Edinburgh Bathroom/PrivacyAluminium FH DFU0087
Chrome FH DFU0842
H154mm x W32mm x D9mmFD30/FD60
Edinburgh
Edinburgh Aluminium Latch handle
Edinburgh Chrome Effect Lock handleEdinburgh Aluminium Bathroom/Privacy handle
DFU0087 & DFU0842 can be used as a bathroom
or a privacy handle - combine with the appropriate lock
or latch pack.
1010 yearoperationalwarranty
1010 yearoperationalwarranty
1010 yearoperationalwarranty
Edinburgh handlesSee matching door furniture on pages 195-210
|187
Antique
Antique Black Ornate Lock handle
Antique Black Latch handle Antique Black Ornate Latch handle
Antique LatchBlack DFU0034
H130mm x W49mm x D4.5mm
Antique LockBlack DFU0033
H160mm x W50mm x D4.5mm
Antique Ornate LatchBlack DFU0028
H160mm x W50mm x D4mm
Antique Ornate LockBlack DFU0029
H160mm x W50mm x D4mm
Antique handlesSee matching door furniture on pages 195-210
188|
Mortice knobs
Chrome mortice knob
Satin Nickel mortice knob Brass mortice knob
Mortice knobsBrass DFU0050
Chrome DFU0063
Satin Nickel DFU0751
D62mm
KnobsetPlastic Brown (mortice/rim) DFU0064
D56mm
Taylors dummy spindle
Bright Zinc plated high-grade alloy steel DFU0910
H32mm x L30mm x T8mm
Mortice knobs & knobsetSee matching door furniture on pages 195-210
|189
Euro, Oval and Disabled
Victorian Chrome Euro profile handle
Disabled Aluminium access lever handle Edinburgh Chrome Euro profile handle
Victorian Euro profile LockChrome DFU0616
H153mm x W41mm x D10mm
Aluminium Roundbar Euro profile LockEuro FH DFU0304
Oval FH DFU0305
H150mm x W40mm x D10mmFD30/FD60
Edinburgh Euro profile LockAluminium FH DFU0088
Chrome FH DFU0843
H154mm x W32mm x D9mmFD30/FD60
Universal Aluminium disabled
access lever handle DFU0922
1010 yearoperationalwarranty
1010 yearoperationalwarranty
5 yearoperationalwarranty
5
Euro, Oval & Disabled handlesSee matching door furniture on pages 195-210
190|
Lock and Latch packs
Newington Satin Stainless Steel Latch pack
Mitred Lecco Rose Latch pack NEW
Newington Matt Black Latch pack NEW
Lock and Latch packs
Packs include door furniture, locks/latches, hinges and fixings.
Newington Rose Latch packPolished/Satin Stainless Steel LAL0758
Black Nickel NEW LAL1330
Matt Black NEW LAL1331
Polished/Satin fire rated NEW FH LAL1332
Turin Rose Latch pack
Stainless Steel NEW LAL1220
Lecco Rose Latch pack
Satin Stainless Steel NEW LAL1221
Mitred Lecco Rose Latch PackStainless Steel NEW LAL1340
Sofia Rose Latch packChrome LAL1222
Black Nickel NEW LAL1350
|191
Garda Lock and Latch packsBrass Latch pack LAL2020
Brass 3 Lever Lock pack LAL2050
Brass Bathroom pack LAL2092
Brass Privacy pack LAL2030
Chrome Latch pack LAL2060
Chrome 3 Lever Lock pack LAL2080
Chrome Privacy pack LAL2070
Lock and Latch packs
Chrissi Lock and Latch packsChrome Latch pack LAL1060
Chrome 3 Lever Lock pack LAL1080
Chrome Bathroom pack LAL1090
Chrome Privacy pack LAL1070
Lock and Latch packs
Burford Rose Latch packBrushed Stainless Steel LAL3020
Newington Push Button Lock and Latch pack
Polished Privacy Satin Stainless Steel NEW LAL0770
Sofia Push Button Lock and Latch Pack
Chrome Privacy NEW LAL0771
Newington Polished Satin Push Button NEW
Sofia Chrome Push Button NEW
Chrissi Chrome 3 Lever Lock pack
192|
Lock and Latch packs
Latch pack (no handle)Chrome Latch pack LAL0178
Brass Latch pack LAL0172
*10 year operational warranty applies to the handle only
Edinburgh Aluminium Lock and Latch packsAluminium Latch pack LAL0166
Aluminium Privacy pack LAL0168
1010 yearoptionalwarranty*
Victorian Lock and Latch packsBrass Latch pack LAL1130
Brass Privacy pack LAL1120
Chrome Latch pack LAL1102
Chrome Bathroom pack LAL1112
Chrome Privacy pack LAL1110
Lock and Latch packs
Victorian Budget Lock and Latch packsBudget Brass Latch pack LAL0752
Budget Chrome Latch pack LAL0756
Budget Chrome Privacy pack LAL0757
Budget Victorian Satin Nickel Latch pack NEW LAL1310
Budget Victorian Satin Nickel Latch pack NEW
Edinburgh Aluminium Latch pack
Victorian Brass Privacy pack
|193
Quick-Fit Lock and Latch Packs
Newington Polished/Satin Quick-Fit latch pack LAL1211
Sofia Chrome Quick-Fit latch pack LAL1212
Quick-Fit handle jig pack TLS0607
Quick-Fit handle Jig - Keep locator TLS0672
Lock and Latch packs
Fino Chrome Quick-Fit latch pack NEW LAL1214
Cesano Chrome Quick-Fit latch pack NEW LAL1213
Newington Polished/Satin Quick-Fit latch pack
Sofia Chrome Quick-Fit latch pack
Newington Polished/Satin Quick-Fit latch pack
194|
Fire Regulations:
FD Fire doorsFH Essential fire door hardwareFH Non-essential fire door hardware
Building Regulations:
E Part E doors - sound reducingL Part L doors - warmth and insulation suitable for new buildL Part L doors - warmth and insulation suitable for refurbishment projectsM Part M doors - mobility and access
Door furniture
Howdens offers a wide range of
matching door furniture to complete
the look of the door. This includes
pull handles, coat hooks, cabin
hooks, door stops, door knockers,
escutcheons and many more.
Door furniture|195
Bathroom turns
Available in multiple finishes and sizes, and supplied with fixings.
Suitable for use with bathroom bolts (LAL0130/31). See page 214.
D53mm
Polished/Satin bathroom turn DFU0432
5 yearoperationalwarranty
5D50mm
Stainless Steel lever indicator and turn DFU0270
D53mm
Aluminium bathroom turn DFU0313
H50mm x W50mm
Brushed Steel Effect Square bathroom turn DFU0761
H50mm x W50mm
Satin Nickel Square bathroom turn DFU0250
H50mm x W50mm
Chrome Square bathroom turn DFU0445
D52mm
Black Nickel bathroom turn DFU0443
D52mm
Matt Black bathroom turn NEW DFU1046
D38mm
Antique Black bathroom turn DFU0035
D44mm
Pewter Effect bathroom turn DFU0756
D44mm
Pewter bathroom turn UK DFU0731
D52mm
Polished Stainless Steel bathroom turn DFU0447
D53mm
Satin Stainless Steel bathroom turn DFU0449
D47mm
Satin Nickel bathroom turn DFU0431
D47mm
Chrome bathroom turn DFU0442
D47mm
Brass bathroom turn DFU0441
Door furniture
Chrome Square bathroom turn
Satin Stainless Steel bathroom turn
Brass bathroom turn
196|
Escutcheons
All escutcheons are sold in pairs unless otherwise stated.
H50mm x W50mm
Chrome square DFU0550
H50mm x W50mm
Satin Nickel square DFU0779
H52mm x W52mm
Brushed Stainless Steel Effect square DFU0780
D47mm
Chrome round DFU0777
D43mm
Satin Nickel round DFU0775
D54mm
Satin Stainless Steel round DFU0771
D52mm
Polished Stainless Steel round DFU0772
D40mm
Pewter round UK DFU0732
D50mm
Pewter Effect round DFU0776
D50mm
Aluminium Euro profile round DFU0773
D50mm
Stainless Steel Euro profile round DFU0774
D53mm
Black Nickel round DFU0216
D53mm
Matt Black round NEW DFU1045
D53mm
Polished/Satin Chrome round DFU0781
H40mm x W35mm
Brass round covered DFU0207
Sold in single units
H40mm x W35mm
Chrome round covered DFU0206
Sold in single units
H43mm x W33mm
Satin nickel round covered DFU0215
Sold in single units
Door furniture
Pewter round escutcheon
Chrome square escutcheon
Brass round covered escutcheon
|197
Pull handles
Supplied with fixings.
Fingerplates & kickplates
Brass bow 6” DFU0147
Chrome bow 6” DFU0138
Satin Nickel bow 6” DFU0139
Aluminium bow 6” DFU0141
Antique Black 7” DFU0137
Aluminium concealed fixing 9” DFU0142
Aluminium cranked 9” DFU0144
Aluminium bolt fixing 9” DFU0143
Stainless Steel concealed fixing 12” FH DFU0136
Fingerplates
Aluminium fingerplate 12” x 3” UK FH DFU0107
Brass fingerplate 12” x 3” UK FH DFU0146
Polished Stainless Steel fingerplate 12” x 3” UK FH DFU0145
Stainless Steel fingerplate 15” x 3” UK FH DFU0095
Kickplates
SAA kickplate 30” H150mm x L762mm UK FH DFU0157
SAA kickplate 33” H150mm x L838mm UK FH DFU0106
FD30/FD60
Door furniture
Aluminium fingerplate
Stainless Steel concealed fixing pull handle
Aluminium bow pull handle
198|
Brass GIR0364
H127mm x W33mm
Chrome GIR0363
H127mm x W33mm
Satin Nickel GIR0365
H120mm x W30mmAluminium GIR0367
H135mm x W33mm
Antique Black GIR0366
H110mm x W35mm
4” / H35mm x L110mm LAL0116
6” / H35mm x L170mm LAL0117
4”/ H35mm x L110mm LAL0113
6”/ H35mm x L170mm LAL0114
4”/ H35mm x L110mm LAL0118
6”/ H35mm x L170mm LAL0119
6”/ H35mm x L170mm LAL0110
Coat hooks
Supplied with fixings.
Cabin hooks
Supplied with fixings.
Brass Chrome
Satin Nickel Antique Black
Door furniture
Chrome cabin hook
Chrome coat hook
Antique Black coat hook
|199
Brass Projection GIR0342
H41mm x L65mm
Satin Nickel Projection GIR0358
H41mm x L65mm
Chrome Projection GIR0345
H41mm x L65mm
Aluminium Projection GIR0344
H41mm x L65mm
Brass Finish Flexible GIR0340
3”/ H24mm x L74mm
Chrome Oval GIR0346
H20mm x L50mm
Satin Nickel Oval GIR0357
H20mm x L50mm
Aluminium Oval GIR0343
H20mm x L50mm
White Plastic GIR0004
H20mm x L25mm
Door stops
Bolts
Supplied with fixings.
BJP - Black Japanned*No fixings supplied
6” / H19mm x L152mm SCF0166Satin Nickel flush bolt
4” / H25mm x L100mm SCF0045Aluminium necked barrel bolt
5” / H37mm x L135mm SCF0067Antique Black bolt
6” / H38mm x L185mm SCF0059*
8” / H45mm x L247mm SCF0155*
BJP tower bolt6” / H45mm x L208mm SCF0125*
8” / H45mm x L255mm SCF0126*
Galvanised padbolt
12” / H120mm x L310mm SCF0300Galvanised garage drop bolt
4” / H25mm x L116mm SCF0046Brass barrel bolt
6” / H30mm x L145mm SCF0047Brass heavy duty bolt
4” / H25mm x L100mm SCF0048
6” / H25mm x L152mm SCF0140
Brass necked barrel bolt6” / H19mm x L152mm SCF0171Brass flush bolt
4” / H25mm x L116mm SCF0141
6” / H25mm x L165mm SCF0163
Chrome barrel bolt4” / H25mm x L100mm SCF0158
6” / H25mm x L152mm SCF0159
Chrome necked barrel bolt
6” / H19mm x L152mm SCF0173Chrome flush bolt
6” / H30mm x L145mm SCF0147Chrome heavy duty bolt
4” / H25mm x L116mm SCF0167Satin Nickel barrel bolt
4” / H25mm x L100mm SCF0168
6” / H25mm x L152mm SCF0169
Satin Nickel necked barrel bolt6” / H30mm x L145mm SCF0170Satin Nickel heavy duty bolt
4” / H25mm x L116mm SCF0041Aluminium barrel bolt
6” / H19mm x L152mm SCF0172Aluminium flush bolt
Door furniture200|
Chrome door tidy
Antique Black letterplate
Brass door knocker
Door furniture
Brass DFU0165
H153mm x W80mm
Chrome DFU0164
H153mm x W80mm
Satin Nickel DFU0166
H168mm x W80mm
Aluminium letterplate DFU0239
L252mm x H80mm
Gold sleeved letterplate DFU0235
L297mm x H71mm
Brass door tidy DFU0150
To suit 252mm / 10” letterplates
Chrome door tidy DFU0159
To suit 252mm / 10” letterplates
Satin Nickel door tidy DFU0158
To suit 252mm / 10” letterplates
Satin Nickel letterplate DFU0099 L252mm x H80mm
Antique Black letterplate DFU0096 L250mm x H80mm
Brass letterplate DFU0100
L252mm x H80mm
Chrome Plated letterplate DFU0233
L252mm x H80mm
Door knockers
Letterplates & door tidies
L297mm x H71mm
Chrome sleeved letterplate DFU0236
|201
Suffolk latches
Cylinder pulls
Fixings not required. Held in place by cylinder lock.
Draught excluders
Brass DFU0108
H70mm x W47mm
Chrome DFU0205
H70mm x W47mm
Satin Nickel DFU0140
H70mm x W47mm
Antique Black LAL0115
Black Japanned LAL0101
Galvanised UK LAL0109
Exitex Lowline Gold GIR0010
L914mm x H55mm x W25mm
Exitex Lowline Aluminium GIR0035
L914mm x H55mm x W25mm
Exitex Gold mobility weather bar kit GIR0016
L914mm x H60mm x W34mm
55 yearoperationalwarranty
55 yearoperationalwarranty
55 yearoperationalwarranty
Door furniture
Antique Black Suffolk latch
Brass cylinder pull
Exitex Lowline Gold draught excluder
202|
55 yearoperationalwarranty
55 yearoperationalwarranty
55 yearoperationalwarranty
55 yearoperationalwarranty
55 yearoperationalwarranty
55 yearoperationalwarranty
55 yearoperationalwarranty
White trackset 1200mm UK GIR2036
White trackset 1800mm UK GIR2030
White trackset 2700mm UK GIR2031
White trackset 3600mm UK GIR2032
Waterbar GAR0010
L914mm
Exitex Aluminium door surround GIR0037
L5,180mm x H40mm x W9mm
Exitex Gold door surround GIR0012
L5,180mm x H40mm x W9mm
Exitex Threshex Aluminium GIR0038
L933mm x H80mm x W18.5mm
Exitex Threshex Gold GIR0014
L933mm x H80mm x W18.5mm
Exitex Aluminium brush strip GIR0039
L914mm x H33mm x W10mm
Exitex Gold brush strip GIR0155
L914mm x H33mm x W10mm
Exitex Aluminium mobility weather bar kit GIR0036
L914mm x H60mm x W34mm
Silver trackset 1200mm UK GIR2037
Silver trackset 1800mm UK GIR2033
Silver trackset 2700mm UK GIR2034
Silver trackset 3600mm UK GIR2035
Sliding wardrobe door tracks
Suitable for use with sliding wardrobe doors. See pages 99-101
Waterbar
Draught excluders
Door furniture
Silver trackset
Exitex Threshex Gold draught excluder
Exitex Aluminium mobility weather bar
|203
1 yearguarantee
1 yearguarantee
Marathon sliding door gear (suitable for single doors)
L1500mm UK GIR0030
Sliding door gear L1500mm (fittings for 2 doors included) UK GIR3010
Sliding door gear L2400mm (fittings for 3 doors included UK GIR3011
Floor Channel L1500mm UK GIR3012
Floor Channel L2400mm UK GIR3013
Nylon guides for floor channel (pair) GIR3014
Additional Truck Kit UK GIR3025
Chrome round tube 19mm x 2.5m GIR0040
Chrome round Socket 19mm GIR0052
Chrome round end bracket 19mm GIR0050
Chrome round centre bracket 19mm GIR0051
Chrome oval tube 15mm x 30mm x 1.8m GIR0056
Chrome oval socket 15mm x 30mm GIR0059
Chrome oval end bracket 15mm x 30mm GIR0057
Chrome oval centre bracket 15mm x 30mm GIR0058
Accessories for multiple doors
Sliding door gear
Sliding door gear is suitable for doors, partitions and wardrobes
in heavy-duty domestic and light commercial applications.
For multiple doors
For single doors
Chrome tube and fittings
Max. weight 45kg per door.
Max. weight 55kg.
Brass flush handle GIR3033
Chrome flush handle GIR3032
Satin Nickel flush handle GIR3031
Door furniture
Chrome oval tube
Floor channel
Marathon sliding door gear
204|
Commercial door furniture
Fire Regulations:
FD Fire doorsFH Essential fire door hardwareFH Non-essential fire door hardware
Building Regulations:
E Part E doors - sound reducingL Part L doors - warmth and insulation suitable for new buildL Part L doors - warmth and insulation suitable for refurbishment projectsM Part M doors - mobility and access
Commercial door
furniture
Howdens supplies a range of
commercial door furniture suitable
for communal buildings, offices
and commercial properties. The
products available include a variety
of handles, fingerplates, door closers,
digital door lock, panic hardware and
signage.
Commercial properties often require
fire rated door furniture and all
Howdens fire rated products are
highlighted with either an essential
fire door hardware or a non-essential
fire door hardware symbol.
