Regína Ósk Einarsdóttir Eldgosasaga íslands síðustu 12.000 árin.
A quick course in genetics part 1 by Elísabet Einarsdóttir [email protected] 7....
-
date post
22-Dec-2015 -
Category
Documents
-
view
215 -
download
1
Transcript of A quick course in genetics part 1 by Elísabet Einarsdóttir [email protected] 7....
CellsDNA, genes & chromosomesRNA & transcriptionMeiosis & mitosisMendelChromosome recombinationsGenetic & physical distancesUses for genetics & genomes
General outline
CellsDNA, genes & chromosomesRNA & transcriptionMeiosis & mitosisMendelChromosome recombinationsGenetic & physical distancesUses for genetics & genomes
CellsDNA, genes & chromosomesRNA & transcriptionMeiosis & mitosisMendelChromosome recombinationsGenetic & physical distancesUses for genetics & genomes
p1p2
p5
p3p4
q3
q5q4
q2q1
q6q7
p-arm of chromosome (short arm)
q-arm of chromosome (long arm)
Chromosome banding
E.g. linkage of a disease to 2q7.2
Chromosomal abnormalities
Turner syndrome – only one X chromosome
Downs syndrome – 3 copies of chr 21
CellsDNA, genes & chromosomesRNA & transcriptionMeiosis & mitosisMendelChromosome recombinationsGenetic & physical distancesUses for genetics & genomes
The splicing of RNA
Ready-to-use mRNA
Unspliced RNA copy of DNA
DNA template
exon intron exon exon exon exonintron intron intron
Alternative splicing of RNA
Different functions of different splice variantsDifferent expression of different splice variantsDominant-negative variants
Amino acids
• Amino acids link together to form a long chain• R (side chain) – varies between amino acids • There are 20 different amino acids
Ribosomes translate 3-base sequences intoamino acid chains – the building blocks for proteins
RNA “copy of DNA”AAGCUGAGAUCAGUUCGGAUACCGUA
Note: T in DNA becomes U in RNA
amino acid chain
ribosome
In-frame: THE FAT CAT ATE THE BIG HAT1 bp deletion: THF ATC ATA TET HEB IGH AT1 bp added: THE FAT CCA TAT ETH EBI GHA T
The importance of being in-frame
CellsDNA, genes & chromosomesRNA & transcriptionMeiosis & mitosisMendelChromosome recombinationsGenetic & physical distancesUses for genetics & genomes
Meiosis – only during reproduction
Egg cells from mother
Sperm cellfrom father
An offspringHalf of the chr from mother, half from father
CellsDNA, genes & chromosomesRNA & transcriptionMeiosis & mitosisMendel Chromosome recombinationsGenetic & physical distancesUses for genetics & genomes
Loci, alleles & markers
A locus is any point (or region) in the genome
A genetic marker is anything in the genome that is variableand can be used to compare individuals
If a locus is variable, distinct alleles (forms) of the locus(e.g. a gene or marker) can be defined and analyzed A genotype is the set of alleles an individualhas at a particular locus
A phenotype is a visible trait in an individual (e.g. blue eyes or the presence of a disease)
Gregor Mendel (1822-1884)- the austrian monk with a passion for peas
•The law of segregation
Each individual carries two copies (alleles) of every gene and only one of these is transmitted to each child
•The law of independent assortment
Alleles from unlinked loci are assorted independently
Mendel´s experiment with peas
Punnet´s square:½ Ss = smooth¼ SS = smooth¼ ss = Wrinkled
S: smooth genes: mutated smooth gene
• In each individual a trait is determined by two copies (alleles) of the same gene, one paternal and one maternal
• Only one of the two parental alleles is transmitted to each child but with equal probability
50% A 50% a
50% A 25%AA 25%Aa
50% a 25%Aa 25%aa
Mother Aa
Father Aa
Principles of Mendelian analysis-First law
Principles of Mendelian analysis- Second law
-The principle of independent segregation applies independently to gene pairs determining different traits
- Alleles from unlinked loci are assorted independently
50% A 50% a
50% B 25%AB 25%aB
50% b 25%Ab 25%ab
Aa
Bb
• A child always inherits one copy of each chromosome from each of the parents (meiosis, Mendel’s fist law)
• Any deviation from this can be pathogenic, e.g. Turner syndrome (only one X) and Downs syndrome (3 copies of chr 21)
• A girl has two X chromosomes (one from each parent), a boy one X and one Y chromosome (X from mother, Y from father) – implications for X-linked diseases
• Each chromosome is inherited independently of the other one, which copy of a parents chromosomes the child inherits is thus random (Mendel’s second law)
Some points to note
CellsDNA, genes & chromosomesRNA & transcriptionMeiosis & mitosisMendel Chromosome recombinationsGenetic & physical distancesUses for genetics & genomes
Recombination of parental chromosomes - a source of variation & essential for looking at
genetic distances & mapping disease
• Recombinations happen only during meiosis (during the generation of egg- or spermcells).
• Recombinations occur in each generation, usuallyat least once per chromosome
• Recombinations are in theory random, but in principlethe likelyhood of recombinations at a particular point in the genome is quite variable
• Almost no recombination at the centrimere, higher frequency of recombinations closer to the telomeres
Some points on recombinations
CellsDNA, genes & chromosomesRNA & transcriptionMeiosis & mitosisMendelChromosome recombinationsGenetic & physical distancesUses for genetics & genomes
Physical distance- Mb
• The lowest-resolution physical map is the chromosomal map, based on the banding patterns observed by microscopy of stained chromosomes.
• More detailed radiation hybrid maps are made by breaking the chromosomes into small pieces. If two markers map to the same small fragment they are likely to be close together.
• The highest-resolution physical map is the complete sequencing of each chromosome in the genome
Physical maps can be divided into three general types: chromosomal or cytogenetic maps, radiation hybrid maps, and sequence maps.
Centimorgan (cM): a unit of chromosome length, equals the length of chromosome over which crossing-over occurs with 1 per cent frequency
A Ba b
A b
Recombination between locus A and locus BIf 1% of meiosis result in recombinant chromosomes=> 1cM between A and B
Genetic distance- cM
CellsDNA, genes & chromosomesRNA & transcriptionMeiosis & mitosisMendelChromosome recombinationsGenetic & physical distancesUses for genetics & genomes
Uses for genetics
Mapping disease
Genetic tests for known diseases
Microbial genomics
Forensics
Paternity tests
Development of medicines - pharmacogenomics
Breeding of animals and plants
Phylogenic studies & evolution
Human Genome Project
Founding partners:U.S. Department of Energy National Institutes of Health (NIH) Wellcome Trust As well as groups in Japan, France, Germany, and China
Aims: To generate a high-quality reference DNA sequence for the human genome‘s 3 billion base pairs and to identify all human genes.
Also to sequence the genomes of model organisms to interpret human DNA, enhance computational resources to support future research and commercial applications, explore gene function through mouse-human comparisons, study human variation, and train future scientists in genomics.
•The human genome consists of 3 billion bases (A, C, T, and G).
•The function of 50% of known genes is unknown.
•The human genome sequence is almost (99.9%) exactly the same in all people.
• A human genome is 97% like a chimp genome, 75% of the mouse genome
•Over 40% of the predicted human proteins share similarity with fruit-fly or worm proteins.
•Chromosome 1 (the largest human chromosome) has the most genes (2968), and the Y chromosome has the fewest (231).
After the Human Genome Project