A Novel Tctex2-Related Light Chain is Required for Stability and ...
Transcript of A Novel Tctex2-Related Light Chain is Required for Stability and ...
Submitted to the Journal of Biological Chemistry on 10th December 2003 and in revised form on 26th January 2004
A Novel Tctex2-Related Light Chain is Required for Stability of Inner Dynein Arm I1 and Motor Function in the
Chlamydomonas Flagellum
Linda M. DiBella¶, Elizabeth F. Smith§, Ramila S. Patel-King¶, Ken-ichi Wakabayashi¶, and Stephen M. King¶*
¶Departments of Biochemistry and Molecular, Microbial, and Structural Biology
University of Connecticut Health Center 263 Farmington Avenue
Farmington, Connecticut 06030-3305
and
§Department of Biological Sciences
Dartmouth College Hanover,
New Hampshire 03755
Tel: (860) 679 3347 Fax: (860) 679 3408
Email: [email protected]
*To whom correspondence should be addressed
Key Words: Chlamydomonas / flagella / axoneme / dynein / microtubule
Running Title: Tctex2b is Required for Dynein Motor Function
JBC Papers in Press. Published on March 11, 2004 as Manuscript M313540200
Copyright 2004 by The American Society for Biochemistry and Molecular Biology, Inc.
by guest on April 3, 2018
http://ww
w.jbc.org/
Dow
nloaded from
ABSTRACT
Tctex1 and Tctex2 were originally described in mice as putative distorters/sterility
factors involved in the non-Mendelian transmission of t haplotypes. Subsequently, these
proteins were found to be light chains of both cytoplasmic and axonemal dyneins. We
have now identified a novel Tctex2-related protein (Tctex2b) within the Chlamydomonas
flagellum. Tctex2b copurifies with inner arm I1 following both sucrose gradient
centrifugation and anion exchange chromatography. Unlike the Tctex2 homologue
within the outer dynein arm, analysis of a Tctex2b-null strain indicates that this protein is
not essential for assembly of inner arm I1. However, lack of Tctex2b results in an
unstable dynein particle that disassembles following high salt extraction from the
axoneme. Cells lacking Tctex2b swim more slowly than wild-type and exhibit a reduced
flagellar beat frequency. Furthermore, using a microtubule sliding assay, we observed
that dynein motor function is reduced in vitro. These data indicate that Tctex2b is
required for the stability of inner dynein arm I1 and wild-type axonemal dynein function.
2
by guest on April 3, 2018
http://ww
w.jbc.org/
Dow
nloaded from
INTRODUCTION
The dynein microtubule-based molecular motor performs a variety of functions
within eukaryotic cells (1,2). Ciliary and flagellar dyneins comprise the inner and outer
arms of the axoneme and provide the power necessary for the motility of these
organelles. Within flagella of the unicellular green alga Chlamydomonas, the apparently
homogeneous ~ 2 MDa outer arms are assembled at 24 nm intervals along the length of
the A tubules of the outer doublet microtubules. This motor complex helps define the
beat frequency of the flagellum and provides ~ 4/5 of the power output (3,4). Flagellar
waveform is regulated by a complex inner arm system comprised of seven dynein
subspecies (reviewed in (5,6)). Indeed, strains that lack various subsets of inner arms
exhibit defects in waveform associated with reductions in shear amplitude (4).
Subspecies f, or inner arm I1 contains 2 HCs (1α and 1β), three ICs (IC110, IC138, and
IC140) and several LCs, including LC8 and Tctex1 (7-13). Both the 1α and 1β HCs are
essential for the assembly of inner arm I1 (9,14) and a truncated 1β HC fragment
containing the N-terminal ~113 kDa but lacking the motor domain is sufficient for this
activity (14). Of the three identified ICs, IC140 is an essential component and is
involved in the localization of this motor (10,11). In addition, crosslinking experiments
indicate that IC140 is closely associated with IC110 (11). Genetic and biochemical
studies have revealed that inner arm I1 is involved in the regulation of microtubule
sliding through phosphorylation (15-18). IC138 is the only phosphorylated subunit of
inner arm I1, and plays an integral role in the control of dynein motor function
(16,17,19).
3
by guest on April 3, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Two inner arm I1 LCs have previously been identified, including the highly
conserved 10 kDa protein LC8 and Tctex1 (13). In Chlamydomonas, LC8 is also found
in the outer arms and radial spokes, and is required for intraflagellar transport (IFT)
(13,20,21). Tctex1 is a member of the Tctex1/Tctex2 family of dynein LCs (13,22) that
includes rp3 (23) and the Chlamydomonas outer arm subunit LC2 (24). The Tctex1 and
Tctex2 genes were initially identified in mice within a 30-40 Mb region of chromosome
17 referred to as the t-complex, and are both candidates for distorter/sterility factors
which play roles in the non-Mendelian inheritance of variant forms of this chromosome
known as the t-haplotypes (25,26). Tctex1 is also a component of cytoplasmic dynein
(22) and participates in a variety of motor/cargo interactions that include an association
with rhodopsin within the vertebrate photoreceptor (27). LC2 is a Tctex2 homologue
(24) that is essential for the assembly of the Chlamydomonas outer dynein arm within the
flagellar axoneme (28).