The Edinburgh and Aluminium
Roundbar handles also come with
a 10 year operational warranty.
|205
Commercial door furniture
5 yearoperationalwarranty
5
Universal Aluminium disabled access lever handle DFU0922
5 yearoperationalwarranty
5
Stainless Steel lever indicator and turn DFU0270
D50mm
Stainless Steel Euro profile round DFU0774
D50mmSold in pairs
1010 yearoperationalwarranty
Edinburgh Aluminium Euro profile FH DFU0088
H154mm x W32mm x D9mmFD30/FD60
1010 yearoperationalwarranty
Edinburgh Chrome Effect Euro profile FH DFU0843
H154mm x W32mm x D9mmFD30/FD60
5 yearoperationalwarranty
5
Stainless Steel Roundbar 19mm FH DFU0260
H50mm x W50mm x D10mmFD30/FD60
1010 yearoperationalwarranty
Aluminium Roundbar 19mm FH DFU0300
H50mm x W50mm x D10mmFD30/FD60
Handles & accessories
1010 yearoperationalwarranty
FD30/FD60
Aluminium Roundbar 19mm Oval profile FH DFU0305
H150mm x W40mm x D10mm
Aluminium Roundbar 19mm Euro profile FH DFU0304
Universal Aluminium disabled access lever
Stainless Steel Euro profile round escutcheon
Aluminium Roundbar 19mm Euro profile
206|
Stainless Steel fingerplate
Briton 2003.SES door closer
Eclipse 73 door closer
Commercial door furniture
Union Retro 3 door closer fixed size 3 Silver FH FD120 DCL0017
Briton 2003.SES door closer fixed size 3 Silver FH FD120* DCL0007
Briton 1110.SES door closer adjustable
size 2-4 Silver FH FD120*¹ DCL0012
Stainless Steel fingerplate 15” x 3” UK FH DFU0095
Polished Stainless Steel Fingerplate 12” x 3” UK FH DFU0145
Aluminium Fingerplate 12” x 3” UK FH DFU0107
SAA Kickplate 30” H150mm x L762mm UK FH DFU0157
SAA Kickplate 33” H150mm x L838mm UK FH DFU0106
Door closers
Door closers are an important link in the control of fire and
smoke and their usage can help save lives.
All Howdens door closers meet BS EN1154, which is the
required standard to attain CE marking for controlled door
closing devices.
Handles & accessories
*Not fire rated when fitted with parallel fixing plate *¹Not FD120 if power size 2 setting is used, minimum power size 3 setting required
10 10 yearguarantee
10 10 yearguarantee
10 10 yearguarantee
1010 yearoperationalwarranty
Cadeby Chrome Effect FH DFU0835
H52mm x W52mm x D9mmFD30/FD60
Stainless Steel concealed fixing 12” FH DFU0136 FD30/FD60
• Silver finish with matching arm• Supplied with parallel fixing plate• Suitable for low usage
• Silver finish with matching arm• Supplied with parallel fixing plate• Suitable for low usage
• Supplied with parallel fixing plate• Suitable for medium usage
|207
EB - Electro Brass
NP - Nickel Plated
Self closing door hinge packs
Concealed door closer
Door closers
Digital door lock
Digital door locks offer a convenient method for allowing access
to authorised-only users.
• Light duty• Internal use• Non-handed • 14 digit key pad• Tubular latch mechanism• Optional holdback mechanism• 60mm backset
10 10 yearguarantee
1 yearguarantee
Suitable for low usage
Briton 121 CE.SES door closer fixed size 3 Silver FH FD120 DCL0001
Parallel fixing plate for DCL0001 DCL0061
See pages 229-232 for the full range of hinges
FD30/FD60
FD30/FD60
4” Satin Stainless Steel (pack of 3) FH HNG0430
Briton digital door lock Satin SCF0241
Concealed closer EB FH DCL0002
Concealed closer NP FH DCL0022
Eclipse 73 door closer fixed size 3 Silver FH FD120*¹ DCL0019
Suitable for low to high usage
10 10 yearguarantee
Commercial door furniture
EB Stainless Steel self closing door hinge
Brass concealed door closer
Briton Satin digital door lock
208|
Briton security push pad FH SCF0081
Briton outside access device - lever FH SCF0074
Panic hardware
On January 1st 2010, it became mandatory for all exit devices
to comply with the latest revisions of BS EN 1125: 2008,
BS EN 179: 2008 and CE Marking.
BS EN 1125: 2008 - Applies to PANIC APPLICATIONS where the
exit door is used by the public and provides safe and effective
escape through the doorway with minimum effort, and without
prior knowledge of operation.
BS EN 179: 2008 - Applies to EMERGENCY APPLICATIONS
where the exit door is used by people who “are familiar with the
emergency exit and its hardware, and therefore a panic situation
is unlikely to occur”.
This product is for use on the exterior surface in conjunction with panic hardware
5 5 yearguarantee
5 5 yearguarantee
Suitable for doors up to H2500mm x W1300mm. Pack includes signage
5 5 yearguarantee
Briton double rebated panic set FH SCF0076
FD30/FD60
Briton single panic bolt FH SCF0078
Suitable for doors up to H2500mm x W1300mm. Pack includes signage
5 5 yearguarantee
FD30/FD60
Briton rim panic latch FH SCF0077
Suitable for doors up to H2500mm x W1300mm. Pack includes signage
5 5 yearguarantee
FD30/FD60
FD30/FD60
FD30/FD60
Commercial door furniture
Briton single panic bolt
Briton security push pad
Briton double rebated panic set
|209
Signage
All signage is 75mm diameter and polished stainless steel.
Push UK FH GIR0090
Pull UK FH GIR0091
Ladies (emblem) UK FH GIR0094
Gents (emblem) UK FH GIR0095
Accessible (emblem) UK FH GIR0096
Fire Door Keep Locked UK FH GIR0092
Fire Door Keep Shut UK FH GIR0093
Commercial door furniture
Fire Door Keep Shut Polished Stainless Steel
door sign
Ladies Polished Stainless Steel door sign
Push Polished Stainless Steel door sign
210|
Door security
As the door is the most obvious
way into a property, it is the first
place a thief will try. If a door is not
securely locked, a burglar can either
kick or lever it open very easily. It is
therefore essential that all external
doors are protected securely with a
high quality lock, which is embedded
into the door for extra strength.
Howdens supplies a variety of
options for making homes and
commercial properties secure.
These include a range of locks and
deadlocks, nightlatches, security
bolts, door chains and viewers, all
complying with insurance guidelines
and British Standards as necessary.
Door Security
Fire Regulations:
FD Fire doorsFH Essential fire door hardwareFH Non-essential fire door hardware
Building Regulations:
E Part E doors - sound reducingL Part L doors - warmth and insulation suitable for new buildL Part L doors - warmth and insulation suitable for refurbishment projectsM Part M doors - mobility and access
|211
Choose the right type of latch/lock
Choosing the right type of latch/lock
Tubular mortice latches
A tubular mortice latch can be used in conjunction with either
latch, rose or knob handles. Bolt through and Quick-Fit options
are available.
Bathroom bolts
Bathroom bolts are operated by a bathroom turn and allow
flexibility when fitting a separate rose or knob handle with latch.
Quick-Fit options are available.
Bathroom locks
Bathroom locks are based on a 3 lever lock case, with a deadbolt
operated by a bathroom turn instead of a key.
Sashlocks
Sashlocks have a deadbolt, latch and a key, and can be operated
from both sides of the door. Sashlocks are suitable for use with
lock handles or a rose handle/mortice knob and an escutcheon.
Deadlocks
Deadlocks have a deadbolt and a key only, and can be operated
from both sides of the door. Deadlocks are often used in
conjunction with a nightlatch, to increase security.
Traditional nightlatches
Are mounted on the surface of the door and are a simple method
of opening external doors, where key access is not required on the
inside. Ideal for use on entrance doors in multi-residential dwellings.
Double locking nightlatches
Automatically deadlock when the door is closed. The inside
handle can be deadlocked by a turn of the key from the inside,
making them ideal for glass panelled doors.
Digital door locks
Digital door locks offer a convenient method for allowing access
to authorised-only users.
Euro/oval profile cylinder locks
Are thumbturn operated and ideal for locations that require
controlled access from one direction and easy access from the other
or as a double cylinder which operates with a key on both sides.
Rebate kits
Use when fitting either a mortice sashlock or deadlock to a
pair of doors with rebated meeting stiles (i.e. the doors overlap
when closed).
Rim locks
A basic deadbolt used for locking sheds, outhouses and similar
applications.
212|
Door security
55 yearoperationalwarranty
55 yearoperationalwarranty
Premium tubular mortice latch 2½” PB/PSS FH LAL0075*
Premium tubular mortice latch 3” PB/PSS FH LAL0076*
Tubular mortice latch 2½” EB LAL0235
Tubular mortice latch 2½” NP LAL0236
Tubular mortice latch 3” EB LAL0237
Tubular mortice latch 3” NP LAL0238
Tubular mortice latch 95mm EB LAL0040*¹
Tubular mortice latch 95mm NP LAL0041*¹
Bolt through tubular latch 2½” EB/CP LAL0078
Bolt through tubular latch 3” EB/CP LAL0077
Quick-Fit latch 60mm CP NEW LAL0863
Quick-Fit latch 60mm NP NEW LAL0864
Quick-Fit latch 70mm CP LAL0860
Quick-Fit latch 70mm NP LAL0861
Quick-Fit latch 70mm BN LAL0862
Tubular mortice latches
Tubular mortice latches can be used in conjunction with either
latch, rose or knob handles.
PB - Polished Brass
PSS - Polished Stainless Steel
EB - Electro Brass
NP - Nickel Plated
CP - Chrome Plated
BN - Black Nickel
*Suitable for use with bolt through fixings
*1CE marked
FD30/FD60
Quick-Fit latch
Premium tubular mortice latch
Tubular mortice latch
|213
Door security
Bathroom bolts & locks
Bathroom bolts are operated by a bathroom turn and allow
flexibility when fitting a separate rose or knob handle with a
latch.
Bathroom bolts
Bathroom locks
Bathroom locks are based on a 3 lever lock case, with a
deadbolt operated by a bathroom turn instead of a key.
SSS - Satin Stainless Steel
EB - Electro Brass
NP - Nickel Plated
CP - Chrome Plated
SCP - Satin Chrome Plated
BN - Black Nickel
MB - Matt Black
55 yearoperationalwarranty
55 yearoperationalwarranty
FD30/FD60
Bathroom bolt with dual striking plate 2½” SSS FH LAL0127
Bathroom bolt with dual striking plate 3” EB/NP FH LAL0130
Bathroom Bolt with dual striking plate 3” BN/MB LAL0250
Quick-Fit bathroom bolt 70mm CP LAL0128
Quick-Fit bathroom bolt 70mm NP LAL0129
Quick-Fit bathroom bolt 70mm BN LAL0126
Mortice sashlock 2½” EB LAL0241
Mortice sashlock 2½” CP LAL0242
Mortice sashlock 3” EB LAL0243
Mortice sashlock 3” CP LAL0244
Bathroom bolt with dual striking plate
Bathroom mortice sashlock
Quick-Fit bathroom bolt
214|
5 Lever mortice sashlock
British Standard 5 lever Union mortice sashlock
3 Lever mortice sashlock
Door security
Sashlocks
Sashlocks have a deadbolt, a latch and a key, and can be
operated from both sides of the door. Sashlocks are suitable
for use with lock handles or a rose handle/mortice knob and
an escutcheon.
3 Lever locks
3 lever locks are a basic type of mortice lock, that is ideal for
securing internal doors. The locks have 100 key patterns -
at least 100 different key patterns must be made before any
key pattern can be used again.
5 Lever locks
5 lever locks are a more secure option than the 3 lever version.
The locks have 500 key patterns - at least 500 different key
patterns must be made before any key pattern can be used again.
British Standard 5 lever locks
The BS approved 5 lever locks are the most secure option.
The locks have 1000 key patterns - at least 1000 different
key patterns must be made before any key pattern can be
used again.
For external use
Hardened steel rollers
False notching to prevent picking
Fittings supplied
2 keys supplied
For external use
False notching to prevent picking
Anti-drill/saw deadbolt
Anti-drill lockcase
Fittings supplied
2 keys supplied
Fittings supplied
2 keys supplied
55 yearoperationalwarranty
10 10 yearguarantee
10 10 yearguarantee
FD30/FD60
Mortice sashlock 2½” EB LAL0231
Mortice sashlock 2½” CP LAL0232
Mortice sashlock 3” EB LAL0233
Mortice sashlock 3” CP LAL0234
Mortice Sashlock 2½” EB LAL0003
Mortice Sashlock 2½” SCP LAL0033
Mortice sashlock 3” SCP LAL0086
Union StrongBOLT mortice sashlock BS 2½” EB FH LAL0042
Union StrongBOLT mortice sashlock BS 3” EB FH LAL0043
Union StrongBOLT mortice sashlock BS 2½” SCP FH LAL0044
Union StrongBOLT mortice sashlock BS 3” SCP FH LAL0045
|215
5 5 yearguarantee
ERA mortice deadlock 2½” EB LAL0038
ERA mortice deadlock 2½” SCP LAL0039
ERA mortice deadlock 2½” EB LAL0007
ERA mortice deadlock 2½” SCP LAL0034
ERA mortice deadlock 3” SCP LAL0035
Union mortice deadlock BS 3” SCP FH LAL0087
Union StrongBOLT mortice deadlock BS 2½” EB FH LAL0046
Union StrongBOLT mortice deadlock BS 2½” SCP FH LAL0047
Deadlocks
Deadlocks have a deadbolt and a key only, and can be operated
from both sides of the door. Deadlocks are often used in
conjunction with a nightlatch, to increase security.
3 Lever locks
3 lever locks are a basic type of mortice lock, that is ideal for
securing internal doors. The locks have 100 key patterns - at
least 100 different key patterns must be made before any key
pattern can be used again.
5 Lever locks
5 lever locks are a more secure option than the 3 lever version.
The locks have 500 key patterns - at least 500 different key
patterns must be made before any key pattern can be used
again.
British Standard 5 lever locks
The BS approved 5 lever locks are the most secure option.
The locks have 1000 key patterns - at least 1000 different key
patterns must be made before any key pattern can be used again.
Fittings supplied
2 keys supplied
Fittings supplied
2 keys supplied
For external use
Hardened Steel rollers
Anti-drill lockcase
Fittings supplied
2 keys supplied
For external use
False notching to prevent picking
Anti-drill/saw deadbolt
EB - Electro Brass
SCP - Satin Chrome Plated
10 10 yearguarantee
10 10 yearguarantee
FD30/FD60
Door security
Union British Standard 5 lever mortice deadlock
ERA 5 lever mortice deadlock
ERA 3 lever mortice deadlock
216|
Economy Brass cylinder nightlatch
Yale 88 Grey case cylinder nightlatch
Yale 81 Rollerbolt nightlatch
Door security
Traditional nightlatches
Are mounted on the surface of the door and are a simple
method of opening external doors, where key access is not
required on the inside. Ideal for use on entrance doors in
multi-residential dwellings.
Latch can be deadlocked from the inside only.
Latch can be deadlocked from the inside only.
Latch can be deadlocked from the inside only.
*Backset is the measurement from the edge of the door to the centre of
the key hole.
2 yearguarantee
2 yearguarantee
2 yearguarantee
2 yearguarantee
Yale 81 Rollerbolt nightlatch (60mm backset)* LAL0509
Yale 85 Grey case/Brass cylinder (40mm backset)* LAL0503
Yale 89 Grey Case/Brass cylinder (60mm backset)* LAL0505
Latch can be deadlocked from the inside and outside.
Yale 84 Grey case/Brass cylinder (40mm backset)* LAL0502
Yale 88 Grey case/Brass cylinder (60mm backset)* LAL0504
Yale 77 Brass cylinder (60mm backset)* LAL0500
ERA Green case/Brass cylinder (60mm backset)* LAL0050
Economy Brass cylinder (60mm backset)* LAL0053
ERA replacement rim Brass cylinder LAL0063
ERA replacement rim Chrome cylinder LAL0067
ERA replacement rim Satin cylinder LAL0064
|217
10 10 yearguarantee
10 10 yearguarantee
(40mm backset)* LAL0510
(60mm backset)* LAL0511
Euro/oval cylinder sashlock case 2½” Satin LAL0220
Euro/oval cylinder sashlock case 3” Satin LAL0221
Euro/oval cylinder deadlock case 2½” Satin LAL0222
Euro/oval profile cylinder deadlock case 3” Satin LAL0230
Yale BS anti snap and anti bump Euro profile double cylinder CP*¹*² LAL0090
ERA Euro profile cylinder and thumbturn Satin*² LAL0226
ERA oval profile cylinder and thumbturn Satin LAL0229
ERA double locking nightlatch Brass case and cylinder
(40mm backset)* LAL0052
ERA double locking nightlatch Brass case and cylinder
(60mm backset)* LAL0062
ERA double locking nightlatch Chrome case and cylinder
(40mm backset)* LAL0065
ERA double locking nightlatch Chrome case and cylinder
(60mm backset)* LAL0066
ERA double locking nightlatch Satin Nickel case and cylinder
(40mm backset)* LAL0072
ERA double locking nightlatch Satin Nickel case and cylinder
(60mm backset)* LAL0073
Euro/oval profile cylinder locks
Available as double cylinder or cylinder and thumbturn.
Double locking nightlatches
Automatically deadlock when the door is closed. The inside
handle can be deadlocked by a turn of the key from the inside,
making them ideal for glass panelled doors.
Euro/oval profile cylinder lock cases
Are a mortice lock offering total versatility. They are ideal for
commercial premises.
*1 Ensures controlled access from both sides of the door.
*2 2 Euro profile escutcheons available DFU0203 and DFU0212.
ERA Euro profile double cylinder Satin*¹*² LAL0200
ERA BS locking nightlatch Chrome case and cylinder
Door security
Yale BS Euro profile cylinder
ERA BS Chrome double locking nightlatch
ERA Brass double locking nightlatch
218|
Deadlock Black rim lock
EB Latch rebate kit
Briton Satin digital door lock
Door security
1 yearguarantee
Latch rebate kit for LAL0235/0237/0245 EB LAL0239
Latch rebate kit for LAL0236/0238/0246 NP LAL0240
Sashlock rebate Kit for LAL0003 EB LAL0032
Sashlock Union BS rebate kit for LAL0042/LAL0043 EB LAL0048
Sashlock Union BS rebate kit for LAL0044/LAL0045 SCP LAL0049
Deadlock 4” Black LAL0011
Sashlock 5” Grey LAL0023
Briton digital door lock Satin SCF0241
Rebate kits
Use when fitting either a mortice latch or sashlock to a
pair of doors with rebated meeting stiles (i.e. the doors overlap
when closed).
