A transposon-based strategy to identify the regulatory gene network responsible for landomycin E...

Acc

epte

d A

rtic

le

This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process, which may lead to differences between this version and the Version of Record. Please cite this article as doi: 10.1111/1574-6968.12117 © 2013 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved

Received Date : 14-Jan-2013 Revised Date : 28-Feb-2013 Accepted Date : 01-Mar-2013 Article type : Research Letter Editor: Paul Hoskisson

A transposon-based strategy to identify the regulatory gene network responsible for

Landomycin E biosynthesis

Lilya Horbal1,2, Viktor Fedorenko2, Andreas Bechthold3 and Andriy Luzhetskyy1*

1Helmholtz-Institute for Pharmaceutical Research Saarland, Campus, Building C2.3

Saarbrücken 66123, Germany

2Ivan Franko Lviv national University Department of Genetics and

Biotechnology,Grushevskogo st.4, Lviv, 79005, Ukraine

3Albert-Ludwigs-University of Freiburg, Pharmazeutische Biologie und Biotechnologie,

Stefan-Meier-Str. 19, Freiburg 79104, Germany.

Running title: Transposon mutagenesis of Streptomyces globisporus

Keywords: transposon mutagenesis, actinobacteria, natural products overproducers,

landomycins

*Corresponding author:

Tel. +4968130270215; E-mail: [email protected]

Acc

epte

d A

rtic

le

© 2013 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved

Abstract

We report here a transposon-based strategy to generate Streptomyces globisporus 1912

mutants with improved landomycin E production. The modified minitransposon with strong,

outward-oriented, promoters for the overexpression of downstream situated genes has been

applied for mutant library generation. Approximately, 2500 mutants of S. globisporus 1912

were analyzed for landomycin E production, leading to the identification of several

overproducers. Subcloning and sequencing of the sites of integration showed that some of the

inactivated genes encode proteins with similarity to known bacterial regulators such as TetR

and LuxR families. One of the regulators (GntR type) has shown the strongest influence on

the landomycin E production. Its ortholog (encoded by sco3269) in S. coelicolor was

characterized in greater detail and showed similar effects on actinorhodin production and

morphological differentiation.

Introduction

Analysis of Actinobacteria genomes revealed that they are an even richer source of

bioactive secondary metabolites than previously expected. However, the full exploitation of

the biosynthetic potential of these bacteria is not a trivial task. The majority of biosynthetic

gene clusters responsible for the natural product biosynthesis are not expressed strongly

enough to yield compounds in sufficient quantity that can be detected with modern analytical

methods. For this reason the production level usually needs to be improved in order to

perform structure elucidation and further bioactivity studies of the corresponding natural

products (Zotchev et al., 2012). The expression of the natural product biosynthetic gene

clusters in actinobacteria is usually tightly regulated by complex regulatory networks (Kutas

et al., 2012). The ability to target this regulatory machinery and, as a consequence, to

increase the production level of secondary metabolites would strongly facilitate the drug

discovery process. Traditionally, the secondary metabolites production improvement has

been carried out by the random mutagenesis of producers induced with the UV irradiation

and/or different chemical mutagens. Although this approach has been successful, it does not

allow one to understand the basis of the overproduction of natural products. Recently, an

efficient and robust mutagenesis system based on Tn5 and Himar1 transposons has been

described for Streptomyces lividans and S. coelicolor. The advantages of the described

strategies are a high mutagenesis frequency and simple identification of the insertion locus,

which can be done by sequencing the individually generated rescue plasmids. S. lividans and

Acc

epte

d A

rtic

le


S. coelicolor are two model actinomycetes strains with very well established genetic systems.

Therefore, the efficiency of described transposons in other, not so well-studied species, is still

to be investigated. We selected the S. globisporus strain producing landomycin E – an

antitumor natural product. The biosynthetic gene cluster involved in the biosynthesis of

landomycin E has been sequenced and functions of several regulatory genes have been

characterized (Rebets et al., 2003; Rebets et al., 2005; Dutko et al., 2006; Ostash et al.,

2011).

We present here a transposon based strategy to identify regulatory gene loci of

landomycin E production outside of its biosynthetic gene cluster. A mutant library of S.

globisporus 1912 was generated using a Tn5-based transposon (Petzke & Luzhetskyy, 2009),

and then screened for the enhanced levels of landomycin E relative to the wild type strain,

using HPLC–UV analysis. This methodology identified five S. globisporus mutants which

significantly over-produced landomycin E. Detailed analysis revealed a global GntR type

regulatory protein affecting secondary metabolite production. Targeted inactivation of its

ortholog in S. coelicolor showed similar phenotype and influence on an actinorhodin and

undecylprodigiosin biosyntheses.

