A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan

Click here to load reader

  • date post

    14-Jun-2015
  • Category

    Law

  • view

    128
  • download

    1

Embed Size (px)

description

A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan

Transcript of A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan

  • 1. Vinita Radhakrishnan

2. PATENT SYSTEM RIGHTS v. DUTY DUTY SPECIFICATION DESCRIPTION SUFFICIENCY ENABLEMENT BEST MODE CLAIMS CLEAR AND UNAMBIGUOUS 3. Claims define the metes and bounds of aninvention Claim Limits the extent of protection What is not claimed is disclaimed! Claims determine the value of your patent Each claim is a representation of your invention. Single sentence ending with a period. 4. Implications of Claiming too broadly Claiming too narrow Claiming just right: This is an art and requires lots of imagination Claim must be adequately supported by the description Must avoid Not claiming what the client wants Claiming what the client does not use or need 5. Cannot broaden the claims of a granted patent Cannot broaden the disclosure and the claimsbeyond what has been included when drafting theapplication that was filed You are responsible for getting the scope ofprotection the inventor deservesYou do not get a second chance 6. Three parts Introductory Phrase Introduces the subject matter of the invention Body defines a particular embodiment of theinvention Transition Phrase joins the introductory phrase and the body ofclaim Open ended v. close ended claims 7. I claim a pencil having an eraser fastened to oneend. Introductory phrase - a pencil Transition phrase having Body an eraser fastened to one end 8. Independent Claims Do not depend on any other claim Generally defines the essential novel features of themost preferred embodiments of a product or a process. A pencil having an eraser fastened to one end. 9. Dependent Claims Depend on either an independent claim or anotherdependent claim Multiple-dependent claims The pencil as in claim 1, where said eraser isfastened to said pencil on one end using anadhesive. The pencil as claimed in claim 1 and 2 whereinthe said adhesive is glue. 10. Process Claims A Process Claim is used for process inventions and hasto clearly define the steps involved in the process. Product Claims A product claim may be claimed as an apparatus, asystem, a device, an article or any other product. 11. Markush Claims Product by process claims Fingerprint claims Structure Claim Composition Claim Gene Sequence claim Diagnostic method claim 12. To Generalize is the Key 13. The feline mammal occupying, a wholly if notentirely sedentary position, a horizontally-spreadwoven textile floor-covering, as is sometimes butnot always the case". 14. Generalize to such an extent that your patent isclose to prior art but can be clearly differentiatedfrom the prior art 15. Product claims Process claims 16. New Chemical entity including a molecule or acompound Combination Compositions 17. A chemical molecule developed in the earlydiscovery stage which later translates into adrug product is generally referred to as a newchemical entity. Actual molecular structure of the NCE in the claim 18. A compound having the formulaScope of protection rendered by the claim stated in theillustration is limited to the compound bearing the molecularstructure. 19. Include a chemical entity along with the variousvariants of the same Close ended claims Claim by grouping 20. A compound having the formulaWherein X is selected from a group consisting of Cl, Br, F and I. 21. When the exact structure is not known butthe characteristics of the structure issufficient to distinguish the compound fromexisting prior art.e.g.:What is claimed isA chemical entity characterized by molecular weightof 280, having a pH of 6.5, which has a melting pointof 123 degree Celsius and a boiling point of 180degree Celsius. 22. When the product cannot be clearly defined andis best defined by the process of preparing thesame 23. Polyjuice potion: A potion that transforms one person to another person hedesires to look and sound likeWhat is claimed is a potion prepared by: Mixing 12 lacewing flies that have been stewed for 21 days; 1 ounce of crude Antimony; 4 leeches that have been unsucculated; 1 pinch of powdered horn of a Bicorn that has been "lunarextracted; and Extract of The-Transfigured-Being-To-Befollowed by 21 days of brewing in a oak barrel. 24. Reference is made to the specification Usually not allowed in most jurisdiction Its a play safe claiming strategy 25. A compound for treating Hemophilia, wherein thecompound is substantially as discussed in thespecification. 26. Novel Combination product patents includingtwo or more already known chemicalcompounds. These compounds may be available in thepublic domain. But so long as the combination isnovel, they can be patented. A composition claim usually shall includeseveral components both essential and nonessential for the invention. 27. What is claimed isA shampoo composition comprising a. 25 % of Alkyl ether sulphate; b. 10% of Dimethicone; c. 2% of imidazole and d. 63% water. 