Rim locks
A basic deadbolt used for locking sheds, outhouses and similar
applications.
EB - Electro Brass
NP - Nickel Plated
SCP - Satin Chrome Plated
Digital door lock
Digital door locks offer a convenient method for allowing access
to authorised-only users.
• Light duty• Internal use• Non-handed • 14 digit key pad• Tubular latch mechanism• Optional holdback mechanism• 60mm backset
|219
Brass door chain SCF0005
Chrome door chain SCF0008
Brass door security bolt twin pack (2 bolts, 1 key) SCF0321
Satin door security bolt twin pack (2 bolts, 1 key) SCF0322
Door security bolt key SCF0001
Security fittings
Chrome door viewer SCF0009
Length adjustable dependent on the door thicknessPrecision optical glass viewer with 120o viewing angle
Brass door viewer SCF0007
Length adjustable dependent on the door thicknessPrecision optical glass viewer with 120o viewing angle
H40mm x W40mmChain L210mm
H40mm x W40mmChain L210mm
L35mm-45mm x H15mm
L35mm-45mm x H15mm
Door security
Brass door security bolt
Chrome door viewer
Brass door chain
220|
BJP – Black Japanned
Gate furniture
BJP Ring Gate Latch LAL0132
Black safety hasp and staple 4½” SCF0101
Galvanised safety hasp and staple 4½” SCF0121
ERA Brass padlock 50mm SCF0204
Door security
Black safety hasp and staple
ERA Brass padlock
Black Japanned ring gate latch
|221
Fire rated hardware
All the specialist fire rated hardware we offer has been tested to meet all relevant fire regulations. Please always
remember to consult a qualified building inspector for exact fire door accessory requirements.
Door closersA legal requirement when fitting any fire door, door closers ensure the door is closed and latched when not in
use to prevent fire from spreading. All our overhead door closers come with a 10 year manufacturer’s guarantee.
Fire door hinges Essential in ensuring the integrity of the fire door is not compromised during an emergency, all our graded hinges
are fire rated. Our wide range of graded hinges suit every application, from heavy commercial to light domestic
use. It is recommended a minimum of 3 hinges are used when installing a fire door, with the grade of hinge
dictated by the weight of the fire door being fitted. See page 230 for a simple hinge grade calculator.
Fire rated door framesA comprehensive range of fire rated door
frames are available to view on page 131.
Fire rated expanding foam Quick-setting, fire rated expanding foam
expands on application to fill small holes
or gaps. Once set, it can provide up to
4 hours fire resistance in linear joints
and help to control the spread of fire.
GIR0088 Everbuild hand held B1 fire
rated expanding foam 750ml can be
found on page 133.
SignageCrucial in directing users to fire exits
in the event of an emergency, signage
ensures awareness of safety procedures
at all times. Find our comprehensive
range of commercial signage on
page 210.
Fire rated handles We have several fire rated handles that
have a higher melting point to ensure the
integrity of the handle is not compromised
in the event of a fire. They are fire rated for
up to 60 minutes and suitable for use with
all our fire doors. These can be identified
by the FH logos and FD30/FD60 labels.
See page 267.
Fire rated latches Help to prevent the spread of fire by ensuring the door remains closed in its frame in the event of a fire.
We offer 2½" and 3" premium tubular mortice latches and BS 5 lever sashlocks and deadlocks, all of which are
fire rated for up to 60 minutes. See pages 213, 215 and 216.
Intumescent door seals & hinge pads Our intumescent products react to heat in the event of a fire and seal the door to help prevent the spread of fire
and smoke. Intumescent products can be found on page 133.
For a full list of Howdens fire rated products, please go to pages 267 - 269.
Page 267
Fire rated
handles
Page 133
Intumescent
door seal
Fire rated hardware
Page 210
Signage
Pages 207 - 208
Door closers
Pages 230 -231
Fire door hinges
Page 131
Fire rated
door frames
222|
HardwareAn illustrated technical guide
Door closers
In order to help us recommend the best door closer for your needs, please make sure you know your door
width, height, location, usage, fire door requirements and whether it is push or pull mounted.
Light dutyDomestic, light commercial
2,000 – 100,000 cycles each year, 60kg
Medium duty Offices, apartment blocks
5,000 – 500,000 cycles each year, 80kg
Heavy dutyOpen plan offices, public buildings, department stores
100,000 – 1,500,000 cycles each year, 120kg
Door closer weight calculator
When a door closer or ironmongery is added to a door this has a disproportionate effect on the
calculated door weight. It is essential this calculated weight is taken into account when choosing hinges
and door closers, and NOT the original door weight alone. To calculate your correct door weight: Add 20% for fitting a door closer and ironmongery or add 75% if the door closer requires a
backcheck function Add 10% for heavy use doors (i.e. corridors in public buildings) Reduce by 10% for light use doors (i.e. internal office doors)
For example – 35kg fire door fitted with DCL0007 door closer in a busy public corridor:
20% added for closer (7kg) + 15% added for heavy use (5.2kg) = correct weight is 47.2kg.
All door closers can be found on page 207-208.
Draught excluders
Draught proofing is one of the most inexpensive and effective energy efficiency measures for any size
of building - yet it is often overlooked. A 5mm gap, commonly found under a domestic door, can let
through 80m3 of cold air per hour.
We offer a wide selection of draught excluders suitable for both commercial and residential properties.
All draught excluders can be found on pages 202-203.
Mobility weather bar kitBase of door
Draught
excluder
Doorstep Weather deflecting end caps
Hardware
DraDraDraDraDraDrDrDDrD aDDDrDDDDDDDrDDDD ughughughughu t t tt
excexcexcexexcexcee ludludludddludluddereerereeere
DDDDD ttt WWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWW ththth dddd flflflflfl tititiititttt ggg dddd
|223
Tubular mortice latches
Use a tubular mortice latch where a simple door catch function is required.
Sashlocks
Use a sashlock where both a latch and key locking mechanism are required.
General domestic and commercial use
Standard tubular mortice latches can be used on
internal doors in general domestic applications.
They can be used in conjunction with lever handles.
Premium tubular mortice latches are also available as
an alternative, which are suitable for high traffic and
commercial areas.
For more rigid handle fixings
Bolt through tubular mortice latches can be used on
internal doors where the bolt through fixings provided
with the handle are used for rigidity. Holes in the latch
allow the bolts to pass through it to fix either side of
the door.
All tubular mortice latches can be found on page 213.
Highest security
Ideal for external doors requiring the highest levels
of security, the British Standard 5 lever locks are
manufactured to BS standards and can withstand
drilling or sawing of the deadbolt and the lockcase.
5 lever mortice lock
Striking
plate
Bolt
Face plate
Lever handle components
Handle
Screw
Striking plates provided in both Electro Brass
and Chrome Plated finishes
Latch
Striking
plate
Face plate
Medium security
The 5 lever locks are ideal for internal & external
doors that require substantial security. Manufactured
with hardened steel rollers within the bolt to withstand
sawing.
Low level security
More suited to internal doors or external doors that
only require minimal security the 3 lever locks offer a
basic key locking mechanism.
All sashlocks can be found on page 215.
Hardware
nHanHanHananandledledledledleddd
crcrcrcrcrcc ewewewewweewwwwwwLatLatLatLatLata chchchchch
StrStrStrSStrStrikikiiikki
plaplaplapplaplaplalap tetettete
FacFacFFacFacFaFFaa e pe pe pe pe pee e latlatatlatlatatatateeeeeee
ng ng ng ngngngngnggnnnnnnnngn
BolBolBolBo tttt
FacFacFacFacacce pe pe pe pe pe ppplatlatlatlatateeeeee
224|
Hardware
5 Minsor less
to fit
Quick-Fit handle LAL packs & jig
Reduce installation time with the Quick-Fit handle jig. Sold in latch packs consisting of a Quick-Fit
handle, Quick-Fit latch and standard hinges. When fitted with the Quick-Fit handle jig pack, the
overall fitting time can be reduced from 25 minutes down to 5 minutes.
Quick-Fit handle jig
The lever mechanism within the cylinder is more complex
and offers increased levels of security to 3 and 5 lever
mortice sashlocks.
Available in Euro or oval profiles, the double cylinder locks
allow key controlled access from both sides of the door.
Cylinder locks are often chosen for premises where regular
lock replacement is required. The cylinder locks available
from Howdens are for timber doors. Of those offered, the
Yale BS Euro profile double cylinder provides the highest
level of security with anti-snap, anti-bump, anti-drill and
anti-pick features.
All Euro/oval profile cylinder locks can be found on
page 218.
Euro/oval profile cylinder locks
Often used on commercial or multi-tenant properties, cylinder locks offer versatility, functionality
and security.
Face plate Strike plate
Latch
Bolt
LatLatLaLatLatLatLLLLatLatLLL chchchchchch
|225
Slipfix stairpart connectors
The Slipfix stairpart connector kits are a fast and simple solution to make fitting a staircase a one-
man job. There are three connectors that secure the different stairparts; the newel post, the angled
handrail and the straight handrail.
Straight Slipfix kit
For fitting a straight handrail between two newel posts.
Angled Slipfix kit
For fitting an angled handrail between the bottom and
top newel posts.
Newel post fastener
For securely fitting a newel post into a wood or concrete
base.
All Slipfix stairpart connectors can be found on page 235.Connectors
Quick-Fit latch
The Quick-Fit latch is a simple and clever latch which can be installed in less than 5 minutes without
the need for chiselling. They can be used in conjunction with all lever handles (latch, rose, knob and
privacy). Quick-Fit bathroom bolts are also available and can be found on page 214.
Radius hinges
Radius hinges are an alternative to standard square corner hinges. Their round corners allow doors to
be routered with the use of a jig (TLS0667) instead of chiselled, saving approximately 20 minutes per
door set for the builder.
Quick-Fit latch
Standard striking plate Standard latch
Quick-Fit striking plate5 Mins
or less
to fit
10 Minsor less
to fit
Hardware226|
Fixings
Howdens has a selection of fixings
for every job, including hinges,
shelving and brackets, catches,
worktop accessories and screws.
Our range covers both commercial
and domestic settings.
Fixings
Fire Regulations:
FD Fire doorsFH Essential fire door hardwareFH Non-essential fire door hardware
Building Regulations:
E Part E doors - sound reducingL Part L doors - warmth and insulation suitable for new buildL Part L doors - warmth and insulation suitable for refurbishment projectsM Part M doors - mobility and access
|227
Choose the right hinge
Choosing the right type of hinge
Butt hinges
Butt hinges are basic general purpose hinges, mainly used for
hanging standard doors in low use, domestic applications.
Graded hinges
All our graded hinges are fire rated. Suitable for commercial
applications, typically used on fire doors and heavier standard
doors.
Self closing hinges
Self closing hinges are suitable for commercial applications on
standard or fire doors up to 40kg where controlled door closing is
not required.
Flush hinges
Flush hinges can be used for hanging lightweight internal and
cupboard doors.
Parliament hinges
Parliament hinges are used to hang double doors between two
rooms where doors need to hinge 180° past the lining/casing.
Tee hinges
Tee hinges can be used internally and externally to hang standard
doors, shed doors and gates. The hinge leaf should be 1/3 -1/2 of
the width of the door or gate.
Hooks and bands
Hooks and bands are used to hang large gates and garage doors.
Piano hinges
Piano hinges are used internally, traditionally for cabinet work.
228|
Fixings
Chrome Plated Brass DPBW hinge
Zinc Plated Steel Pattern 5050 hinge
EB Steel Pattern 1838 hinge
6” ZP Sherardized Steel butt hinge (Pattern 5050) HNG0015
3” BK Steel butt hinge (Pattern 1838) HNG0056
3” CP Steel butt hinge (Pattern 1838) HNG0017
3” EB Steel butt hinge (Pattern 1838) HNG0003
3” SC Steel butt hinge (Pattern 1838) HNG0001
3” SN Steel butt hinge (Pattern 1838) HNG0023
3” ZP Steel butt hinge (Pattern 1838) HNG0019
4” BK Steel butt hinge (Pattern 1838) HNG0057
4” CP Steel butt hinge (Pattern 1838) HNG0018
4” EB Steel butt hinge (Pattern 1838) HNG0004
4” SC Steel butt hinge (Pattern 1838) HNG0002
4” SN Steel butt hinge (Pattern 1838) HNG0024
4” ZP Steel butt hinge (Pattern 1838) HNG0014
4” SC Steel butt hinge (Pattern 451) HNG0020
4” ZP Steel butt hinge (Pattern 451) HNG0021
3” EB Steel loose pin butt hinge (Pattern 1840) HNG0007
3” SC Steel loose pin butt hinge (Pattern 1840) HNG0005
3” PB Brass DSW hinge HNG0042
3” SC Brass DSW hinge HNG0046
4” PB Brass DSW hinge HNG0043
3” CP Brass DPBW hinge HNG0061
3” PB Brass DPBW hinge HNG0048
4” CP Brass DPBW hinge HNG0060
Hinges
Sold as single units unless otherwise stated.
Butt hinges Butt hinges are basic general purpose hinges, mainly used for
hanging standard doors in low use, domestic applications.
EB - Electro Brass
SC - Self Coloured
ZP - Zinc Plated
CP - Chrome Plated
BN - Black Nickel
3” CP Steel HNG3033
Ball bearing
Pattern 451 Not supplied with fixings
Pattern 1840 - loose pin Not supplied with fixings
Pattern 5050 Not supplied with fixings
Double Steel washered
Double Phosphor Bronze washered
Pattern 1838Not supplied with fixings
PB - Polished Brass
DPBW - Double Phosphor Bronze Washered
SN - Satin Nickel
BK - Black
|229
Fixings
Satin Stainless Steel washered butt hinge grade 7
Satin Chrome Steel ball bearing butt hinge grade 11
Black Nickel Stainless Steel ball bearing butt hinge grade 7
Graded butt hingesAll our graded hinges are fire rated. Suitable for commercial
applications, typically used on fire doors and heavier standard
doors. All are CE marked.
3” EB Stainless Steel FH FD30 HNG0111
3” Polished Stainless Steel FH FD30 HNG0161
3” Stainless Steel FH FD30 HNG0068
4” EB Stainless Steel FH FD30/FD60 HNG0112
4” Polished Stainless Steel FH FD30/FD60 HNG0160
4” Satin Stainless Steel FH FD30/FD60 HNG0069
Grade 7 - washered
3” BN Stainless Steel FH FD30 HNG0372
3” EB Stainless Steel FH FD30 HNG0371
3” Polished Stainless Steel FH FD30 HNG0085
3” Satin Stainless Steel FH FD30 HNG0370
Grade 7 - ball bearing
4” EB Stainless Steel FH FD30/FD60 HNG0065
4” Satin Stainless Steel FH FD30/FD60 HNG0066
Grade 13 - ball bearing
4” EB Stainless Steel FH FD30/FD60 HNG0027
4” Polished Stainless Steel FH FD30/FD60 HNG0086
4” Satin Chrome Steel FH FD30/FD60 HNG0029
4” Satin Stainless Steel FH FD30/FD60 HNG0025
Grade 11 - ball bearing
Graded hinges have different specifications dependent on the
grade that is achieved in testing. It is important to understand
the differences in specification when selecting the hinge to
ensure it is compatible with the door and other hardware being
fitted; ensuring the door does not sag and operates smoothly.
Please see the table and other guidance information below to
select the correct hinge grade for the door mass:
Door closers increase the loading on hinges and the rate at
which they wear.
Door closers without a backcheck increase the door mass by
20%* while door closers with a backcheck increase the door
mass by 75%*1.
Hinges should be selected according to the total mass; actual
door mass plus the mass added by the door closer.
It is recommended that three hinges are used on timber doors
when fitting with a door closer.
*Add 20% to the mass of the actual door
*1Add 75% to the mass of the actual door
Grade Door Mass (kg)
7 40
11 80
13 120
230|
Electro Brass Steel flush hinge
Chrome Plated Steel loose pin hurlinge
Chrome Plated Brass parliament hinge
Fixings
Radius graded ball bearing hinges
Not supplied with fixings
EB - Electro Brass CP - Chrome Plated
PB - Polished Brass NP - Nickel Plated
3” Polished Stainless Steel Grade 7 FH FD30/FD60 HNG0077
3” Satin Stainless Steel Grade 7 FH FD30/FD60 HNG0076
4” Satin Chrome Steel Grade 11 FH FD30/FD60 HNG0078
4” Satin Stainless Steel Grade 13 FH FD30/FD60 HNG0079
Self closing door hinge packsSelf closing hinges are suitable for commercial applications on
standard or fire doors up to 40kg where controlled door closing
is not required. All are CE marked.
4” Satin Stainless Steel (pack of 3) FH FD30/FD60 HNG0430
Intumescent hinge padsRecommended for use when fitting fire door hinges.
Please refer to page 133 for full range of intumescent accessories.
4” Intumescent hinge pads (pack of 6) UK FH FD30/FD60 ITS0030
Not supplied with fixings
Flush hingesFlush hinges can be used for hanging lightweight internal and
cupboard doors.
2” CP Steel flush hinge HNG0096
2” EB Steel flush hinge HNG0053
3” CP Steel flush hinge HNG0097
3” EB Steel flush hinge HNG0054
Not supplied with fixings
Flush hinges - loose pin hurlinge
3” CP Steel loose pin hurlinge hinge HNG0382
3” EB Steel loose pin hurlinge hinge HNG0352
4” CP Steel loose pin hurlinge hinge HNG0392
4” EB Steel loose pin hurlinge hinge HNG0362
Radius hinge jig UK TLS0667
Parliament hingesParliament hinges are used to hang double doors between two
rooms where doors need to hinge 180° past the lining/casing.