Materials and Methods

Bacterial strains, plasmids, and culture conditions

All strains and plasmids are listed in Table 1. E. coli DH5α (Life Technologies) was used for

routine subcloning. E. coli ET12567 harboring the conjugative plasmid pUB307 was used to

perform intergeneric conjugation from E. coli to Streptomyces species (Flett et al., 1997;

Luzhetskyy et al., 2006). For plasmid and total DNA isolation, E. coli, S. globisporus and S.

coelicolor strains were grown as described by Sambrook and Russell (2001), Kieser et al.

(2000). For landomycin E production, S. globisporus strains were grown in liquid SG

medium (Rebets et al., 2003). For actinorhodin and undecylprodegiosin production, S.

coelicolor strains were grown in liquid or on solid mediums: TSB, MYM, NL5, and R2YE

(Kieser et al., 2000, Shimana et al., 2011). X-gal and IPTG were used for blue-white colony

selection in the case of the pKC1218E vector as described elsewhere (Kieser et al., 2000;

Sambrook & Russell, 2001).

DNA manipulations

Isolation of chromosomal DNA from streptomycetes and plasmid DNA from E. coli were

carried out using standard protocols (Kieser et al., 2000). Restriction enzymes and molecular

Acc

epte

d A

rtic

le


biology reagents were used according to recommendation of suppliers (Thermo Scientific,

NEB, Promega).

Construction of plasmids

The SpeI DNA fragment carrying tcp830 promoter has been excised from pUC57tetRA (Table

1) and cloned into XbaI site of the vector pMODTM-3 (Table 1) yielding pMO3. An

apramycin resistance cassette flanked by two loxP sites was excised from pLERECJ using

EcoRV and inserted into the SmaI site of pMO3 resulting in pMOAM. The KpnI-EcoRI

DNA fragment from pUC57tetRA containing ermEp1 was inserted into pMODTM-3 giving

pMEry. The minitransposon containing two outwards promoter and an apramycin resistance

gene was generated after inserting a 1,3 kb PstI-KpnI-DNA fragment of pMOAM into the

same sites of pMEry. Finally, the PvuII fragment containing minitransposon was ligated into

EcoRV of pAL-tnp (Petzke & Luzhetskyy, 2009) to generate pALTEAm (Fig. 1), which was

used to perform transposon mutagenesis in vivo.

A 0.9 kb fragment carrying the whiG gene was amplified from the chromosomal DNA

of S. coelicolor M145 using primers whiGF (5’ AAAGGAAGGAAATGCCCCAGCACA 3’)

and whiGR (5’ AAGAATTCAGCGGCCCGCGTC 3’). The amplified DNA fragment was

cloned into EcoRV of pKC1218E in the orientation to yield an antisense RNA. As a result

pKCEwhiGas was obtained.

A 0.882 kb DNA fragment containing sco3269 gene was amplified from the

chromosomal DNA of S. coelicolor M145 using primers GntRF (5’

ATCCAGCGATCACTTTGAGTG 3’), GntRRev (5’ ATCACCCGTCATCCCATGCCCT

3’) and cloned into the EcoRV-digested pKC1218E to give pKCEGntR.

Cosmid StE39sco3269::aac was obtained by substitution of sco3269 with the

apramycin resistance gene from pIJ774 using RedET (Gust et al., 2003) and the primers

SCO3269inactFor (5’

TTAACTAGGTTAGAGCTAGTGGACTAGATTTTCCATATGATTCCGGGGATCCGTC

GACC 3’) and SCO3269inactRev (5’

TGCCGGTCACGAGACCGTACCGCCAGCGGCGAGGACTCATGTAGGCTGGAGCTG

CTTC 3’).

A 2.4 kb fragment containing the sco3269 gene was amplified from the chromosomal

DNA of the S. coelicolor wild type strain using primers SCO3269Forw (5’

GTGCATACGACCTCACTGCGT 3’), SCO3269Rev (5’

Acc

epte

d A

rtic

le


GCGTTGATGTCGGACGTGGATG 3’) and cloned into EcoRV digested pKC1139 to give

pKCSCO3269.