28. What is claimed is1. A shampoo composition comprising 20- 30% of at least one Surfactant; 5-15% of at least one conditioning agent; 1-3% of at least one anti fungal agent and water.2. The shampoo composition as claimed in claim 1,wherein the antifungal agent is selected from agroup consisting of pyrazole, imidazole, triazole,tetrazole and pentazole.3. The shampoo composition in claim 1 wherein saidanti fungal agent is imidazole. 29. A shampoo composition comprising 20- 30% of at least one Surfactant; 5-15% of at least one conditioning agent; 1-3% of at least one anti fungal agent and Waterwherein the antifungal agent is selected from a group consistingof pyrazole, imidazole, triazole, tetrazole and pentazole. 30. A process claim enumerates the step wiseprocess for manufacturing the compound orformulation Steps to be enumerated in the logical order. 31. A process for preparing a modifiedphosphocalcic compound comprising:a) adding a gem-biphosphonic acid or an alkali metal oralkaline-earth metal salt thereof to a suspension of aprecursor phosphocalcic compound in ultrapure water;b) stirring the reaction medium at room temperature andc) recovering the formed compound there from bycentrifugation. 32. Biphenyl Propionic acid 33. A compound wherein the compound isWhat is claimed is a compound whereinring P is an aromatic ring optionally having substituent(s),ring Q is an aromatic ring optionally further having substituent(s)besides YCOOH,and X and Y are each independently a spacer, or a salt thereof or aprodrug thereof. 34. Nothing is unfair when you define the scope ofyour invention. Examiners are always stingy 35. Product related claims Process related claims 36. Gene sequence Amino Acid sequence Vector and host used for expression of the gene An antibody against the protein / sequence and akit made from the antibody / sequence 37. What is claimed is An isolated nucleic acid comprising a nucleic acidsequenceATGGGCCTAACGTGAGGGAATTCGAAATTOr What is claimed is An isolated nucleic acid molecule comprising a nucleicacid Sequence of SEQ ID no. 1. 38. A nucleic acid molecule comprising a nucleic acidsequence that hybridizes to SEQ ID no.1 understringent conditions. 39. A nucleic acid molecule comprising1) SEQ ID no.1OR2) a nucleic acid sequence that hybridizes toSEQ ID no.1 under stringent conditions 40. What is claimed is An isolated nucleic acid molecule which encodes apolypeptide comprising the amino acid sequenceMet Ala Asp Asp Cys Glu Phe Val Gly Ser Ala ValOr An isolated nucleic acid molecule which encodes apolypeptide comprising the amino acid sequence ofSEQ ID NO 2. 41. Vector: A vector comprising a nucleic acid molecule as claimedin Claim 1. Host Cell: A transgenic host cell that contains the vectorcomprising a nucleic acid molecule comprising thenucleic acid sequence of SEQ ID no.1. 42. Isolated Antibody: An isolated antibody or fragment thereofcomprising the amino acid sequence of ofSEQ ID no. 2. Antibody Kit: A kit comprising the antibody or fragmentthereof of claim 1. 43. Method of expression claims Biotechnological process claims 44. A method of expressing a target protein orpolypeptide comprising the steps of: A) transfecting a host cell with the expression vector ofclaim 2; B) culturing the host cell transfected with theexpression vector under conditions that permitexpression of the target protein or polypeptide; and C) isolating the target protein or polypeptide. 45. A process for making an insulin precursor or aninsulin analog precursor, said method comprising(i) culturing a host cell comprising a polynucleotidesequence encoding an insulin precursor or aninsulin analog precursor according to claim 1 undersuitable culture conditions for expression of saidprecursor; and(ii) isolating the expressed precursor. 46. Product Process 47. A diagnostic kit used for detecting malaria antibodiesin a biological sample comprising of the proteinencoded by SEQ ID NO.1 where the said protein isbrought in contact with the biological sample underappropriate conditions which allow the formation of animmune complex, wherein said peptide is labeled witha detectable label. 48. A method for in vitro diagnosis of malaria antibodies in abiological sample, comprising(i) contacting said biological sample with a compositioncomprising a protein encoded by SEQ ID no1 underappropriate conditions which allow the formation of animmune complex, wherein said peptide is labeled with adetectable label, and(ii) detecting the presence of said immune complexesvisually or mechanically. 49. An isolated nucleic acid encoding a flavonoidmethyltransferase molecule bearing the SEQ IDno 1 and its amino acid sequence bearing SEQID no 2 50. An isolated nucleic acid molecule according to any one ofclaims 1 to 3 having the nucleotide sequence comprising:(i) a nucleotide sequence set forth in SEQ ID NO:1;(ii) a nucleotide sequence capable of hybridizing underlow stringency conditions to SEQ ID NO: 1 or itscomplementary form;(iv) a nucleotide sequence