4” CP Brass parliament hinge HNG0098
4” PB Brass parliament hinge HNG0071
|231
Fixings
1¼” x 6’0” NP Steel piano hinge HNG0204
11” Antique Black HNG0022
16” Galvanised Steel HNG0101
Coach bolt and nut M12 x 75mm NAB0002
12” Black Japanned Steel HNG0104
14” Black Japanned Steel HNG0108
16” Black Japanned Steel HNG0103
18” Black Japanned Steel HNG0109
24” Galvanised steel hook and band HNG0110
Paintable with metal primer and metal paint.
Tee hingesTee hinges can be used internally and externally to hang
standard doors, shed doors and gates. The hinge leaf should be 1/3 - 1/2 of the width of the door or gate.
Hooks & bandsHooks and bands are used to hang large gates and garage doors.
Piano hingesPiano hinges are used internally, traditionally for cabinet work.
Antique Black tee hinge
Nickel Plated Steel piano hinge
Galvanised Steel hook and band
232|
Fixings
Ball catch
Brass handrail bracket
Braking castor
Projection 63mm
Brass SAB0055
Projection 63mm
Chrome SAB0056
Projection 76mm
Stainless Steel SAB0053
Projection 63mm
White SAB0051
Ball catch ¾” EB GIR0007
Adjustable roller catch EB GIR0018
Adjustable roller catch NP GIR0019
Brown magnetic catch GIR0331
White magnetic catch GIR0330
Chrome finish cabinet lock GIR0308
Double roller catch BZP GIR0311
Magnetic cupboard lock UK HYH1702
50mm braking castors (pack of 2) HKC0017
50mm non-braking castors (pack of 2) HKC0018
EB - Electro Brass
NP - Nickel Plated
BZP - Bright Zinc Plated
Catches & castors
Catches
Handrail brackets
Castors
|233
Aluminium end cap
Aluminium T-bar joint strip
Corner brace
Fixings
Table Stretcher Plate Self Coloured Steel SAB0010
Corner plate 324 Pattern Self Coloured Steel SAB0030
Aluminium 28mm (8mm radius) UK GIR0031
Aluminium 38mm (3mm radius) UK GIR0128
Aluminium 38mm (6mm/8mm radius) UK HYH2515
Aluminium 38mm square edge UK GIR0129
Black 28mm (8mm radius) UK GIR0032
Black 38mm (3mm radius) UK GIR0113
Black 38mm (6mm/8mm radius) UK GIR0119
Black 38mm square edge UK GIR0114
Chrome Effect 38mm (6mm/8mm radius) UK HYH2506
Adjustable worktop bracket (pack of 1) UK GIR0053
End caps
Aluminium 28mm (8mm radius) UK GIR0125
Aluminium 38mm (3mm radius) UK GIR0126
Black 38mm (3mm radius) UK GIR0111
Black 38mm (6mm/8mm radius) UK GIR0117
Matt Silver Effect 38mm (6mm/8mm radius) UK GIR0110
T-bar joint strips
Aluminium 28mm (8mm radius) UK GIR0033
Aluminium 38mm (3mm radius) UK GIR0127
Aluminium 38mm (6mm/8mm radius) UK HYH2510
Black 28mm (6mm/8mm radius) UK GIR0034
Black 38mm (3mm radius) UK GIR0112
Black 38mm (6mm/8mm radius) UK GIR0118
Chrome Effect 38mm (6mm/8mm radius) UK HYH2505
Joint strips
Worktop accessories
Standard GIR0020
Slim GIR0029Easibolt UK GIR0025
Zipbolt GIR0026
Zip bolt Allen bit TLS0476
Connecting bolts
Corner brace & mending plates
1” SAB0003
2” SAB0004
3” SAB0001
Corner brace 319 Pattern Self Coloured Steel
3” SAB0020
4” SAB0021
6” SAB0022
Mending plate Self Coloured Steel
234|
Newel post fastener GIR0522
3mm x 12mm SCW0523
3mm x 16mm SCW0451
3.5mm x 20mm SCW0452
3.5mm x 25mm SCW0453
3.5mm x 30mm SCW0454
4mm x 25mm SCW0455
4mm x 30mm SCW0456
4mm x 35mm SCW0457
4mm x 40mm SCW0458
4mm x 50mm SCW0459
4mm x 60mm SCW0475
4.5mm x 30mm SCW0460
4.5mm x 40mm SCW0461
4.5mm x 50mm SCW0462
4.5mm x 70mm SCW0474
4.5mm x 80mm SCW0473
5mm x 30mm SCW0463
5mm x 40mm SCW0464
5mm x 50mm SCW0465
5mm x 60mm SCW0466
5mm x 70mm SCW0467
5mm x 80mm SCW0468
5mm x 100mm SCW0469
6mm x 50mm SCW0470
6mm x 100mm SCW0472
6mm x 80mm SCW0471
Screws and anchors
Woodscrews - Reisser R2 single thread Yellow
passivated hardened steel (Box of 200)
4mm x 30mm SCW0476
4mm x 40mm SCW0477
4mm x 50mm SCW0478
5mm x 80mm SCW0479
Woodscrews - Reisser R2 single thread Yellow passivated
hardened steel (Large tubs)
Angled Slipfix kit GIR0520 Set includes 2 fixings, screws, 5mm hex driver bit and 5mm allen key
Straight Slipfix kit GIR0521
Set includes 2 fixings, screws and 5mm hex driver bit
Set includes 1 fixing, screws and 6mm hex driver bit
Slipfix stairpart connectors are designed to offer a time-saving
alternative to traditional methods of fitting stair parts. Fitting
can now be a quick and easy one-man job with the fixings
concealed when the fillet strip and spindles are fitted.
Slipfix stairpart connectors
Fixings
Straight Slipfix kit
Angled Slipfix kit
Newel post fastener
|235
Fixings
Reisser Medium assorted box of screws
Reisser medium assorted box of screws SCW0550
Reisser screw box trade pack SCW0557
Woodscrews - Reisser R2 single thread
Bright Zinc plated
(Box of 200)
3mm x 12mm SCW0522
Lost head nails steel
(1kg box)
40mm FIX0090
65mm FIX0091
Kitchen hinge screws
Box of 200 HKC0024
Woodscrews - Reisser R2 Retinox single
thread Stainless Steel (Box of 200)
3.5mm x 25mm SCW0520
4mm x 30mm SCW0521
20mm FIX0065
25mm FIX0066
30mm FIX0067
Panel pins steel
(250g box)
Woodscrews - Reisser R2 single thread
Bright Zinc plated (Box of 200)
7mm x 1” SCW0020
8mm x 1¼” SCW0031
Paslode Gun nail packs
(Pack of 2,000 with 2 x 30ml fuel cells)
Galvanised angled brads 32mm FIX0220
Galvanised angled brads 38mm FIX0242
Galvanised angled brads 45mm FIX0221
Galvanised angled brads 51mm FIX0243
Galvanised angled brads 63mm FIX0222
Galvanised straight brads 32mm FIX0230
Galvanised straight brads 38mm FIX0240
Galvanised straight brads 45mm FIX0231
Galvanised straight brads 50mm FIX0241
Galvanised straight brads 63mm FIX0232
Panel pins
Reisser Medium assorted box of screws
Paslode gun nail packs
236|
Fixings
Anchors
BZP - Bright Zinc Plated
Brown plastic plugs (box of 100) FIX0002
Red plastic plugs (box of 100) FIX0001
Anchors
Plasterboard cavity fixing BZP (box of 100) FIX0121
Frame fixings M10 x 100mm (box of 10) SCW0920
Frame fixings M10 x 115mm (box of 10) SCW0921
Frame fixings M10 x 160mm (box of 10) SCW0922
Frame fixings M8 x 100mm (box of 10) SCW0901
Frame fixings M8 x 120mm (box of 10) SCW0902
Frame fixings M8 x 80mm (box of 10) SCW0900
Concrete frame screws 7.5mm x 102mm (box of 100) SCW0931
Concrete frame screws 7.5mm x 112mm (box of 100) SCW0932
Concrete frame screws 7.5mm x 122mm (box of 100) SCW0933
Concrete frame screws 7.5mm x 152mm (box of 100) SCW0934
Concrete frame screws 7.5mm x 82mm (box of 100) SCW0930
Plasterboard cavity fixings
Kitchen screws
Brown plastic plugs
|237
Tools and accessories
Howdens has a selection of tools to
complete any job, from router cutters to
saws, screwdrivers to clamps. We also
supply a wide range of sealants and
adhesives, stains and varnishes.
Fire Regulations:
FD Fire doorsFH Essential fire door hardwareFH Non-essential fire door hardware
Building Regulations:
E Part E doors - sound reducingL Part L doors - warmth and insulation suitable for new buildL Part L doors - warmth and insulation suitable for refurbishment projectsM Part M doors - mobility and access
Tools & accessories238|
Tools
Worktop jigs and accessoriesCurved worktop jig (suitable for concave curves) UK TLS0645
65 Worktop jig UK TLS0600
1001 Worktop jig UK TLS0601
Lamona Stainless Steel 1.5 bowl undermount worktop jig UK TLS0646
Lamona ceramic 1.5 bowl undermount worktop jig UK TLS0647
Lamona Stainless Steel single bowl undermount worktop jig UK TLS0648
Lamona granite composite 1.5 bowl undermount worktop jig UK TLS0649
Jig pegs (pack of 4) UK TLS0605
Worktop biscuits (pack of 50) WRK4010
Universal sub-base UK TLS0602
Guide bush 30mm TLS0603
Unika double sided worktop tape GAR0415
Quartz and Granite worktop tools and accessoriesVacuum brazed dry diamond holesaw M14 35mm TLS1010
Diamond granite blade 150mm TLS1011
Vacuum brazed drum M14 70/80 grit 20mm TLS1012
Vacuum brazed drum M14 50/60 grit 75mm TLS1021
Vacuum brazed drum M14 70/80 grit 50mm TLS1035
Dry diamond polishing drums M14 50mm (pack of 7) TLS1036
Dry diamond polishing pads M14 100mm (pack of 9) TLS1014
Rubber backing pad M14 100mm (to fit TLS1014) TLS1013
Drainer groove wheel vacuum brazed 50 grit 12mm TLS1037
Drainer groove flute polishing wheels (pack of 6) TLS1038
Vacuum brazed diamond holesaw 50mm TLS0474
Drainer groove jig UK TLS0662
Makita grinder guide UK TLS0664
M14 to Hex drill spindle adapter TLS1015
500mm Base cabinet support rail UK TLS1022
600mm Base cabinet support rail UK TLS1023
700mm Base cabinet support rail UK TLS1080
800mm Drawer base cabinet support rail UK TLS1024
900mm Drawer base cabinet support rail UK TLS1081
1000mm Drawer base cabinet support rail UK TLS1025
450mm Appliance support rail UK TLS1029
600mm Appliance support rail UK TLS1026
600mm Oven support rail UK TLS1027
600mm Fridge support rail UK TLS1028
SenGuard NF anti-stain protection 375ml TLS1040
White solid granite jointing compound 125ml UK WOR9040
Black solid granite jointing compound 125ml UK WOR9041
Everbuild Everflex premium silicone/frame sealant Clear 310ml UK GAR0117
Everbuild Everflex premium silicone/frame sealant Black 310ml UK GAR0112
Granite worktop cleaner 500ml UK TLS1016
Plastic packing shims assorted sizes (pack of 100) UK TLS0895
Dust mask FFP3 UK TLS1018
Worktop jigs
Granite worktop accessories
Jointing compound and sealants
Tools & accessories |239
Drill and screwdriver bitsHowdens 10 piece drill bit set TLS0130
Kitchen drill bit pack TLS9991
Wera Bi-Torsion screwdriver bit PZ2 (pack of 2) TLS0141
Wera Bi-Torsion screwdriver bit PZ2 (pack of 10) TLS0139
Irwin flat bit 16mm TLS0110
Irwin flat bit 20mm TLS0111
Irwin flat bit 22mm TLS0112
Irwin flat bit 25mm TLS0113
Irwin flat bit 32mm TLS0114
Irwin flat bit 38mm TLS0109
Masonry drill bits 6mm TLS0124
Masonry drill bits 7mm TLS0125
Irwin Impact driver bits - Pack of 20 TLS0143
Irwin Impact driver bits - Holder TLS0144
Flat bit 1” (25mm) 7mm centre point TLS0475
Irwin flat bit 8 piece set TLS0115
Irwin 7 piece multi-purpose drill bit set TLS0117
Router cutters
Trend TR17D 12.7mm straight cutter TLS0639
Trend TR17D 12.7mm straight cutter (pack of 3) TLS0655
Trend 2 flute 12.7mm straight cutter TLS0642
Trend 35mm hinge boring bit TLS0665
Trend TR32 multi profile cutter TLS0098
Trend TR40D 15mm intumescent strip cutter TLS0615
Trend TR41 10mm intumescent strip cutter TLS0095
Trend TR42 15mm intumescent strip cutter TLS0096
Trend PBR03 ¼” Size 0, 10 and 20 biscuit cutter TLS0089
Bearing guided Ovolo cutter 3mm TLS0670
Bearing guided chamfer cutter 45° TLS0671
Drill bits
Router cutters
Jigsaw blades
Tools & accessories240|
Jigsaw bladesReisser (T101B) for wood and board materials 3-30mm (pack of 5) TLS0450
Reisser (T111C) for wood and board materials 5-50mm (pack of 5) TLS0451
Reisser (T119B) for softwood, plywood, chipboard and fibreboard 2-15mm (pack of 5) TLS0452
Reisser (T114D) for wood and board materials 5-50mm and soft plastics less than 50mm (pack of 5) TLS0453
Reisser (T101BR) for wood and board materials including laminates 3-30mm and soft plastics less than 30mm (pack of 5) TLS0454
SawsIrwin Drywall saw 6½” TLS0480
Irwin hacksaw 12” TLS0483
Irwin BiMetal hacksaw blades (pack of 2) TLS0484
Irwin junior hacksaw 6” TLS0481
Irwin junior hacksaw blades (pack of 10) UK TLS0482
Bahco hard point medium saw 22” TLS0488
Bahco hard point fine saw 22” TLS0487
Spear & Jackson hard point 22” TLS0002
Irwin Jack universal saw 20” TLS0015
Bahco coping saw 6” TLS0013
Bahco coping saw blades (pack of 5) TLS0014
Tenon saw TLS0019
Laminator saw TLS0025
190mm circular saw blade TLS0457
160mm plunge saw blade TLS1048
165mm plunge saw blade TLS1049
216mm mitre saw blade TLS0456
Trend planer blades (pair) TLS0455
HammersEstwing claw hammer 16oz TLS0040
Estwing claw hammer 20oz TLS0041
KnivesIrwin Folding Knife TLS0314
Irwin Replacement Blades (pack of 10) TLS0325
Stanley Fat Max instant change retractable blade knife TLS0320†
Stanley Fat Max knife blades (pack of 10) UK TLS0322†
BradawlStanley bradawl TLS0082
ScrewdriversStanley screwdriver PZ1 TLS0223
Stanley screwdriver PZ2 TLS0224
Stanley screwdriver PZ3 TLS0225
Stanley screwdriver PZ2 extra long TLS0226
Stanley screwdriver flare tip 100mm TLS0227
Stanley screwdriver flare tip 150mm TLS0228
Stanley screwdriver flare tip 200mm TLS0229
Stanley ratchet stubby screwdriver multi bit TLS0230
†Subject to availability
Saws
Hammers
Wood chisels
Tools & accessories |241
Tools & accessories
Wood chiselsIrwin Marples soft touch chisel 6mm TLS0180
Irwin Marples soft touch chisel 10mm TLS0181
Irwin Marples soft touch chisel 13mm TLS0182
Irwin Marples soft touch chisel 19mm TLS0183
Irwin Marples soft touch chisel 25mm TLS0184
Irwin Marples soft touch chisel 32mm TLS0186
Irwin Marples soft touch chisel 38mm TLS0185
Irwin Marples soft touch 5 piece chisel set TLS0087
Irwin Marples split-proof 6 piece chisel set TLS0196
SharpeningTrend fast track diamond sharpening stone honing system UK TLS9888
Trend replacement stone 120 grit diamond TLS9889
Trend replacement stone 220 grit diamond TLS9890
ClampsIrwin quick release clamp 6” (pack of 2) TLS0340
Irwin quick release clamp 12” (pack of 2) TLS0341
Solo trigger G clamp 6” UK TLS0358
Spirit levelsStabila spirit level 24” TLS0067
Stabila spirit level 48” TLS0066
Stabila spirit level 71” TLS0065
Measuring tapeStanley Fat Max tape 8m TLS0061
Combination squares
Stanley combination square 12” UK TLS0062
FinishingStanley fine grade finishing file TLS0240
P60 coarse Aluminium Oxide sandpaper roll 115mm x 5m TLS0510
P80 medium Aluminium Oxide sandpaper roll 115mm x 5m TLS0511
P120 fine Aluminium Oxide sandpaper roll 115mm x 5m TLS0512
Masking tape (25mm x 50m) TLS0967
Masking tape (50mm x 50m) TLS0961
Multi-purpose tape (50mm x 50m) SDH0930
Frog tape TLS0968
Clamps
Spirit levels & measuring tape
Sharpening system
242|
Tools & accessories
Decorating accessories
Paint brushesHarris paint brush 1” TLS0962
Harris paint brush 2” TLS0963
Harris paint brush 3” TLS0964
Harris mini roller set TLS0965
Harris mini roller sleeves (pack of 10) TLS0966
PackersPlastic packing shims assorted sizes (pack of 300) UK TLS0890
CleaningBlue paper roll 2 ply 135m TLS9950
Everbuild adhesive removal wipes (pack of 100) UK TLS9943
Everbuild adhesive removal spray 1 litre GAR0070
ProtectionRoll and Stroll carpet protector roll 25m GAR9200
Roll and Stroll hard surface protector roll 25m GAR9201
Cotton twill dustsheet 12’ x 9’ TLS0910
GeneralCanvas tool bag 24” TLS9905
Kitchen fitters pack TLS9990
Roughneck door lifter TLS0659
Rubble sacks (5 pack) TLS9945
Door finger protector NEW TLS0820
Door stand NEW TLS0657
Winbag airbag (pack of 2) TLS0627
Howdens branded Box TLS9989
Oils, stains, varnishes and primersDoors finishing matrix can be found on page 270.