Analysis of landomycin E by HPLC-MS

In order to analyze secondary metabolite production, S. globisporus wild type and mutants

were grown in 100 ml of SG. Cultures were extracted with ethylacetate. The extracts were

then evaporated and redissolved in methanol. In each case, three independent cultures were

analyzed. HPLC-UV-MS analysis was carried out on an Agilent 1100 series LC/MS system

by electrospray ionization (ESI) and detection in the positive and negative mode. The LC-

system was equipped with a Hewlett Packard ZORBAX SB C-18 column (5μm particle size,

4.6 x 12,5 mm), and a ZORBAX Eclipse XDB-C8 (5μm particle size, 4.6 x 150 mm)

maintained at 30°C. A non-linear gradient over 30 min at a flow rate of 0.7 ml min with 0.5

% acetic acid in H2O as solvent A and CH3CN as solvent B was used. The gradient started

with 20% and ended with 95% CH3CN. The detection wavelength was 254 nm.

Quantification of landomycin E production was performed by comparison of integrated peak

areas. Landomycin E was used as a reference.

Analysis of actinorhodin and undecylprodigiosin production. Actinorhodin and

undecylprodigiosin were analyzed as previously described (Kieser et al., 2000). A culture

grown in 50 ml TSB liquid medium was filtered, and the supernatant and pellet were

separated. For actinorhodin, KOH was added to the supernatant to a final concentration of 1

M, and the optical density at 640 nm was determined. For undecylprodigiosin, the pellet was

dried under a vacuum and extracted with 10 ml methanol (pH 2) overnight at the room

temperature. The optical density at 530 nm was then measured.

Rescue plasmid generation and recovery

Genomic DNA of S. globisporus 1912 and the respective transposon mutants was digested

either with NotI or SacII, and self-ligated with T4-DNA ligase according to the

manufacturer’s instructions. The ligated DNA was transferred into E. coli TransforMax™

EC100D™ pir-116 electrocompetent cells (Epicentre, Madison) by electroporation (E. coli

pulser BIO-RAD™). Plasmids were isolated from the obtained transformants with the

Wizard® Plus SV Minipreps DNA Purification System (PROMEGA™) according to the

manufacturer’s instructions. Chromosome-Tn5 junction sequences were determined using the

Acc

epte

d A

rtic

le


sequencing primers pMODseq-f (5’ GCCAACGACTACGCACTAGCCAAC 3’) and

pMODseq-r (5’ GAGCCAATATGCGAGAACACCCGAGAA 3’).

Generation and verification of sco3269-deficient S. coelicolor strain.

The sco3269 gene disruption was done via double crossover according to the procedure

(Kieser et al., 2000), using StE39sco3269::aac. The Amr Kms S. coelicolor ΔSCO3269 strain,

which carries replacement of sco3269 with sco3269::aac allele, was generated. The gene

replacement event was proven by amplification of sco3269 from S. coelicolor M145 (wild

type) and S. coelicolor ΔSCO3269 (sco3269-mutant) strains. Approximately 1.115 kb DNA

fragment corresponding to sco3269 was amplified from M145, whereas 1.782 kb DNA

fragment was amplified from ΔSCO3269, indicating that wild type copy of sco3269 was

replaced by the mutated one.

Electron microscopy.

For electron microscopy thin slices of lawn grown on Soy-Mannitol, oatmeal or TSB agar

plates were prepared and fixed in 1% OsO4 in cacodylate buffer for 90 min at 0oC. The

samples were dehydrated with successive solutions containing increasing concentration of

ethanol and examined using electron microscope Jeol JSM-T220A.

Results and Discussion

1.1 Construction of the transposon vector pAL-TEAm containing synthetic Tn5-based

transposon flanked by two outwards-oriented promoters

In most cases, transposon insertions lead to the loss-of-function mutations of the gene into

which they were inserted. Therefore, we have constructed a transposon, flanked with the two

outward oriented promoters, which would cause the high-level transcription of the adjacent

genes. Two different promoters – a constitutive strong promoter ermEp1 and an inducible

synthetic promoter tcp830 were inserted into the Tn5-derived minitransposon to yield the

vector pALTEAm, which contains the synthetic transposase gene (tnp(a)) transcribed from

the thiostrepton inducible promoter (tipAp) and the minitransposon consisting of an

apramycin resistance gene flanked by two loxP sites, two outwards-oriented promoters and

an origin of replication (oriR6K). In addition, this vector contains a temperature sensitive

origin of replication (ori pSG5) which is readily lost after incubation above 37°C for 2 days.

The pALTEAm-based transposon system has two significant advantages over previously

Acc

epte

d A

rtic

le


published Tn5 minitransposons. Firstly, it contains two outward-facing strong promoters

ensuring the expression of downstream situated genes and allowing the identification

“cryptic” and/or silent genes. Secondly, the presence of two loxP sites enables the removal of

the apramycin reistance gene from the chromosome of transposon mutants and reuse of the

same resistance marker for further genetic manipulations (gene expression, inactivation etc).

1.2 Transposon mutagenesis in S. globisporus 1912

To generate a collection of mutants with the changes in production of landomycin E and/or

morphological differentiation, we performed in vivo transposon mutagenesis using pAL-

TEAm according to the scheme described earlier by Petzke (Petzke & Luzhetskyy, 2009).

Following cultivation on SG agar plates, approximately 2500 transposon mutants were

screened for landomycin E production. Landomycin E has the absorption maximum at 450

nm and therefore S. globisporus colonies producing the compound are orange to brown

colored. Thus, we were able to preselect the transposon mutants with the altered landomycin

E production. Five selected mutants were grown on larger scale (100 ml) and analyzed for

LaE production by HPLC-UV (Fig. 2). The DNA regions flanking the transposon insertions

from the above mentioned mutants have been sequenced and analyzed. Annotation of the

sequenced regions revealed several regulatory genes involved in landomycin E production

and S. globisporus sporulation.

In the strain S. globisporus S10 yielding the highest amount of landomycin E (Fig. 2b)

the affected gene encodes a GntR-type regulator. The closest homologues are ZP_08237327

from S. griseus, YP_004924037 from S. flavogrisues, ZP_06578980 from S. ghanaensis and

SCO3269 from S. coelicolor (% identities?). Functions of these orthologues are not yet

studied. However, there are several well-known GntR-regulators that are involved in the

regulation of morphological differentiation and/or antibiotic production in Streptomyces. For

example, DasR and DevA in S. coelicolor (Rigali et al., 2006; Rigali et al., 2008; Hoskisson

et al., 2006) and LndYR in S. globisporus (Ostash et al., 2011). All aforementioned proteins

are pleiotropic regulators which repress expression of different target genes. We suppose that

identified gene encodes a negative regulator of landomycin E production.

S. globisporus S21 produces 5 fold less of landomycin E in comparison to the wild type

(Fig. 2b). The transposon had been introduced within the intergenic region of the S.

globisporus S21 chromosome between the genes encoding a putative TetR-protein and a

copper chaperon. The closest homologues of the putative TetR regulator are ZP_11384166

(91% identity) from S. globisporus C-1027, ZP_04708450 (88% identity) from S.

Acc

epte

d A

rtic

le


roseosporus and ZP_08238536 (76% identity) from S. griseus. The ermEp1 promoter from

the minitransposon was inserted in front of the TetR-repressor gene, which might lead to its

enhanced transcription. This is likely to be the reason for the decreased landomycin E

production (Ramos et al., 2005).

In S. globisporus S67, which produces approximately 3 times more of landomycin E

(Fig. 2b), the transposon insertion was detected in the gene of the putative ROK-type

regulator. Closest homologues of the putative product of this gene are regulators

ZP_04708323 (98% identity) from S. roseosporus and SGR_4874 (95% identity) from S.

griseus. In most cases these types of regulators function as repressors. For instance, the ROK-

type regulator (GlkA) of S. coelicolor plays an essential role in glucose repression of a variety

of genes involved in the utilization of alternative carbon sources (Angell et al., 1994).

Upstream of the gene coding a ROK-type regulator in S. globisporus there is a gene encoding

a putative ABC-transporter that could be involved in the transport of sugars. We suppose that

inactivation of this regulatory gene lead to increased expression of the transporter gene that

could be the main reason of the elevated landomycin E production.

The integration site in S. globisporus S85 and S41 occurs within the gene encoding a

LuxR-type regulator, which shares a high similarity to SCO3818 from S. coelicolor.