Oils & coatingHJ worktop wax oil 1 litre WRK4015
Prime worktop oil 1 litre WRK3595
Rustins Danish oil 1 litre UK GAR0125
Rustins plastic coating and hardener gloss 1 litre UK GAR0580
Grey worktop tint wax oil GAR0126
Osmo door oil GAR0542
Osmo tinted oil graphite - 500ml GAR0545
Osmo tinted oil terra - 500ml GAR0544
Osmo tinted oil white - 500ml GAR0543
Osmo top oil clear matt - 500ml GAR0546
Kitchen fitters pack
Paint brushes
Danish oil
|243
Interior stain and varnishSadolin English Oak interior stain 750ml UK GAR0536
Sadolin interior varnish satin 1 litre UK GAR0539
Exterior stains and varnishesSadolin Clear exterior base coat 1 litre UK GAR0530
Sadolin Mahogany exterior stain 1 litre UK GAR0531
Sadolin Dark Oak exterior stain 1 litre UK GAR0532
Sadolin Heritage Oak exterior stain 1 litre UK GAR0533
Sadolin Walnut exterior stain 1 litre UK GAR0534
Sadolin Clearcoat exterior varnish satin 1 litre UK GAR0510
Sadolin Clearcoat exterior varnish gloss 1 litre UK GAR0511
PrimerMacpherson primer/undercoat 2.5 litre STN0805
Adhesives & sealants
Skeleton gun
Skeleton gun for use with 290/310/350mm tubes GAR0200
Howdens Joinery bath and sanitary siliconeHJ White 310ml UK GAR0105
HJ Clear 310ml UK GAR0106
HJ Cream 310ml UK GAR0124
Premium silicone/frame sealantEverbuild Everflex White 310ml UK GAR0115
Everbuild Everflex Brown 310ml UK GAR0116
Everbuild Everflex Clear 310ml UK GAR0117
Everbuild Everflex Black 310ml UK GAR0112
Howdens Joinery general purpose siliconeHJ White 310ml UK GAR0120
HJ Cream 310ml UK GAR0119
HJ Brown 310ml UK GAR0121
HJ Clear 310ml UK GAR0122
HJ Grey 310ml UK GAR0118
HJ Black 310ml UK GAR0123
Intumescent masticAstro Flame White 310ml UK ITS0020
Howdens Joinery decorators caulkHJ White solvent free 310ml UK GAR0305
HJ Cream solvent free 310ml UK GAR0302
Expanding FoamsHJ fix and fill expanding foam 750ml GIR0077
HJ gun grade expanding foam 750ml GIR0078
Everbuild hand held B1 fire rated expanding foam 750ml GIR0088
P45 Gun applicator for HJ foams GIR0079
Everbuild PU foam gun cleaner 500ml UK GIR0086
Oils, stains, varnishes & primers
Skeleton gun
Silicone products
Tools & accessories244|
General adhesivesEvo-Stik Sticks Like White 290ml UK GAR0053
Evo-Stik Sticks Like Clear 290ml UK GAR0063
Everbuild Stixall adhesive & sealant White 300ml UK GAR0065
Everbuild Stixall adhesive & sealant Clear 300ml UK GAR0066
Evo-Stik Gripfill solvent based 350ml UK GAR0055
Evo-Stik Gripfill solvent free 350ml UK GAR0056
Everbuild Pink Grip solvent based 350ml UK GAR0160
Everbuild Pink Grip solvent free 350ml UK GAR0161
Evo-Stik contact adhesive solvent based 65g UK GAR0062
Evo-Stik contact adhesive solvent based 250ml UK GAR0059
Evo-Stik contact adhesive solvent free 250ml UK GAR0058
Unika double sided worktop tape GAR0415
Mitre pen pack with 1 adhesive (50g) UK GAR0381
Mitre bond adhesive 50g and aerosol activator 200ml UK GAR0365
Flooring adhesives & sealantsEverbuild Lumberjack adhesive applicator gun UK SDH3182
Everbuild Lumberjack adhesive pack for gun (12 x 600ml cartridges) UK SDH3181
SikaBond 54 wood floor adhesive (13kg tub) SDH3176
Flooring adhesive trowel SDH0912
Unika Clicseal flooring joint sealer 125ml SDH0099
Unika Beech colour sealant 310ml SDH0090
Unika Medium Oak colour sealant 310ml SDH0091
Unika Ochre Burl colour sealant 310ml SDH0095
Unika Light Grey colour sealant 310ml SDH0097
Wood adhesivesEverbuild Lumberjack PU expanding wood adhesive 750g UK GAR0057
Evo-Stik wood adhesive 1 litre UK GAR0001
Evo-Stik weatherproof wood adhesive 1 litre UK GAR0050
HJ Weatherproof wood adhesive 1 litre UK GAR0003
HJ Weatherproof wood adhesive 500ml UK GAR0004
Wood fillersEverbuild stainable wood filler light 250ml UK GAR0081
Everbuild stainable wood filler medium 250ml UK GAR0082
Everbuild 2 part stainable wood filler light 500g UK GAR0083
Everbuild 2 part stainable wood filler medium 500g UK GAR0084
General purpose fillerEverbuild all purpose powder filler 1.8kg UK GAR0085
Everbuild One Strike ready mixed filler 1 litre UK GAR0086
Care kitsKitchen door care kit GIR0982
Tewkesbury Stone kitchen door care kit GIR0986
Tewkesbury Skye kitchen door care kit GIR0985
Tewkesbury Blue kitchen door care kit GIR0987
Flooring care kit SDH0715
Gloss surface cleaner 150ml UK GIR0981
WD40 450ml TLS0970
Repair kit - Pre-finished hardwood door NEW GAR0540
Repair kit - Pre-finished moulded door NEW GAR0541
Expanding foams
Flooring adhesives & sealants
Wood fillers
Tools & accessories |245
Kitchen overview
In addition to doors, joinery,
hardware and flooring, Howdens
Joinery offers over 70 inspirational
kitchens plus a full range of
accessories, worktops, sinks, taps
and a wide variety of Lamona
appliances exclusive to Howdens.
For full details please refer to The
Kitchen Collection brochure or visit
our website at www.howdens.com
Bring kitchens to life on the Howdens
website. You can learn more through
our collection of movies at
www.howdens.com/
advice-inspiration/movies
Kitchen overview246|
T h e U n i v e r s a l C o l l e c t i o n
In virtually any kitchen, this simple slab door design works perfectly. Whether you're aiming for a sleek, clean look,
or want something purely functional, you can adapt The Universal Collection to suit your style.
This range is versatile and capable of customisation, with handles and colour combinations, hence the name
Universal.
There are 3 families within this collection - Glendevon, Greenwich Gloss and Greenwich.
The Kitchen Collection |247
T h e S h a k e r C o l l e c t i o n
From urban chic to country classic, The Shaker Collection makes any style of kitchen possible. Choose your
finish - wood grain, super matt or gloss - to create a modern or traditional feel.
There are 8 families within this collection - Tewkesbury Framed, Tewkesbury, Burford Gloss, Burford Tongue & Groove,
Fairford, Burford, Allendale and Greenwich Shaker.
The Kitchen Collection 248|
T h e C o n t e m p o r a r y C o l l e c t i o n
Integrated handles and a super-smooth finish give The Contemporary Collection the purest of clean lines.
This is a modern design with understated elegance - and in a wide range of soft, subtle colours.
There are 3 families within this collection - Bayswater, Clerkenwell Gloss and Clerkenwell Super Matt.
The Kitchen Collection |249
Our commitment
Over 75% of the products we
supply to the builder are timber
or timber based. Howdens Joinery
is committed to ensure all timber
based products come from legally
harvested sources and where
possible we look to purchase
through certified sources. 100% of
wood-based material used in our
manufacturing processes are from
FSC® certified sources.
For more details, please visit
www.howdens.com/about-us/
corporate-social-responsibility
Regulations
Fire Regulations:
FD Fire doorsFH Essential fire door hardwareFH Non-essential fire door hardware
Building Regulations:
E Part E doors - sound reducingL Part L doors - warmth and insulation suitable for new buildL Part L doors - warmth and insulation suitable for refurbishment projectsM Part M doors - mobility and access
250|
The following is a guide to the regulations that apply to selected joinery products. Door ranges that
include products conforming to these regulations will be marked with the relevant icon.
Door regulations
Fire doors (FD)
Howdens doors are tested to BS 476: Part 22: 1987 achieving fire resistance up to
30 minutes (FD30) or 60 minutes (FD60) when hung and installed in accordance with
the instructions provided with the door. Our fire doors are supported by third party test
evidence, assessment or certification schemes.
Part E doors (E) - sound reducing
Doors which conform to Building Regulation Part E help to minimise sound travel,
providing a peaceful and quiet environment.
Essential fire door hardware (FH)
Howdens essential fire door hardware is tested to perform against fire regulations and
legislation, and has test evidence to support this for presentation to a Building Control
Inspector. These items of hardware are classed as essential, to ensure that the fire resisting
door stays closed in its frame in a fire emergency, and include items such as door closers,
hinges and latches. Other items which do not alter the integrity or performance of the
door would be classed as non-essential and do not require test evidence (see FH below).
Any hardware listed in a fire doors data sheet is essential to that door. This includes
intumescent strips and glazing systems.
Non-essential fire door hardware (FH)
Howdens hardware includes a range of products suitable for use on fire doors, which does
not require test evidence to support this for presentation to a Building Control Inspector.
These items of hardware are classed as non-essential, and consist of face fixed products
that do not affect the integrity of the fire door, and in no way impede or reduce the door's
ability to withstand fire attack for the specified time. These products include items such
as fingerplates, kickplates and signage. Although these items do not require test evidence
like essential fire door hardware, careful selection is still needed, as often holes are drilled
through timber fire doors or large metal components are attached, which can invalidate a
fire door test certificate.
Part M doors (M) - mobility and access
For access and facilities for disabled people, wider doors and reduced threshold heights
are required by Building Regulation Part M (selected sizes only).
Part L doors (L) - warmth & insulation suitable for new build
Doors carrying Building Regulation Part L have a greater thermal efficiency and help to keep
rooms warm and cosy. Suitable for most new build and extension projects. A U-Value of
2.00 W/m2 K or better is achieved by these products, when fitted with an approved frame in
accordance with instructions.
Part L doors (L) - warmth & insulation suitable for refurbishment projects
Doors carrying Building Regulation Part L have a greater thermal efficiency and help to keep
rooms warm and cosy. Suitable for most refurbishment projects where both door and frame
are being replaced.
A U-Value of 1.80 W/m2 K or better is achieved by these products, when fitted with an
approved frame in accordance with instructions.
These regulatory specifications are correct at the time of going to press, and are subject to fitting in accordance with relevant guidelines.
FD
FH
E
L
M
L
FH
Regulations |251
Howdens Joinery supplies high quality doors, joinery and hardware to trade customers from stock.
When professionally installed, these products will provide many years of reliable use.
Our commitment – We work closely with our suppliers to ensure that the items we purchase come
from sustainable, renewable resources and are produced in a socially responsible way. Howdens
Joinery has successfully achieved the Forest Stewardship Council® (FSC®) and the Programme for
the Endorsement of Forest Certification™ (PEFC™) Chain of Custody certificates, which apply to a
number of products as indicated in this brochure by F for FSC® P for PEFC™.
The Chain of Custody certification means there is an unbroken and documented chain of ownership
all the way from the forest, via the mill, the importer, the manufacturer and the supplier to the end
user. Our full environmental policy is available on request.
Forest Stewardship Council® (F) – The Forest Stewardship Council® (FSC®) is an international
network designed to promote responsible management of the world's forests.
Programme for the Endorsement of Forest Certification™ (P) – The Programme
for the Endorsement of Forest Certification™ (PEFC™) is a framework for the recognition of
forest certification schemes meeting internationally recognised requirements for sustainable forest
management.
UK Manufactured (UK) – Howdens Joinery is a British business. We pride ourselves on the sense of
local community, traditional values and long established relationships that thrive in our depots and
manufacturing facilities. This logo UMANUFACTURED
or UK indicates that the products illustrated are manufactured
and assembled in the UK.
British Standards (BS) – In all instances it is good practice to fit British Standard approved
locks to all of your external doors. In many cases this is an insurance company requirement and may
reduce your premium. Approved locks carry the BSI Kitemark™ and are approved to either BS 3621:
2007 or BS EN 1303: 2005, rigorous test standards to which the locks must perform.
BS 3621: 2007 – A well established product standard for thief resistant locks in the UK. Locks tested
to BS 3621: 2007 must exceed a minimum level of performance and be subjected to a general
vulnerability assessment to enable the product to be Kitemark™ by BSI.
Standards and accreditations
Standards & accreditations252|
BS EN 1303: 2005 – The product standard for thief resistant cylinders for locks in the UK. Locks
tested to BS EN 1303: 2005 must pass various performance and vulnerability assessments to
enable the product to be KitemarkTM by BSI.
BS EN 1154: 1997 – The required standard to test to, in order to attain CE marking for controlled
door closing devices.
BS EN 1125: 2008 – Applies to panic exit devices where the exit door is used by the public and
provides safe and effective escape through the doorway. The emphasis of products covered by this
standard is the safe exit, rather than security.
BS EN 179: 2008 – Applies to emergency applications where the exit door is used by people who
‘are familiar with the emergency exit and its hardware, and therefore a panic situation is unlikely
to occur.’
Secured by Design (SBD) – Secured by Design is the official police initiative to guide and encourage
those engaged within the specification, design and build of new homes to adopt crime prevention
measures. Secured by Design focuses on reducing crime in homes and commercial premises and
promotes the use of security standards to ensure products help to achieve this. The objective is to
reduce burglary and crime in the UK by designing out crime through physical security and processes.
Where a product is shown with the Secured by Design logo you have the reassurance that the product
has been tested to the highest relevant standard for security.
Guild of Architectural Ironmongers (GAI) – Howdens Joinery is an affiliate member of the
Guild of Architectural Ironmongers (GAI) ensuring the highest professional standards are achieved
and ongoing commitment to quality assurance.
Standards & accreditations |253
Doors,hardware & flooring overview
Fire Regulations:
FD Fire doorsFH Essential fire door hardwareFH Non-essential fire door hardware
Building Regulations:
E Part E doors - sound reducingL Part L doors - warmth and insulation suitable for new buildL Part L doors - warmth and insulation suitable for refurbishment projectsM Part M doors - mobility and access
Doors, hardware& flooring overview
A comprehensive guide to our full
range of internal and external doors,
handles, fire rated hardware and
flooring accessories.
254|
Howdens range of doors
Internal doors
External doors
We offer a comprehensive range of internal and external doors that is sure to meet all your requirements.
To help you find the perfect door for your home, visit our door visualiser at
www.howdens.com/advice-inspiration/door-visualiser
Internal moulded panel doors
pages 08 to 30
External hardwood doors
pages 102 to 115
Internal softwood doors
pages 31 to 38
External softwood doors
pages 116 to 119
Internal primed stile
and rail doors
pages 39 to 46
External flush doors
pages 120 to 123
Internal hardwood doors
pages 47 to 73
Internal flush doors
pages 74 to 90
Sliding wardrobe doors
pages 95 to 100
Garage doors
pages 124 to 125
Doors Overview |255
Internal moulded panel doors
All internal doors conform to the following thicknesses:
Imperial sizes 35mm, Metric sizes 40mm, Fire doors 44mm (excluding 35mm Fire doors).
All external doors conform to the following thicknesses: Standard and FD30 44mm, FD60 54mm.