SCO3818 is a part of the two-component regulatory system and is involved in the repression

of actinorhodin biosynthesis (Wang et al., 2009). Therefore, we predict that identified LuxR

encoding gene is a part of regulatory networks responsible for landomycin E biosynthesis in

S. globisporus as well.

During screening we have identified several strains that are characterized by altered

sporulation in addition to landomycin E biosynthesis. One strain, S. globisporus S4, doesn’t

form the spores (Fig. 3) and produces in approximately 2.5 times more of landomycin E (Fig.

2b). Annotation of the insertion locus revealed the gene encoding DprA (DNA processing

protein) (Mortier-Barrière et al., 2007) with no assigned regulatory function. However, a

gene encoding a protein with high similarity (98 % identity) to the σ-factor WhiG was

identified 400 bp upstream to the inserted minitransposon. It is known, that WhiG is involved

in the regulation of the differentiation of aerial hyphae into mature grey spores and

inactivation of this gene in different Streptomyces strains block the development of mature

spores (Keleman et al., 1996; Chater & Chandra, 2006). In the S. globisporus S4 strain the

WhiG encoding gene is facing ermEp1 promoter from the minitransposon, which might lead

to the synthesis of the antisense-RNA of whiG. To verify this hypothesis, we cloned whiG

under ermE* in the opposite orientation and introduced this construct into the S. globisporus

Acc

epte

d A

rtic

le


wild type strain. The obtained mutant showed weak sporulation on the oatmeal agar

compared to wild type, but no changes in landomycin E production (Fig. 3). Thus, the

increased level of landomycin E in the S. globisporus S4 could not be explained.

Nevertheless, we note that the gene knock down using antisense RNA is a reliable method to

quickly determine the function of a gene.

1.4 Deletion of the sco3269 influences antibiotic production and morphological

differentiation

The most pronounced effect on the biosynthesis of landomycin E had inactivation of the

putative GntR type regulator. Taking into account that this type of regulators is least studied

in Streptomyces and that the identified regulator has one or several highly homologous

counterparts in different actinomyces strains, we decided to investigate whether its

homologue will have any effect on antibiotic production in the model strain, S. coelicolor. A

homology search against the S. coelicolor genome demonstrated that there are several

homologues (orthologues?) of the GntR regulator from S. globisporus. The deduced gene

product of sco3269 showed the highest sequence similarity (78 % identity) to aforementioned

regulator.

The sco3269 gene has been deleted from the chromosome of S. coelicolor using the cosmid

StE39sco3269::aac modified by RedET. To obviate polar effects on adjacent genes due to the

integration of the apramycin resistant marker the later was removed using Cre-recombinase

(Fedoryshyn et al., 2008). The gene deletion was confirmed by PCR and further sequencing

(data not shown).

The mutant strain ΔSCO3269 has altered morphology and secondary metabolite production

profile similar to the corresponding transposon mutant of S. globisporus. In contrast to the

wild type strain the mutant produces an abundant lawn of aerial mycelium on NL5, TSB,

MYM mediums (Fig. 4). Microscopic analysis and comparison of the mutant and wild type

strains revealed that at the same stage of growth on TSB medium, the mutant displayed

coiled, septated aerial hyphae as well as mature spores, whereas the wild type strain did not

(Fig. 4b). However, ΔSCO3269 had growth and morphological characteristics identical to

those of S. coelicolor M145 when grown on R2YE (Fig. 4a) or MM with glucose, mannitol

or sucrose. Analysis of the secondary metabolite production in different mediums revealed

that the mutant produces approximately 2.5 times more of the actinorhodin and 1.6 times

more of the undecyprodigiosine in liquid TSB medium (Fig.1S). Complementation

Acc

epte

d A

rtic

le


experiments were carried out to confirm that the changes in the morphology and antibiotic

production were caused by the deletion of sco3269. We failed to complement the mutant with

the intact gene (pKCEGntR) in trans. In contrast, replacement of the sco3269::aac allele with

the sco3269 gene on the chromosome restored the wild type phenotype. This might indicate

that the sco3269 gene dosage is very important. Therefore, we have performed the expression

of the sco3269 gene under ermE* in S. coelicolor M145. The recombinant strain carrying

additional copies of the sco3269 gene doesn’t form grey spore pigment on any medium tested

(Fig. 5a). On the MS medium the M145 pKCEGntR+ recombinant strain forms aerial

mycelium with a pale-grey phenotype (Fig. 5a). Since mutants lacking or having less spore

pigment are frequently spore defective (Hopwood et al., 1970), we used microscopic analysis

to evaluate aerial mycelium development and sporulation of M145 pKCEGntR+ on MS agar.

In contrast to the abundant spore chains on the surface of the wild-type strain (Fig. 5b), SEM

of the recombinant strain’s surface reveals many long and unbranched aerial hyphae (Fig.

5b). Some hyphae have a small number of apparently normal spore chains. Even some spores

seem to differ in size and shape (Fig. 5b). Thus, spore formation in the recombinant strain

M145 pKCEGntR+ even on MS agar is severely impaired. In addition, the M145 pKCEGntR+

mutant produces two times less of actinorhodin and nearly the same amount of

undecylprodigiosin as a control strain (M145 pKC1218E+) in the liquid TSB medium (Fig.

1S)

In summary, we have designed and constructed a modified Tn5 minitransposon, which

contains not only antibiotic resistance marker, but also strong outward-oriented promoters for

targeting genes settled downstream to the insertion. To demonstrate the utility of the

established transposon system, we have obtained several landomycin E overproducing

mutants and have identified several novel regulators responsible for LaE and actinorhodin

production in S. globisporus and S. coelicolor, respectively. This work also demonstrates that

the transposon-based mutagenesis can be efficiently applied to a non-model streptomyces

strain. In addition, due to the loxP sites flanking the resistance marker of the transposon, it is

possible to remove the marker efficiently from the chromosome and reutilize it in further

experiments. Thus, the transposon-based technology may become a practical strategy to

improve the level of the natural products synthesis in actinobacteria. The ability to identify a

transposon site of integration will help to identify novel regulatory circuits involved in the

regulation of natural product biosynthesis.

Acc

epte

d A

rtic

le


Acknowledgements

This work was supported by a DFG grant (Lu1524/2-1) to AL. Authors are very grateful to

Prof. David Zechel for the critical reading of the manuscript.

References

Angell S, Lewis CG, Buttner MJ & Bibb MJ (1994) Glucose repression in

Streptomyces coelicolor A3(2): a likely regulatory role for glucose kinase. Mol Gen

Genet 244(2): 135-143.

Bierman, M, Logan R, O'Brien K, Seno ET, Rao RN & Schoner BE (1992) Plasmid cloning

vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp.

Gene 116:43-49.

Chater KF & Chandra G (2006) The evolution of development in Streptomyces analysed by

genome comparisons. FEMS Microbiol Rev 30(5): 651-672.

Dutko L, Rebets Y, Ostash B, Luzhetskyy A, Bechthold A, Nakamura T & Fedorenko V

(2006) A putative proteinase gene is involved in regulation of landomycin

E biosynthesis in Streptomyces globisporus 1912. FEMS Microbiol Lett 255(2): 280-

285.

Fedoryshyn M, Welle E, Bechthold A & Luzhetskyy A. (2008) Functional expression of

the Cre recombinase in actinomycetes. Appl Microbiol Biotechnol 78(6): 1065-1070.

Flett F, Mersinias V & Smith C (1997) High efficiency intergeneric conjugal transfer of

plasmid DNA from Escherichia coli to methyl DNA-restricting Streptomyces. FEMS

Microbiol Lett 155: 223-229.

Gust B, Challis GL, Fowler K, Kieser T & Chater KF (2003) PCR-

targeted Streptomyces gene replacement identifies a protein domain needed for

biosynthesis of the sesquiterpene soil odor geosmin. Proc Natl Acad Sci USA

100(4):1541-1546.

Hanahan D (1985) Techniques for transformation of Escherichia coli. In DNA Cloning.

Edited by D. M. Glover. Oxford, UK: IRL Press 109–135.

Hopwood DA, Wildermuth H & Palmer HM (1970) Mutants of Streptomyces coelicolor

defective in sporulation. J Gen Microbiol 61(3): 397-408.

Acc

epte

d A

rtic

le


Hoskisson PA, Rigali S, Fowler K, Findlay KC & Buttner MJ (2006) DevA, a GntR-like

transcriptional regulator required for development in Streptomyces coelicolor. J

Bacteriol 188(14): 5014-5023.

Kelemen GH, Brown GL, Kormanec J, Potúcková L, Chater KF & Buttner MJ (1996) The

positions of the sigma-factor genes, whiG and sigF, in the hierarchy controlling the

development of spore chains in the aerial hyphae of Streptomyces coelicolor A3(2). Mol

Microbiol 21(3): 593-603.