Pre-finished Dordogne Smooth
Pre-finished 6 panel grained
Burford 4 panel
4 Panel Shaker smooth
Linear smooth
Arched top grained
Imperial (inch)
6'6" x 1'3"
6'6" x 1'6" DIM1610 UK F DIM1210 UK F DIC9810 UK F DIC0728 UK F6'6" x 1'9" DIM1620 UK F DIM1220 UK F DIC9820 UK F DIM1020 UK F DIC0729 UK F6'6" x 2'0" DIM1630 UK F DIM1230 UK F DIC9830 UK F DIM1030 UK F DIM1430 UK F DIC0730 UK F6'6" x 2'3" DIM1640 UK F DIM1240 UK F DIC9840 UK F DIM1040 UK F DIM1440 UK F DIC0740 UK F6'6" x 2'4" DIM1650 UK F DIM1250 UK F DIM1050 UK F6'6" x 2'6" DIM1660 UK F DIM1260 UK F DIC9860 UK F DIM1060 UK F DIM1460 UK F DIC0760 UK F6'6" x 2'9" DIM1670 UK F M DIM1270 UK F M DIC9870 UK F M DIM1070 UK F M DIM1470 UK F M DIC0770 UK F M 6'6" x 2'10"
6'8" x 2'8" DIM1680 UK F M DIM1280 UK F M DIC9880 UK F M DIM1080 UK F M
Metric (mm)
2040 x 526
2040 x 626 DIM1730 UK F DIM1530 UK F DIC8530 UK F DIM1130 UK F2040 x 726 DIM1740 UK F DIM1540 UK F DIC8540 UK F DIM1140 UK F2040 x 826 DIM1760 UK F M DIM1560 UK F M DIC8560 UK F M DIM1160 UK F M2040 x 926 DIM1770 UK F M DIM1570 UK F M DIC8570 UK F M DIM1170 UK F M
Developer door
imperial
6'6" x 2'0"
6'6" x 2'3"
6'6" x 2'6"
6'6" x 2'9"
Firecheck FD30
imperialFire door
6'6" x 2'0"
6'6" x 2'3" DGM1640 UK P E DIF8140 UK P E DIF2640 UK P E DFM1040 UK P DFM1440 UK P E6'6" x 2'6" DGM1660 UK P E DIF8160 UK P E DIF2660 UK P E DFM1060 UK P DFM1460 UK P E6'6" x 2'9" DGM1670 UK P M E DIF8170 UK P M E DIF2670 UK P M E DFM1070 UK P M DFM1470 UK P M E6'8" x 2'8"
Firecheck FD30 metric
Fire door
2040 x 526
2040 x 626 DFM1130 UK P2040 x 726 DFM1140 UK P2040 x 826 DFM1160 UK P M2040 x 926 DFM1170 UK P M
Firecheck FD30 35mm
imperialFire door
6'6" x 2'3"
6'6" x 2'6"
6'6" x 2'9"
6'8" x 2'8"
Glazed imperial
6'6" x 2'0"
6'6" x 2'3" DGM2040 F UK DGM1940 F UK DIC9140 UK F DGM1840 UK F DGM1540 UK F6'6" x 2'6" DGM2060 F UK DGM1960 F UK DIC9160 UK F DGM1860 UK F DGM1560 UK F6'6" x 2'9" DGM2070 F UK M DGM1970 F UK M DIC9170 UK F M DGM1870 UK F M DGM1570 UK F M6'8" x 2'8"
Glazed metric
2040 x 626
2040 x 726
2040 x 826
2040 x 926
Bi-Fold imperial
6'6" x 2'3"
6'6" x 2'6"
Doors overview256|
Internal moulded panel doors
Dordognesmooth
4 Panel smooth
6 Panel smooth
4 Panelgrained
6 Panelgrained
Imperial (inch)
6'6" x 1'3" DIC0900 UK F6'6" x 1'6" DIC8310 UK F DIC7410 UK F DIC1010† UK F DIC2010 UK F DIC0910 UK F6'6" x 1'9" DIC8320 UK F DIC7420 UK F DIC1020† UK F DIC2020 UK F DIC0920 UK F6'6" x 2'0" DIC8330 UK F DIC7430 UK F DIC1030 UK F DIC2030 UK F DIC0930 UK F6'6" x 2'3" DIC8340 UK F DIC7440 UK F DIC1040 UK F DIC2040 UK F DIC0940 UK F6'6" x 2'4" DIC8350 UK F DIC2050 UK F DIC0950 UK F6'6" x 2'6" DIC8360 UK F DIC7460 UK F DIC1060 UK F DIC2060 UK F DIC0960 UK F6'6" x 2'9" DIC8370 UK F M DIC7470 UK F M DIC1070 UK F M DIC2070 UK F M DIC0970 UK F M6'6" x 2'10" DIC0990 UK F M6'8" x 2'8" DIC8380 UK F DIC7480 UK F M DIC2080 UK F M DIC0980 UK F M
Metric (mm)
2040 x 526 DIC1921 UK F2040 x 626 DIM1330 UK F DIC1831 UK F DIC1931 UK F2040 x 726 DIM1340 UK F DIC1841 UK F DIC1941 UK F2040 x 826 DIM1360 UK F M DIC1861 UK F M DIC1961 UK F M2040 x 926 DIM1370 UK F M DIC1871 UK F M DIC1971 UK F M
Developer door
imperial
6'6" x 2'0" DIC3930 UK P6'6" x 2'3" DIC3940 UK P6'6" x 2'6" DIC3960 UK P6'6" x 2'9" DIC3970 UK P M
Firecheck FD30
imperialFire door
6'6" x 2'0" DIF2930 UK P E DIF0631 UK P E DIF0531 UK P E6'6" x 2'3" DIF7340 UK P E DIF2940 UK P E DIF1040 UK P E DIF0641 UK P E DIF0541 UK P E6'6" x 2'6" DIF7360 UK P E DIF2960 UK P E DIF1060 UK P E DIF0661 UK P E DIF0561 UK P E6'6" x 2'9" DIF7370 UK P M DIF2970 UK P M E DIF1070 UK P M E DIF0671 UK P M E DIF0571 UK P M E6'8" x 2'8" DIF2980 UK P M E DIF0681 UK P M E DIF0580 UK P M E
Firecheck FD30 metric
Fire door
2040 x 526 DIF0920 UK P E2040 x 626 DIF2330 UK P E DIF0930 UK P E2040 x 726 DIF2340 UK P E DIF0940 UK P E2040 x 826 DIF2360 UK P M E DIF0960 UK P M E2040 x 926 DIF2370 UK P M E DIF0970 UK P M E
Firecheck FD30 35mm
imperialFire door
6'6" x 2'3" DIF5440† UK P6'6" x 2'6" DIF5460 UK P6'6" x 2'9" DIF5470 UK P M6'8" x 2'8" DIF5480 UK P M
Glazed imperial
6'6" x 2'0" DGM1230 UK F6'6" x 2'3" DGM1640 UK F DGM1440 UK F DGM1240 UK F6'6" x 2'6" DGM1660 UK F DGM1460 UK F DGM1260 UK F6'6" x 2'9" DGM1670 UK F M DGM1470 UK F M DGM1270 UK F M6'8" x 2'8" DGM1280 UK F M
Glazed metric
2040 x 626 DGM1330 UK F2040 x 726 DGM1340 UK F2040 x 826 DGM1360 UK F M2040 x 926 DGM1370 UK F M
Bi-Fold imperial
6'6" x 2'3" DIP0240 UK F DIP0140 UK F6'6" x 2'6" DIP1060 UK F DIP0260 UK F DIP0160 UK F
†Subject to availability Doors overview |257
Internal softwood doors
8 Light Clear Pine
glazed
Pattern 10 Clear Pine glazed
Downham Clear Pine glazed
6 PanelClear Pine
4 PanelClear Pine
4 Panel Knotty Pine
Imperial (inch)
6'6" x 1'3"
6'6" x 1'6"
6'6" x 1'9"
6'6" x 2'0" DIS1330 F DIS3430 F DIS2630†
6'6" x 2'3" DIS1340 F DIS3440 F DIS2640†
6'6" x 2'4"
6'6" x 2'6" DIS1360 F DIS3460 F DIS2660†
6'6" x 2'9" DIS1370 F M DIS3470 F M DIS2670† M6'6" x 2'10"
6'8" x 2'8" DIS3480 F M
Metric (mm)
2040 x 526
2040 x 626 DIS1730† F2040 x 726 DIS1740† F DIS3640 F2040 x 826 DIS1780† F M DIS3680 F M2040 x 926
Firecheck FD30
imperialFire door
6'6" x 2'0"
6'6" x 2'3" DFD25406'6" x 2'6" DFD25606'6" x 2'9" DFD25706'8" x 2'8"
Glazed imperial
6'6" x 2'0" DIS3830† F6'6" x 2'3" DIS3840† F DIS3240 F6'6" x 2'6" DIS3860† F DIS2860† F DIS3960† F DIS3260 F6'6" x 2'9" DIS3870† F M DIS2870† F M DIS3970† F M DIS3270 F M6'8" x 2'8" DIS3280 F M
Glazed metric
2040 x 626
2040 x 726 DIS3241 F2040 x 826 DIS3261 F M2040 x 926
Internal primed doors
PrimedDordogne
Primed LinearPrimed 4 panel Shaker
Primed Worcester
Imperial (inch)
6'6" x 1'3"
6'6" x 1'6"
6'6" x 1'9"
6'6" x 2'0" DIR1330 DIR1530 DIR1230 DIR11306'6" x 2'3" DIR1340 DIR1540 DIR1240 DIR11406'6" x 2'4"
6'6" x 2'6" DIR1360 DIR1560 DIR1260 DIR11606'6" x 2'9" DIR1370 M DIR1570 M DIR1270 M DIR1170 M6'6" x 2'10"
6'8" x 2'8"
Firecheck FD30
imperialFire door
6'6" x 2'0"
6'6" x 2'3" DFD1340 DIF8640 DIF8340 DIF84406'6" x 2'6" DFD1360 DIF8660 DIF8360 DIF84606'6" x 2'9" DFD1370 M DIF8670 M DIF8370 M DIF8470 M6'8" x 2'8"
Glazed imperial
6'6" x 2'0"
6'6" x 2'3" DGT1340 DGT1240 DGT11406'6" x 2'6" DGT1360 DGT1260 DGT11606'6" x 2'9" DGT1370 M DGT1270 M DGT1170 M6'8" x 2'8"
†Subject to availabilityDoors overview258|
Internal hardwood doors
Solid Rustic Oak ledgedPre-finished Linear
Oak4 Panel Oak Linear Oak
Worcester Oak
Imperial (inch)
6'6" x 1'3"
6'6" x 1'6" DIE2210 6'6" x 1'9" DIE2220 6'6" x 2'0" DIE3430 DIE7130 DIE4030 DIE2230 DIC64306'6" x 2'3" DIE3440 DIE7140 DIE4040 DIE2240 DIC64406'6" x 2'4" DIE2250 6'6" x 2'6" DIE3460 DIE7160 DIE4060 DIE2260 DIC64606'6" x 2'9" DIE3470 M DIE7170 M DIE4070 M DIE2270 M DIC6470 M6'6" x 2'10"
6'8" x 2'8" DIE4080† M DIE2280 M
Metric (mm)
2040 x 526
2040 x 626 DIE4460 DIE9130 2040 x 726 DIE4470 DIE9140 2040 x 826 DIE4480 M DIE9160 M2040 x 926 DIE4490 M DIE9170 M
Firecheck FD30
imperial Fire door
6'6" x 2'0"
6'6" x 2'3" DIF9540 DFD4040 DFD3940 DFD65406'6" x 2'6" DIF9560 DFD4060 DFD3960 DFD65606'6" x 2'9" DIF9570 M DFD4070 M DFD3970 M DFD6570 M6'8" x 2'8"
Firecheck FD30 metric
Fire door
2040 x 526
2040 x 626
2040 x 726 DFD44702040 x 826 DFD4480 M2040 x 926 DFD4490 M
Firecheck FD30 35mm
imperialFire door
6'6" x 2'3"
6'6" x 2'6"
6'6" x 2'9"
6'8" x 2'8"
Glazed imperial
6'6" x 2'0"
6'6" x 2'3" DIE4140 DIE2840 DIC65406'6" x 2'6" DIE4160 DIE2860 DIC65606'6" x 2'9" DIE4170 M DIE2870 M DIC6570 M6'8" x 2'8"
Glazed metric
2040 x 626
2040 x 726 DIE4570 DIE92402040 x 826 DIE4580 M DIE9260 M2040 x 926
Bi-Fold imperial
6'6" x 2'3" DIP1349 P6'6" x 2'6" DIP1369 P
†Subject to availability Doors overview |259
Internal hardwood doors
4 Panel Shaker Oak
Dordogne Oak
Burford 4 Panel Oak
Victorian 4 Panel Oak
Westlock OakPre-finished Holdenby
Oak
Imperial (inch)
6'6" x 1'3" DIE46006'6" x 1'6" DIE46106'6" x 1'9" DIE46206'6" x 2'0" DIE5130 DIE6630 DIE7730 DIE2530 DIE88306'6" x 2'3" DIE5140 DIE6640 DIE7740 DIE2540 DIE88406'6" x 2'4" DIE46506'6" x 2'6" DIE5160 DIE6660 DIE7760 DIE2560 DIE88606'6" x 2'9" DIE5170 M DIE6670 M DIE7770 M DIE7370† M DIE2570 M DIE8870 M6'6" x 2'10" DIE4690 M6'8" x 2'8" DIE4680 M
Metric (mm)
2040 x 526
2040 x 626 DIE66312040 x 726 DIE66412040 x 826 DIE6661 M2040 x 926 DIE6671 M
Firecheck FD30
imperial Fire door
6'6" x 2'0" DFD41306'6" x 2'3" DIF7440 DFD5840 DIF5940 DIF91406'6" x 2'6" DIF7460 DFD5860 DIF5960 DIF91606'6" x 2'9" DIF7470 M DFD5870 M DIF5970 M DIF9170 M6'8" x 2'8" DFD4180 M
Firecheck FD30 metric
Fire door
2040 x 526
2040 x 626 DFD49302040 x 726 DFD49402040 x 826 DFD4960 M2040 x 926 DFD4970 M
Firecheck FD30 35mm
imperialFire door
6'6" x 2'3" DFD24406'6" x 2'6" DFD24606'6" x 2'9" DFD2470 M6'8" x 2'8" DFD2480 M
Glazed imperial
6'6" x 2'0" DIE50306'6" x 2'3" DIE5440 DIE78406'6" x 2'6" DIE5360 DIE5460 DIE78606'6" x 2'9" DIE5370 M DIE5470 M DIE7870 M DIE7470† M6'8" x 2'8" DIE5080 M
Glazed metric
2040 x 626 DIE52302040 x 726 DIE5240 2040 x 826 DIE5260 M2040 x 926 DIE5270 M
Bi-Fold imperial
6'6" x 2'3" DIP09406'6" x 2'6" DIP0960
†Subject to availabilityDoors overview260|
Internal hardwood doors
Pre-finished Genoa Oak
Holdenby Oak
Genoa Oak
Imperial (inch)
6'6" x 1'3"
6'6" x 1'6" DIE6910 DIE64106'6" x 1'9" DIE6920 DIE64206'6" x 2'0" DIE7230 DIE6930 DIE64306'6" x 2'3" DIE7240 DIE6940 DIE64406'6" x 2'4" DIE7250 DIE6950 DIE64506'6" x 2'6" DIE7260 DIE6960 DIE64606'6" x 2'9" DIE7270 M DIE6970 M DIE6470 M6'6" x 2'10"
6'8" x 2'8" DIE7280 M DIE6980 M DIE6480 M
Metric (mm)
2040 x 526
2040 x 626 DIE6931 DIE68302040 x 726 DIE8440 DIE6941 DIE68402040 x 826 DIE8460 M DIE6961 M DIE6860 M2040 x 926 DIE6971 M DIE6890 M
Firecheck FD30
imperial Fire door
6'6" x 2'0"
6'6" x 2'3" DIF8540 DIF7540 DFD28406'6" x 2'6" DIF8560 DIF7560 DFD28606'6" x 2'9" DIF8570 M DIF7570 M DFD2870 M6'8" x 2'8"
Firecheck FD30 metric
Fire door
2040 x 526
2040 x 626
2040 x 726
2040 x 826
2040 x 926
Firecheck FD30 35mm
imperialFire door
6'6" x 2'3"
6'6" x 2'6"
6'6" x 2'9"
6'8" x 2'8"
Glazed imperial
6'6" x 2'0"
6'6" x 2'3" DIE8040 DIE67406'6" x 2'6" DIE8560 DIE8060 DIE67606'6" x 2'9" DIE8570 M DIE8070 M DIE6770 M6'8" x 2'8"
Glazed metric
2040 x 626
2040 x 726 DIE8140 2040 x 826 DIE8160 M2040 x 926
Bi-Fold imperial
6'6" x 2'3" DIP14496'6" x 2'6" DIP1469
Doors overview |261
Oak Foil16G glazed
Light Grey Oak Foil20G glazed
Ash veneer16G glazed
Oak Foil20G glazed
Ply 20G glazedPly 16G glazed
Firecheck FD30
imperialFire door
6'6" x 2'0"
6'6" x 2'3" DFL1540 UK E DIF8040 UK E DIF7840 UK E DFL1740 UK P E DIF3340 UK P E6'6" x 2'6" DIF3660 UK E DIF8060 UK E DIF3790 UK E DIF7860 UK E DIF7960 UK P E DIF3360 UK P E6'6" x 2'9" DIF3670 UK M E DIF8070 UK M E DIF3750 UK M E DIF7870 UK E DIF7970 UK P M E DIF3370 UK P M E6'8" x 2'8"
Firecheck FD30 metric
Fire door
2040 x 526
2040 x 626
2040 x 726
2040 x 826 DIF3161 UK M E DIF3240 UK M E DIF7760 UK M E DFL1860 UK P M E DIF9460 UK P E2040 x 926 DIF3171 UK M E DIF3250 UK M E DIF7770 UK M E DFL1870 UK P M E DIF9470 UK P M E
Ply G/O glazed
Dordogne inlaid Oak veneer
Oak Veneer Oak Veneer 20G glazedAsh
veneerOak foil
Imperial (inch)
6'6" x 1'3"
6'6" x 1'6"
6'6" x 1'9"
6'6" x 2'0" DIL1830 UK DIC3230 UK6'6" x 2'3" DIL1240 UK DIL1840 UK DIC3240 UK6'6" x 2'4"
6'6" x 2'6" DIL1260 UK DIL1860 UK DIC3260 UK6'6" x 2'9" DIL1270 UK M DIL1870 UK M DIC3270 UK M6'6" x 2'10"
6'8" x 2'8"
Metric (mm)
2040 x 526
2040 x 626
2040 x 726 DIC4941 UK2040 x 826 DIC4961 UK2040 x 926 DIC4971 UK
Firecheck FD30
imperialFire door
6'6" x 2'0" DIF1730† UK E6'6" x 2'3" DIF4640 UK P E DFL1240 UK DIF9640 UK E DIF9340 UK E DIF0740 UK E DIF1740 UK E6'6" x 2'6" DIF4660 UK P E DFL1260 UK DIF9660 UK E DIF9360 UK E DIF0760 UK E DIF1760 UK E6'6" x 2'9" DIF4670 UK P M E DFL1270 UK M DIF9670 UK M E DIF9370 UK M E DIF0770 UK M E DIF1770 UK M E6'8" x 2'8" DIF4680 UK P M E
Firecheck FD30 metric
Fire door
2040 x 526
2040 x 626
2040 x 726 DIF2131† UK E2040 x 826 DIF5280 UK P M DIF9760 UK M E DIF9960 UK M E DIF0240 UK M E DIF2161 UK M E2040 x 926 DIF5290 UK P M DIF9770 UK M E DIF9970 UK M E DIF0250 UK M E DIF2171 UK M E
Internal flush doors
†Subject to availabilityDoors overview262|
Light Grey Oak Foil Sapele veneerPrimed unlipped
hardboardPlywood
Imperial (inch)
6'6" x 1'3" DIC1100 UK DIC1300 UK F6'6" x 1'6" DIC1110 UK DIC1310 UK F6'6" x 1'9" DIC1120 UK DIC1320 UK F6'6" x 2'0" DIL1430 UK DIC1430† UK DIC1130 UK DIC1330 UK F6'6" x 2'3" DIL1440 UK DIC1440† UK DIC1140 UK DIC1340 UK F6'6" x 2'4" DIC1150 UK DIC1350 UK F6'6" x 2'6" DIL1460 UK DIC1460† UK DIC1160 UK DIC1360 UK F6'6" x 2'9" DIL1470 UK M DIC1470† UK M DIC1170 UK M DIC1370 UK F M6'6" x 2'10"
6'8" x 2'8" DIC1380 UK F M
Metric (mm)
2040 x 526 DIC3020 UK F2040 x 626 DIC3030 UK F2040 x 726 DIC0641† UK DIC3040 UK F2040 x 826 DIC0661† UK M DIC3060 UK F M2040 x 926 DIC3070 UK F M
Firecheck FD30
imperialFire door
6'6" x 2'0" DIF1430 UK P E 6'6" x 2'3" DFL1440 UK E DIF1440 UK P E6'6" x 2'6" DFL1460 UK E DIF1160† UK E DIF1460 UK P E6'6" x 2'9" DFL1470 UK M E DIF1190† UK M E DIF1470 UK P M E6'8" x 2'8" DIF1480 UK P M E
Firecheck FD30 metric
Fire door
2040 x 526 DIF1520 UK P E2040 x 626 DIF1530 UK P E2040 x 726 DIF1540 UK P E2040 x 826 DIF1560 UK P M E2040 x 926 DIF1570 UK P M E
Firecheck FD30 35mm
imperialFire door
6'6" x 2'3" DIF8940 UK P6'6" x 2'6" DIF8960 UK P6'6" x 2'9" DIF8970 UK P M6'8" x 2'8" DIF8980 UK P M
Internal flush doors
Sliding wardrobe doors
White edgemirror door
White Shakermirror door
White Shakerpanel door
Oak Shakermirror door
Oak Shakerpanel doord
Metric (mm)
2220 x 610 GIR2011 GIR2015 GIR2044 F GIR2025 GIR2024 F
2220 x 914 GIR2010 GIR2013 GIR2042 F GIR2023 GIR2022 F
White Trackset
L1200mm GIR2036
L1800mm GIR2030
L2700mm GIR2031
L3600mm GIR2032
Silver Trackset
L1200mm GIR2037
L1800mm GIR2033
L2700mm GIR2034
L3600mm GIR2035
†Subject to availability Doors overview |263
Part L Regent Oak
Cottage Oak triple glazed
External Dordogne Oak
External Worcester Oak
External Linear Oak
Georgian glazed
Imperial (inch)
6'6" x 2'0"
6'6" x 2'3"
6'6" x 2'6"
6'6" x 2'9" DXP2670 M DXP3170† M DXP1570† M
6'8" x 2'8" DXP1981† F L L M DXP2680 M DXP3180† M DXP1580† M
6'10" x 2'10"
Glazed imperial
6'6" x 2'0"
6'6" x 2'3"
6'6" x 2'6" DXP5960†
6'6" x 2'9" DXP2970 M DXP3270 M DXP5970 M
6'8" x 2'8" DXP2380† M DXP2980 M DXP3280 M DXP5980 M
Bosworth glazed
Richmond glazed
Carolina glazed
H2XG glazed
Regent
Imperial (inch)
6'6" x 2'0"
6'6" x 2'3"
6'6" x 2'6" DXP4360
6'6" x 2'9" DXP4370 M
6'8" x 2'8" DXP4381 M
6'10" x 2'10"
Glazed imperial
6'6" x 2'0"
6'6" x 2'3"
6'6" x 2'6" DXP5860† DXP5460 DXP4660† DXP5160
6'6" x 2'9" DXP5870 M DXP5470 M DXP4670 M DXP5170 M
6'8" x 2'8" DXP5880 M DXP5480 M DXP4680 M DXP5180 M
External hardwood doors
†Subject to availabilityDoors overview
All internal doors conform to the following thicknesses:
Imperial sizes 35mm, Metric sizes 40mm, Fire doors 44mm (excluding 35mm Fire doors).