Kieser T, Bibb MJ, Buttner MJ, Chater KF & Hopwood DA (2000) Practical Streptomyces

genetics. The John Innes Foundation, Norwich.

Kutas P, Feckova L, Rehakova A, Novakova R, Homerova D, Mingyar E, Rezuchova B,

Sevcikova B, & Kormanec J. (2012) Strict control of auricin production in

Streptomyces aureofaciens CCM 3239 involves a feedback mechanism. Appl Microbiol

Biotechnol. In press.

Luzhetskyy A, Fedoryshyn M, Gromyko O, Ostash B, Rebets Y, Bechthold A & Fedorenko

V (2006) IncP plasmids are most effective in mediating conjugation between

Escherichia coli and Streptomyces. Genetica 42: 595-601.

Mortier-Barrière I, Velten M, Dupaigne P et al. (2007) A key presynaptic role in

transformation for a widespread bacterial protein: DprA conveys incoming ssDNA to

RecA. Cell 130(5): 824-836.

Muth G, Nussbaumer B, Wohlleben W, Puhler A (1989) A vector system with temperature-

sensitive replication for gene disruption and mutational cloning in Streptomycetes. Mol

Gen Genet 6:1–8

Ostash B, Rebets Y, Myronovskyy M (2011) Identification and characterization of the

Streptomyces globisporus 1912 regulatory gene lndYR that affects sporulation and

antibiotic production. Microbiology 157(Pt 4): 1240-1249.

Petzke L & Luzhetskyy A (2009) In vivo Tn5-based transposon mutagenesis of

Streptomycetes. Appl Microbiol Biotechnol 83: 979-986.

Ramos J, Martinez-Bueno M, Molina-Henares A et al. (2005) The TetR family of

transcriptional repressors. Microbiol Mol Biol Rev 69: 326-356.

Rebets Y, Ostash B, Luzhetskyy A et al. (2003) Production of landomycins in

Streptomyces globisporus 1912 and S. cyanogenus S136 is regulated by genes encoding

putative transcriptional activators. FEMS Microbiol Lett 222(1): 149-153.

Acc

epte

d A

rtic

le


Rebets Y, Ostash B, Luzhetskyy A et al. (2005) DNA-binding activity of LndI protein and

temporal expression of the gene that upregulates landomycin E production in

Streptomyces globisporus 1912. Microbiology 151(Pt 1): 281-90.

Rigali S, Titgemeyer F, Barends S et al. (2008) Feast or famine: the global

regulator DasR links nutrient stress to antibiotic production by Streptomyces. EMBO

Rep 9(7): 670-675.

Rigali S, Nothaft H, Noens EE et al. (2006) The sugar phosphotransferase system of

Streptomyces coelicolor is regulated by the GntR-family regulator DasR and links N-

acetylglucosamine metabolism to the control of development. Mol Microbiol 61(5):

1237-1251.

Sambrook J & Russell D (2001) Molecular cloning, a laboratory manual, 3rd edn Cold Spring

Harbor Laboratory, Cold Spring Harbor, NY.

Schimana J, Walker M, Zeeck A & Fiedler H-P (2001) Simocyclinones: diversity of

metabolites is dependent on fermentation conditions. J Ind Microbiol Biotechnol 27:

144–148.

Wang W, Shu D, Chen L, Jiang W & Lu Y (2009) Cross-talk between an orphan response

regulator and a noncognate histidine kinase in Streptomyces coelicolor. FEMS

Microbiol Lett 294(2): 150-156.

Zotchev SB, Sekurova ON, Katz L. (2012) Genome-based bioprospecting of microbes for

new therapeutics. Curr Opin Biotechnol. 23(6): 941-947.

Fig. 1. Schematic representation of the Tn5 modified transposon with two promoters. ME

mosaic end recognition sequence for transposase, R6Kγ ori origin of replication in E. coli

pir+ cells, aac3(IV) apramycin resistance gene, loxP – short sequence recognized by Cre

recombinase, tcp830 tetracycline resistance gene promoter, ermEp1 erythromycin gene

resistance promoter.

Fig. 2. Landomycin E production in S. globisporus strains. (a) HPLC analysis of landomycin

E from wild type strain: mass spectrum (1 – positive ion mode, 2 – negative ion mode), UV

spectrum (3) and chemical structure of landomycin E. (b) Level of landomycin E production

of S. globisporus strains. Each value represents the average of three different experiments.