All external doors conform to the following thicknesses: Standard and FD30 44mm, FD60 54mm.
264|
External softwood doors
External flush doors
Ply G/O glazed
Solid core blank lightweight
Plywood
Imperial (inch)
6'6" x 2'0"
6'6" x 2'3"
6'6" x 2'6" DXL0560 UK6'6" x 2'9" DXL0570 UK M6'6" x 2'10"
6'8" x 2'8"
Firecheck FD30 imperial
Fire door
6'6" x 2'3" DXF0140 UK P6'6" x 2'6" DXF1360 UK P DXF0160 UK P6'6" x 2'9" DXF1370 UK P M DXF0170 UK P M6'8" x 2'8" DXF1380 UK P M DXF0180 UK P M7'0" x 3'0" DFD0041 M E8'0" x 4'0" DFD0053 M E
Firecheck FD30 metric
Fire door
2040 x 826 DXF1440 UK P M DXF0460 UK P M
2040 x 926 DXF1450 UK P M DXF0470 UK P M
Firecheck FD60 imperial
Fire door
6'6" x 2'6" DXF0262 UK P6'6" x 2'9" DXF0272 UK P M7'0" x 3'0" DFD0044 M E
Garage doors
Softwood FL&B
Imperial (inch)
6'6" x 7'0" DXG0110† UK F7'0" x 7'0" DXG0220† UK F
2XG/2XGG Hemlock
FL&B L&B
Imperial (inch)
6'6" x 2'0" DXC0530 F6'6" x 2'3" DXC0540 F DXC0640 F6'6" x 2'6" DXT0160 P DXC0560 F DXC0660 F6'6" x 2'9" DXT0170 P M DXC0570 F M DXC0670 F M6'8" x 2'8" DXT0180 P M DXC0580 F M6'10" x 2'10"
Glazing Metric
1019 x 599 DGL01011019 x 675 DGL0121
†Subject to availability Doors overview |265
Joinery door finishes matrix
Internal moulded door
Internal softwood clear
Pine door
Internal softwood
Knotty Pine door
Internal primed
Internal hardwood
veneered door
Internal hardwood solid door
Internal flush ply &
hardboard primed door
Internal flush foil &
veneered door
Sadolin English
Oak interior
stain (750ml)GAR0536 *
Sadolin interior
varnish satin
(1 litre)GAR0539 *
Primer/
Undercoat
(2.5 litre)STN0805 *
Rustin's
Danish oil
(1 litre)GAR0125
Osmo oil
(1 litre)GAR0542
Internal doors
External doors
External hardwood
door
External softwood
door
External ply flush
doorGarage door†
Sadolin Clear exterior base
coat (1 litre)GAR0530
Sadolin Mahogany exterior
stain (1 litre)GAR0531
Sadolin Dark Oak exterior stain
(1 litre)GAR0532
Sadolin Heritage Oak exterior
stain (1 litre)GAR0533
Sadolin Walnut exterior stain
(1 litre)GAR0534
Sadolin clearcoat exterior
varnish satin (1 litre)GAR0510
Sadolin clearcoat exterior
varnish gloss (1 litre)GAR0511
Finish suitable for door range. * To be finished on edges only.
All Howdens doors are suitable for paint finishes. Exterior stains are not suitable for internal applications as they do not adequately protect the door against knocks, scratches
and dents. Interior stains and varnishes are not suitable for external applications as they are not flexible enough to cope with the movement of external doors and do not
protect against UV light. Some finishes may cause the grain to raise slightly. A light sand between coats is recommended.
†Subject to availabilityJoinery door finishes matrix266|
Fire rated matrix
Fire Rating
Aluminium Roundbar latch 19mm DFU0302
Aluminium Roundbar lock 19mm DFU0301
Aluminium Roundbar bathroom 19mm
DFU0303
Aluminium Roundbar Euro profile 19mm
DFU0304
Aluminium Roundbar oval profile 19mm
DFU0305
FD30 FH FH FH FH FH
FD60 FH FH FH FH FH
FD120
Fire Rating
Aluminium Roundbar rose 19mm DFU0300
Lecco Satin Stainless Steel
DFU0471
Cadeby Chrome Effect DFU0835
Turin Satin Stainless Steel
DFU0727
Lago Polished Stainless Steel
DFU0729
FD30 FH FH FH FH FH
FD60 FH FH FH FH FH
FD120
Fire Rating
Stainless Steel Roundbar 19mm
DFU0260
Stainless Steel concealed fixing 12"
DFU0136
FD30 FH FH
FD60 FH FH
FD120
Fire Rating
Edinburgh Chrome Effect latch
DFU0840
Edinburgh Chrome Effect lock
DFU0841
Edinburgh Chrome Effect bathroom
DFU0842
Edinburgh Chrome Effect privacy
DFU0842
Edinburgh Chrome Effect Euro profile
DFU0843
FD30 FH FH FH FH FH
FD60 FH FH FH FH FH
FD120
Fire Rating
Edinburgh Aluminium latch
DFU0085
Edinburgh Aluminium lock
DFU0086
Edinburgh Aluminium bathroom
DFU0087
Edinburgh Aluminium privacy
DFU0087
Edinburgh Aluminium Euro profile
DFU0088
FD30 FH FH FH FH FH
FD60 FH FH FH FH FH
FD120
FH = Essential fire door hardware
p.187
p.187
p.187
p.187
p.187
p.187
p.187
p.187
p.190
Handles
p.190
p.186 p.186 p.186 p.190 p.190
p.186 p.175 p.175 p.176 p.176
p.186 p.207
Fire rated matrix |267
Panic hardware
Fire Rating
Briton double rebated panic set
SCF0076
Briton single panic bolt SCF0078
Briton rim panic latch SCF0077
Briton security push pad SCF0081
Briton outside access device - lever
SCF0074
FD30 FH FH FH FH FH
FD60 FH FH FH FH FH
FD120
Door closers
Fire Rating
Union Retro 3 door closer fixed size
3 Silver DCL0017
Briton 2003.SES door closer fixed size
3 Silver DCL0007
Briton 1110.SES door closer adjustable size
2-4 Silver DCL0012
Eclipse 73 door closer fixed size 3 Silver DCL0019
Briton 121 CE.SES door closer fixed size
3 Silver DCL0001
Concealed closer EB DCL0002
Concealed closer NP DCL0022
4" Satin Stainless Steel self closing
hinge pack HNG0430
FD30 FH FH FH FH FH FH FH
FD60 FH FH FH FH FH FH FH
FD120 FH FH FH FH FH
Locks & latches
Fire Rating
Premium tubular mortice latch 2.5" PB/PSS
LAL0075
Premium tubular mortice latch 3" PB/PSS LAL0076
3" Bathroom bolt with dual striking plate EB/NP
LAL0130
2.5” Bathroom bolt with dual striking plate EB/NP LAL0127
Union StrongBOLT mortice sashlock BS 2.5" EB LAL0042
Union StrongBOLT mortice sashlock BS 3" EB
LAL0043
Union StrongBOLT mortice sashlock BS 2.5" SCP
LAL0044
Union StrongBOLT mortice sashlock BS 3" SCP
LAL0045
Union StrongBOLT mortice deadlock BS 2.5" EB
LAL0046
Union StongBOLT mortice deadlock BS 2.5" SCP
LAL0047
FD30 FH FH FH FH FH
FD60 FH FH FH FH FH
FD120
p.213
p.209
p.208p.207 p.208p.207 p.208p.207 p.208
p.213
p.209
p.215
p.209
p.215
p.209
p.216
p.209
Fire rated matrix
FH = Essential fire door hardware
268|
Fingerplates & kickplates
Fire Rating
Brass 12" x 3" fingerplate DFU0146
Stainless Steel 15" x 3" fingerplate DFU0095
Polished Stainless Steel 12" x 3" fingerplate
DFU0145
Aluminium 12" x 3" fingerplate DFU0107
30"/ H150mm x L762mm SAA kickplate
DFU0157
33"/ H150mm x L838mm SAA kickplate
DFU0106
FH FH FH FH FH
Intumescent accessories
Fire Rating
10mm x 4mm x L2.1m fire & smoke strip Brown
ITS0007
10mm x 4mm x L2.1m fire & smoke strip White
ITS0008
15mm x 4mm x L2.1m fire & smoke strip Brown
ITS0011
15mm x 4mm x L2.1m fire & smoke strip White
ITS0012
20mm x 4mm x L2.1m fire & smoke strip Brown
ITS0013
20mm x 4mm x L2.1m fire & smoke strip White ITS0014
10mm x 4mm x L2.1m fire strip Brown
ITS0005
10mm x 4mm x L2.1m fire strip White
ITS0006
15mm x 4mm x L2.1m fire strip Brown
ITS0009
15mm x 4mm x L2.1m fire strip White
ITS0010
Astro Flame White intumescent mastic 310ml
ITS0020
Everbuild hand held B1 fire rated expanding
foam 750ml GIR0088
4" Intumescent hinge pads (pack of 6)
ITS0030
Intumescent paper pack ITS0050
FD30 FH FH FH FH FH
FD60 FH FH FH
FD120 FH
Hinges
Fire Rating
3" EB Stainless Steel grade
7 washered hinge HNG0111
3" Satin Stainless Steel grade 7 washered hinge
HNG0068
3" Polished Stainless Steel grade 7 washered
hinge HNG0161
4" EB Stainless Steel grade 7 washered hinge
HNG0112
4" Satin Stainless Steel grade 7 washered hinge
HNG0069
4" Polished Stainless Steel grade 7 washered
hinge HNG0160
3" EB Stainless Steel grade 7 ball bearing
hinge HNG0371
3" Satin Stainless Steel grade 7 ball bearing
hinge HNG0370
3" Polished Stainless Steel grade 7 ball
bearing hinge HNG0085
3" Black Nickel Finish 7 ball bearing hinge
HNG0372
4" EB Stainless Steel grade 13 ball bearing
hinge HNG0065
4" Satin Stainless Steel grade 13 ball bearing
hinge HNG0066
4" Polished Stainless Steel grade 11 ball bear-
ing hinge HNG0086
4" EB Stainless Steel Grade 11 ball bearing
hinge HNG0027
4" Satin Stainless Steel grade 11 ball bearing
hinge HNG0025
4" Satin Chrome Steel grade 11 ball bearing
hinge HNG0029
3” Polished Stainless Steel Grade 7 HNG0077
3” Satin Stainless Steel Grade 7 HNG0076
4” Satin Chrome Steel Grade 11 HNG0078
4” Satin Stainless Steel Grade 13 HNG0079
FD30 FH FH FH FH FH FH
FD60 FH FH FH FH
FD120
p.231p.230p.230 p.230p.230p.230
p.133 p.133 p.133 p.133 p.133
p.198 p.198 p.198 p.198 p.198
Fire rated matrix
FH = Non-essential fire door hardware, not FD30/FD60/FD120 specific FH = Essential fire door hardware
|269
Victorian Chrissi
Scroll Brass
page 184
Scroll Chrome
page 184
Brass
page 185
Chrome
page 185
Satin Nickel
page 185Chrome
page 179Satin Nickel page 180
Door handles
Latch DFU0631 DFU0661 DFU0621 DFU0611 DFU0641 DFU0039 DFU0045
Lock DFU0630 DFU0660 DFU0620 DFU0610 DFU0640 DFU0038 DFU0044
Bathroom DFU0632 DFU0662 DFU0622 DFU0612 DFU0642 DFU0031 DFU0032
Privacy DFU0633 DFU0663 DFU0623 DFU0613 DFU0643 DFU0040 DFU0046
Rose DFU0071 DFU0615 DFU0072
Bathroom turn* DFU0441 DFU0442 DFU0442
Euro/oval DFU0616
Matching external
door furniture
Door knocker DFU0165 DFU0164 DFU0165 DFU0164 DFU0166 DFU0164 DFU0166
Cylinder pull DFU0108 DFU0205 DFU0108 DFU0205 DFU0140 DFU0205 DFU0140
Letterplate DFU0100 DFU0233 DFU0100 DFU0233 DFU0099 DFU0233 DFU0099
Door tidy DFU0150 DFU0159 DFU0150 DFU0159 DFU0158 DFU0159 DFU0158
Door chain SCF0005 SCF0008 SCF0005 SCF0008 SCF0008
Door viewer SCF0007 SCF0009 SCF0007 SCF0009 SCF0009
Escutcheon* DFU0207 DFU0206/0777 DFU0207 DFU0206/0777 DFU0215/0775 DFU0206/0777 DFU0215/0775
Matching door
accessories
Coat hook GIR0364 GIR0363 GIR0364 GIR0363 GIR0365 GIR0363 GIR0365
Cabin hook LAL0116/7 LAL0113/4 LAL0116/7 LAL0113/4 LAL0118/9 LAL0113/4 LAL0118/9
Door stop GIR0340/2 GIR0345/6 GIR0340/2 GIR0345/6 GIR0357/8 GIR0345/6 GIR0357/8
BoltSCF0046/
47/48/140/171SCF0141/
47/58/59/63/73SCF0046/
47/48/140/171SCF0141/47
58/59/63/73SCF0166/67
68/69/70SCF0141/47
58/59/63/73SCF0166/67
68/69/70
Pull handle DFU0147 DFU0138 DFU0147 DFU0138 DFU0139 DFU0138 DFU0139
Fingerplate DFU0146 DFU0146
Kickplate
Lock & latch pack LAL1120/30 LAL1102/10/12 LAL1060/70/80/90
Budget lock & latch pack LAL0752 LAL0756
Idro Lugano Garda
Brass
page 181
Chrome
page 181
Satin Nickel
page 181
Chrome
page 183Brass
page 182
Chrome
page 182
Satin Nickel
page 182
Door handles
Latch DFU0601 DFU0604 DFU0830 DFU0905 DFU0701 DFU0705 DFU0719
Lock DFU0600 DFU0603 DFU0831 DFU0904 DFU0700 DFU0704 DFU0720
Bathroom DFU0738 DFU0737 DFU0736
Privacy DFU0602 DFU0605 DFU0832 DFU0906 DFU0702 DFU0706 DFU0721
Rose DFU0907 DFU0819 DFU0820 DFU0821
Bathroom turn* DFU0445 DFU0441 DFU0442 DFU0431
Euro/oval
Matching external
door furniture
Door knocker DFU0165 DFU0164 DFU0166 DFU0164 DFU0165 DFU0164 DFU0166
Cylinder pull DFU0108 DFU0205 DFU0140 DFU0205 DFU0108 DFU0205 DFU0140
Letterplate DFU0100 DFU0233 DFU0099 DFU0233 DFU0100 DFU0233 DFU0099
Door tidy DFU0150 DFU0159 DFU0158 DFU0159 DFU0150 DFU0159 DFU0158
Door chain SCF0005 SCF0008 SCF0008 SCF0005 SCF0008
Door viewer SCF0007 SCF0009 SCF0009 SCF0007 SCF0009
Escutcheon* DFU0207 DFU0206/0777 DFU0215/0775 DFU0206/778 DFU0207 DFU0206/0777 DFU0215/0775
Matching door
accessories
Coat hook GIR0364 GIR0363 GIR0365 GIR0363 GIR0364 GIR0363 GIR0365
Cabin hook LAL0116/7 LAL0113/4 LAL0118/9 LAL0113/4 LAL0116/7 LAL0113/4 LAL0118/9
Door stop GIR0340/2 GIR0345/6 GIR0357/8 GIR0345/6 GIR0340/2 GIR0345/6 GIR0357/8
BoltSCF0046/
47/48/140/171 SCF0141/47
58/59/63/73SCF0166/67
68/69/70SCF0141/47
58/59/63/73SCF0046/
47/48/140/171SCF0141/47
58/59/63/73SCF0166/67
68/69/70
Pull handle DFU0147 DFU0138 DFU0139 DFU0138 DFU0147 DFU0138 DFU0139
Fingerplate DFU0146 DFU0146
Kickplate
Lock & latch pack LAL2020/30/50/92 LAL2060/70/80
Budget lock & latch pack
Handles and matching door furniture
* Dimensions may differ from rose handle.Handles & matching door furniture270|
Handles and matching door furniture
Durham Pewter Edinburgh Aluminium Antique Sofia
Pewter
page 177
Pewter Effect
page 178
Chrome Effect
page 187
Aluminium
page 187
Roundbar
page 186
Black
page 188
Ornate Black
page 188
Black Nickel
page 174
Door handles
Latch DFU0740 DFU0833 DFU0840 DFU0085 DFU0302 DFU0034 DFU0028
Lock DFU0741 DFU0834 DFU0841 DFU0086 DFU0301 DFU0033 DFU0029
Bathroom DFU0743 DFU0842 DFU0087 DFU0303
Privacy DFU0842 DFU0087
Rose DFU0742 DFU0755 DFU0300
Bathroom turn* DFU0731 DFU0756 DFU0313 DFU0313 DFU0035 DFU0035 DFU0482
Euro/oval DFU0843 DFU0088 DFU0304/5
Matching external
door furniture
Door knocker
Cylinder pull
Letterplate DFU0233 DFU0239 DFU0239 DFU0096 DFU0096
Door tidy
Door chain
Door viewer
Escutcheon* DFU0732 DFU0776 DFU0777 DFU0773 DFU0773 DFU0216
Matching door
accessories
Coat hook GIR0363 GIR0367 GIR0367 GIR0366 GIR0366
Cabin hook LAL0110 LAL0110
Door stop GIR0345/46 GIR0343/4 GIR0343/4
BoltSCF0141/
58/59/63/73SCF0041/
45/172SCF0041/
45/172 SCF0067 SCF0067
Pull handle DFU0138 DFU0141/44 DFU0141/42/43 DFU0137 DFU0137
Fingerplate DFU0107 DFU0107
Kickplate DFU0106/157 DFU0106/157
Lock & latch pack LAL0166/68
Budget lock & latch pack
Ledro Newington Mortice Knobs Commercial
Black Nickel
page 174
Polished/Satin
Chrome page 175
Brass
page 189
Chrome
page 189
Satin Nickel
page 189
Stainless Steel
page 206
Door handles
Latch DFU0050 DFU0063 DFU0751
Lock
Bathroom
Privacy
Rose DFU0260
Bathroom turn* DFU0482 DFU0432 DFU0441 DFU0442 DFU0431 DFU0270
Euro/oval
Matching
external
door
furniture
Door knocker DFU0165 DFU0164 DFU0166
Cylinder pull DFU0108 DFU0205 DFU0140
Letterplate DFU0100 DFU0233 DFU0099
Door tidy DFU0150 DFU0159 DFU0158
Door chain SCF0005 SCF0008
Door viewer SCF0007 SCF0009
Escutcheon* DFU0216 DFU0781 DFU0207 DFU0206/0777 DFU0215/0775 DFU0774
Matching
door
accessories
Coat hook GIR0364 GIR0363 GIR0365
Cabin hook LAL0116/7 LAL0113/4 LAL0118/9
Door stop GIR0340/2 GIR0345/6 GIR0357/8
BoltSCF0046/47/
48/140/171SCF0141/47
58/59/63/73SCF0166/67
68/69/70
Pull handle DFU0147 DFU0138 DFU0139 DFU0136
Fingerplate DFU0146 DFU0094/145
Kickplate
Lock & latch pack
Budget lock &
latch pack
Handles & matching door furniture |271
Matching flooring accessories
Whatever type of flooring you choose from our range, we offer all the accessories you need for the perfect finish.