Fig. 3. Phenotype of S. globisporus wild type (a), S4 strain (b) and 1912 pKCEwhiGas+ (c).

Strains were grown on oatmeal medium for 5 days.

Fig. 4. Effect of sco3269 inactivation on morphology. (a) Phenotype of S. coelicolor M145

and sco3269 mutant on different mediums. Strains were grown at 28°C for 4-5 days. (b)

Acc

epte

d A

rtic

le


Electron microscopy images of the surfaces of the wild type strain M145 and ΔSCO3269

mutant. Both strains were grown on TSB medium for 5 days at 28°C.

Fig. 5. Effect of additional copies of the sco3269 gene on morphological differentiation and

secondary metabolite production. (a) Phenotypes of the S. coelicolor wt and M145

pKCEGntR+ recombinant strains on different mediums. Strains were grown at 28°C for 4-5

days. (b) Electron microscopy images of the surfaces of the recombinant strains M145

pKC1218E+ and M145 pKCEGntR+ (for details see text). Both strains were grown on MS

medium for 5 days at 28°C.

Table 1. Strains and plasmids used in this work.

Bacterial strains and plasmids

Description Source or reference

E. coli DH5α E. coli ET12567/ pUB307 E. coli TransforMax™ EC100D™ pir-116 S. globisporus 1912 S. coelicolor M145 S. coelicolor ΔSCO3269 pMODTM-3 pUC57tetRA pKC1218 pKCEwhiGas pKCEGntR StE39sco3269::aac

supE44 ΔlacU169(φ80lacZΔM15) hsdR17 recA1endA1gyrA96 thi-1 relA1dam-13::Tn9(Cmr) dcm-6 hsdM; harbors conjugative plasmid pUB307; Cmr, Kmr F- mcrA Δ(mrr-hsdRMS-mcrBC) φ80dlacZΔM15 ΔlacX74 recA1 endA1 araD139 Δ(ara, leu)7697 galU galK λ- rpsL (StrR) nupG pir-116(DHFR) landomycin E producer prototroph SCP1- SCP2-

M145 with disrupted sco3269 gene Tn5 containing vector pUC57 derivative containing synthetic tetracycline inducible promoter and constitutive erythromycin promoter Replicative vector for actinomycetes containing oriT, SCP2rep, oripUC18, aac(3’)IV pKC1218E derivative carrying whiG gene under ermEp in the antisense orientation pKC1218E derivative containing sco3269 gene under the control of ermEp StE39 derivative containing mutant allele of the sco3269 gene

Hanahan, 1985 Flett et al., 1997 Epicentre, Madison Prof. B. Matselukh,Institute of Microbiology and Virology, NAS of Ukraine Kieser et al., 2000 This work Epicentre; Madison, USA GeneScript; Piscataway, USA Bierman et al.,1992 This work This work This work

Acc

epte

d A

rtic

le

© 2013 Federation of European Microbiological Societies. Published by Blackwell Publishing

Fig. 1.

Fig. 2.

(a)

(b)

landomycin E production

0

5

10

15

20

25

wt S4 S10 S21 S41 S67 S85

strain

lan

do

myc

in E

mg

/L

m/z732 734 736 738 740

0

5

10

Pos Scan

Max: 100568

735.3 711.3

Max: 289152

m/z700 720 740 760

0

50

Neg Scan

0 5 10 15 20 25

mAU

0255075

100125

16.7871

2 3

OCH3

OH

OCH3

OHO

OCH3

OOH

O

OO

OHOH CH3

OH

4

min

aac3(IV) tcp830 ermEp1 oriγ RK6

ME ME

loxP loxP

Acc

epte

d A

rtic

le


Fig. 3.

Fig. 4.

(a)

(b)

Fig. 5.

(a)

(a) (b) (c)

MYM

M145 pKC1218+

NL5

pKC1218E+ΔSCO3269

pKCEGntR+

M145 pKCEGntR+

MS MS MS

1218+ pKCEGntR+

NL5 TSB

M145 M145 ΔSCO3269

R2YE

M145 ΔSCO3269 ΔSCO3269

wild type ΔSCO3269

Acc

epte

d A

rtic

le


(b)

M145 pKC1218E+

M145 pKCEGntR+

M145 pKC1218E+

M145 pKCEGntR+

A transposon-based strategy to identify the regulatory gene network responsible for landomycin E...

Documents

Transcript of A transposon-based strategy to identify the regulatory gene network responsible for landomycin E...