Scotia trim creates a neat edge to skirting boards; pipe roses make tidy work of radiator pipes; L sections help
you deal with steps or hearths; threshold strips cover the join from room to room; and ramp strips smooth the
transition between different types of flooring.
Scotia
(1.85m)
Scotia
(2.1 - 2.4m)
Pipe Rose
(Pack of 4)
Threshold Strip
(900 - 910mm)
Threshold Strip
(970mm)
Threshold Strip
(2.1m)
Ramp Strip
(900 - 970mm)
L Section
(910mm)
L Section
(970mm)
Howdens Solid
Wood
Pre-finished
Solid Oiled Oak SDH2201
SDH3052 P SDH3090 P SDH5520 UK P SDH5521 UK P
SDH5530 UK P
SDH5540 UK PSolid Oiled Oak SDH2202
Solid Oiled Oak SDH2203
Solid Oiled Oak SDH2204
Solid Oiled Oak SDH2300 SDH4314 SDH4311 SDH4312 SDH4313
Solid Oak (17% Gloss) SDH3052 P SDH3090 P SDH5520 UK P SDH5521 UK P SDH5530 UK P SDH5540 UK P
Howdens
Real Wood
Pre-finished
Fast Fit Oak 3 Strip
SDH3220
SDH3052 P SDH3090 P SDH3021 F SDH3023 F SDH3031 F SDH3041 FFast Fit Oak single plank
wide SDH3630
Fast Fit Oak single plank
SDH3612
Fast Fit Chestnut Oak
single plank wide SDH3631SDH6550 F SDH3090 P SDH6520 UK F SDH6521 UK F SDH6530 UK F SDH6540 UK P
Light Grey Oak 3 Strip
SDH3635
Dark Oak 180mm SDH3637
Light White Oak 180mm
SDH3638
Light Grey Oak 180mm
SDH3636
4 in 1 backed
underlayFoam underlay
High
performance
underlay (XPS)
Damp proof
membrane
Paintable
damp proof
membrane
Bitumen
moisture barrier
paper
Howdens Solid
Wood
Pre-finished
Solid Oiled Oak SDH2201
Solid Oiled Oak SDH2202
Solid Oiled Oak SDH2203
Solid Oiled Oak SDH2204
Solid Oiled Oak SDH2300
Solid Oak (17% Gloss)
Howdens
Real Wood
Pre-finished
Fast Fit Oak 3 Strip
SDH3220
SDH0915 SDH0900 UK SDH0909 UK SDH0910 UK SDH0931 UK SDH0932 UK
Fast Fit Oak single plank
wide SDH3630
Fast Fit Oak single plank
SDH3612
Fast Fit Chestnut Oak
single plank wide SDH3631
Light Grey Oak 3 Strip
SDH3635
Dark Oak 180mm SDH3637
Light White Oak 180mm
SDH3638
Light Grey Oak 180mm
SDH3636
Matching flooring accessories272|
Matching flooring accessories
Scotia
(2.4m)
Pipe Rose
(Pack of 4)
Sealant
(310ml)Hydro Foam Kit Quickstep Incizo
Threshold Strip
(900mm &
2.7m)
Ramp Strip
(900mm)Profile A Profile B
Quickstep Livyn
Click Fit Vinyl
Classic Oak Natural
SDH3680
Canyon Oak Grey SDH3681
Silk Oak Dark Grey SDH3682
Vintage Chestnut Natural
SDH3683
Cottage Oak Dark Brown
SDH3684
Oak Light Natural SDH3685
Canyon Oak Beige SDH3689
Black Slate SDH3686
Cream Travertine SDH3687
Light Grey Travertine
SDH3688
Howdens
Professional Click
Fit Vinyl
Oak SDH3641
Light Oak SDH3640
Light Tile SDH3643
Quickstep
Impressive
Oak SDH2402 SDH2412SDH0088 SDH0089
SDH2410SDH0940 SDH0942
Grey Oak SDH2401 SDH2413 SDH2411
Howdens
Professional Fast
Fit V Groove
Oak SDH3576 SDH4960 P
SDH0290 UK SDH0091SDH8021 P* SDH8030 P
SDH0940 SDH0942
Tawny Chestnut Oak
SDH3583SDH0961 P
American Pecan SDH3577 SDH7150 P SDH7120 P SDH7130 P
Rustic Chestnut SDH3581 SDH7350 P SDH0490 UK GAR0106 UK SDH7320 P SDH7330 P
Hickory SDH3575 SDH8050 P SDH0290 UK SDH0091 SDH8030 P
Smoky Hickory SDH3584 SDH0961 P
SDH0895
GAR0106 UKDark Grey Oak SDH3582 SDH6150 P SDH6120 P SDH6130 P
Light Grey Oak SDH3578
SDH6250 P
SDH0097 UK
SDH6220 P SDH6230 PWhite Washed Oak
SDH3590SDH0091
Grey Oak SDH3591 SDH0097 UK
Light Oak SDH3592 SDH0090
Dark Oak SDH3595
GAR0106 UKBlack Oak SDH3596
Matching flooring accessories
* Code SDH8021 strips are 2.7m in length.
|273
Matching flooring accessories
Profile FClear Edge
T-Bar
4 in 1 backed
underlay*
Foam
underlay
High
Performance
underlay
(XPS)*
Selitbloc Vinyl
underlay
Damp proof
membrane
Paintable damp
proof
membrane
Bitumen
moisture
barrier
paper
Quickstep Livyn
Click Fit Vinyl
Classic Oak Natural
SDH3680
SDH4120 SDH0926 SDH0931 UK SDH0932 UK
Canyon Oak Grey SDH3681
Silk Oak Dark Grey SDH3682
Vintage Chestnut Natural
SDH3683
Cottage Oak Dark Brown
SDH3684
Oak Light Natural SDH3685
Canyon Oak Beige SDH3689
Black Slate SDH3686
Cream Travertine SDH3687
Light Grey Travertine
SDH3688
Howdens
Professional Click
Fit Vinyl
Oak SDH3641
SDH4120 SDH0926 SDH0931 UK SDH0932 UKLight Oak SDH3640
Light Tile SDH3643
Quickstep
Impressive
Oak SDH2402
SDH0945 SDH0915 SDH0900 UK SDH0909 UK SDH0910 UK SDH0931 UK SDH0932 UKGrey Oak SDH2401
Howdens
Professional Fast
Fit V Groove
Oak SDH3576
SDH0945 SDH0915 SDH0900 UK SDH0909 UK SDH0910 UK SDH0931 UK SDH0932 UK
Tawny Chestnut Oak
SDH3583
American Pecan SDH3577
Rustic Chestnut SDH3581
Hickory SDH3575
Smoky Hickory SDH3584
Dark Grey Oak SDH3582
Light Grey Oak SDH3578
White Washed Oak
SDH3590
Grey Oak SDH3591
Light Oak SDH3592
Dark Oak SDH3595
Black Oak SDH3596
* Not suitable for use with underfloor heating.Matching flooring accessories274|
Scotia
(2.4m)
Pipe Rose
(Pack of 4)
Sealant
(310ml)
Threshold Strip
(900mm)
Threshold Strip
(2.4m)
Threshold Strip
(2.7m)
Ramp Strip
(900mm)
Ramp Strip
(2.4m)
Black
skirting
(L2.4m)
Howdens
Professional
Oak SDH3572 SDH4961 P SDH0290 UK SDH0091 SDH8020 P SDH8021 P SDH8030 P
Light Oak SDH3573 SDH6350 P SDH0290 UK GAR0106 UK SDH6320 P SDH6330 P
Dark Grey Oak SDH3574 SDH6150 P SDH0895 SDH0097 UK SDH6120 P SDH6130 P
Light Grey Oak SDH3588 SDH6450 P SDH0896 UK SDH0097 UK SDH6420 P SDH6430 P
Walnut SDH3570 SDH7350 P SDH0490 UK SDH0095 SDH7320 P SDH7330 P
Rustic Hickory SDH3720 SDH4960 P SDH0290 UK SDH0091 SDH8020 P SDH8021 P SDH8030 P
Grey Oak SDH3722 SDH6150 P SDH0895 SDH0097 UK SDH6120 P SDH6130 P
Dark Brown SDH3721 SDH0290 UK GAR0106 UK
Howdens
Oak SDH2094 SDH7450 P SDH0290 UK SDH0091 SDH7420 P SDH7430 P
3 Strip Oak SDH2096 SDH7450 P SDH0290 UK SDH0091 SDH7420 P SDH7430 P
Light Oak SDH2093 SDH6350 P SDH0190 GAR0106 UK SDH6320 P SDH6330 P
3 Strip Oak SDH3587 SDH6250 P SDH0895 SDH0097 UK SDH6220 P SDH6230 P
3 Strip White Washed Oak
SDH2112SDH6450 P SDH0896 UK GAR0106 UK SDH6420 P SDH6430 P
Howdens
Professional
Continuous Tiles
Natural Stone SDH2082
SDH0961 PGAR0106 UK
Limestone SDH2083
Light Stone SDH2088
Black Slate SDH2084 SDH7950 P SDH7920 P SDH7930 P MOD0540
Howdens
Professional Fast
Fit V Groove Tile
Light Travertine SDH3668
SDH0961 P
GAR0106 UK
Marble SDH3586
Grey Slate SDH3585
Travertine SDH3667
Basalt Slate SDH3670 SDH7950 P SDH7920 P SDH7930 P MOD0540
White Slate SDH3598
SDH0961 PConcrete SDH3599
Midnight Slate SDH3600 SDH7950 P SDH7920 P SDH7930 P MOD0540
Grey Stone SDH3601 SDH0961 P
Howdens
Professional
Decorative Tiles
Grey Chevron SDH2076 SDH6150 P SDH0895 SDH0097 UK SDH6220 P SDH6230 P
Oak Chevron SDH2075 SDH4961 P SDH0290 UK SDH0091 SDH6320 P SDH6330 P
Random Effect
TileSlate SDH3689 SDH7950 P GAR0106 UK SDH7920 P SDH7930 P MOD0540
Fast Fit Tile Slate SDH2089 SDH7950 P GAR0106 UK SDH7920 P SDH7930 P MOD0540
Matching flooring accessories
Matching flooring accessories |275
Profile A Profile B Profile F4 in 1 backed
underlay*Foam underlay
High
performance
underlay
(XPS)*
Damp proof
membrane
Paintable
damp proof
membrane
Bitumen
moisture
barrier
paper
Howdens
Professional
Oak SDH3572
SDH0940 SDH0942 SDH0945 SDH0915 SDH0900 UK SDH0909 UK SDH0910 UK SDH0931 UK SDH0932 UK
Light Oak SDH3573
Dark Grey Oak SDH3574
Light Grey Oak SDH3588
Walnut SDH3570
Rustic Hickory SDH3720
Grey Oak SDH3722
Dark Brown SDH3721
Howdens
Oak SDH2094
SDH0940 SDH0942 SDH0945 SDH0915 SDH0900 UK SDH0909 UK SDH0910 UK SDH0931 UK SDH0932 UK
3 Strip Oak SDH2096
Light Oak SDH2093
3 Strip Oak SDH3587
3 Strip White Washed Oak
SDH2112
Howdens
Professional
Continuous Tiles
Natural Stone SDH2082
SDH0940 SDH0942 SDH0945 SDH0915 SDH0900 UK SDH0909 UK SDH0910 UK SDH0931 UK SDH0932 UKLimestone SDH2083
Light Stone SDH2088
Black Slate SDH2084
Howdens
Professional Fast
Fit V Groove Tile
Light Travertine SDH3668
SDH0940 SDH0942 SDH0945 SDH0915 SDH0900 UK SDH0909 UK SDH0910 UK SDH0931 UK SDH0932 UK
Marble SDH3586
Grey Slate SDH3585
Travertine SDH3667
Basalt Slate SDH3670
White Slate SDH3598
Concrete SDH3599
Midnight Slate SDH3600
Grey Stone SDH3601
Howdens
Professional
Decorative Tiles
Grey Chevron SDH2076
SDH0940 SDH0942 SDH0945 SDH0915 SDH0900 UK SDH0909 UK SDH0910 UK SDH0931 UK SDH0932 UKOak Chevron SDH2075
Random Effect
TileSlate SDH3689 SDH0940 SDH0942 SDH0945 SDH0915 SDH0900 UK SDH0909 UK SDH0910 UK SDH0931 UK SDH0932 UK
Fast Fit Tile Slate SDH2089 SDH0940 SDH0942 SDH0945 SDH0915 SDH0900 UK SDH0909 UK SDH0910 UK SDH0931 UK SDH0932 UK
Matching flooring accessories
* Not suitable for use with underfloor heating.Matching flooring accessories276|
Cottage Oak triple glazed door Burford architrave & skirting
Quick fit bathroom boltHowdens Professional Marble tile
Edinburgh latch handle
Square spindles
Product information correct at time of publication in February 2018
The company has a policy of continuous product development and reserves the right
to change any products and specifications given in this brochure. Subject to the Terms
and Conditions of Trading, a copy of the Howdens Joinery Terms and Conditions is
available upon request. Photography is for illustration purposes only, some products
may differ from those shown. The colours in this brochure are as accurate as printing
processes allow. Natural wood products may vary slightly in tone.
February 2018 ISSUE (XBR8674)
Howden Joinery Ltd, First Floor, 40 Portman Square, London, W1H 6LT.Registered in England 526923
www.howdens.com
This brochure is printed on FSC® certified paper