In this study, we describe an additional member (here called Tctex2b) of the
Tctex1/Tctex2 family of LCs in Chlamydomonas. This novel flagellar component
associates with inner arm I1 but, unlike the Tctex2 homologue in the outer arm, is not
essential for its assembly. Interestingly however, Tctex2b plays a role in maintaining the
stability of this dynein complex. Furthermore, mutants lacking Tctex2b swim more
slowly than wild-type and show consistently slower velocities in an in vitro microtubule
sliding assay. These data suggest that Tctex2b is required for wild-type axonemal motor
function.
4
by guest on April 3, 2018
http://ww
w.jbc.org/
Dow
nloaded from
MATERIALS AND METHODS
Strains and Media.
The following strains of Chlamydomonas reinhardtii were used in this study: cc124
(wild-type), oda9, ida1, ida4, pf14, pf18 and pf28 (obtained from the Chlamydomonas
Genetics Center, Duke University), pf28pf30 (from Dr. Winfield Sale, Emory
University), A54-e18 (pf16-D2 parental strain), pf16A, pf16-D2, pf16-D2HA4C, pf16-
D2HA5A, pf16-D2pf28, and pf16-D2λ8b (Table 1). Methods for the generation of the
pf16 insertional allele (pf16-D2) as well as transformation of the pf16A and pf16-D2
strains with the wild-type PF16 gene were described previously (29). The pf16-D2λ8b
strain was generated by cotransformation of the pf16-D2 strain with the pArg7.8 plasmid
and λ clone “8b” as previously described (29). The double mutant strain pf16-D2pf28
transformed with the wild-type PF16 gene was constructed from crosses of pf16-D2pf28
with pf16-D2 transformed with the wild-type PF16 gene. The strain of interest was
identified in nonparental ditype tetrads as a very slow swimmer.
To generate the pPF16-HA constructs, an HA-tag encoding three copies of the 9–
amino acid hemagglutinin epitope [(3xHA, obtained from Dr. Carolyn Silflow (30)] was
amplified with flanking MluI sites and then ligated into MluI-digested pb6D2 (31)
resulting in the 3xHA tag inserted after D418 (148 residues from the carboxy terminus).
pf16, arg- cells were cotransformed with 1µg each of the pPF16-HA and pARG7.8 (32)
plasmids using the glass bead method (33). Successful transformants were identified as
swimming cells and then further analyzed by western blot and immunoelectron
microscopy using antibodies to the HA-tag (Santa Cruz Biotechnology, Inc.) as
5
by guest on April 3, 2018
http://ww
w.jbc.org/
Dow
nloaded from
previously described (31). The presence of two central tubules and correct localization of
PF16-HA were verified.
All cells were grown in Tris-Acetate-Phosphate (TAP) media. pf16A, pf28, A54-
e18 and all pf16-D2-related strains were grown under continuous light.
Purification of Axonemes and Dynein.
Wild-type and mutant strains of C. reinhardtii were deflagellated with dibucaine
using standard methods and demembranated with 1% IGEPAL CA-630 (Sigma Cat #I-
3021; replaces Nonidet P-40) (34). For dynein purification, isolated axonemes were
subjected to extraction with 0.6 M NaCl (35). Extracted proteins were fractionated using
either a 5-20% sucrose density gradient as described previously (34) or anion exchange
chromatography (see below). Samples were routinely electrophoresed in 5-15% gradient
polyacrylamide gels, and either stained with Coomassie brilliant blue, or transferred to
nitrocellulose for western blotting.
Anion Exchange Chromatography.
To separate the different species of axonemal dynein, the 0.6 M NaCl axonemal
extract was dialyzed against buffer A (20 mM Tris, pH 7.5, 60 mM KCl, 0.5 mM EDTA,
0.1 % Tween 20, 1 mM dithiothreitol (DTT), 1 mM phenylmethysulfonyl fluoride
(PMSF)), and applied to an anion exchange column (Mono Q HR5/5, Pharmacia Corp.)
using a Biorad Biologics chromatography work station. Proteins were eluted at a flow
rate of 0.5 ml/min using a linear salt gradient of 0 – 50% buffer B (buffer A with 1 M
KCl) and collected in 0.3 ml fractions. To initially identify fractions pertinent to this
study, samples were electrophoresed in 8% acrylamide gels and silver stained (36).
6
by guest on April 3, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Molecular Analysis of Tctex2b.
The entire coding region for Chlamydomonas Tctex2b was obtained by the
polymerase chain reaction using a Chlamydomonas λZapII wild-type cDNA library
enriched for flagellar messages as the template. Both the forward primer 5’→3’
GCGCGAATTCATGGCGGAAGCGGCTGACTTC and reverse primer 3’→5’
GCGCCTCGAGTCAGTACAGGTACACGCCGAA were designed based on the entire
coding sequence derived from the Chlamydomonas Expressed Sequence Tag BE122193,
and incorporate an EcoRI site at the 5’end and a XhoI site at the 3’ end, respectively.
Following restriction digestion, the gel-purified product was subcloned into pBluescript
II SK- (Stratagene) across the EcoRI/XhoI restriction sites. 32P-labeled oligonucleotides
were generated from the sequenced clone and used to probe a Southern blot of
Chlamydomonas wild-type genomic DNA, and a northern blot of Chlamydomonas RNA
obtained from wild-type nondeflagellated cells and from cells 30 minutes post-
deflagellation that were enriched for flagellar messages. The entire coding region was
also used to isolate an ~6.5 kb genomic fragment containing the full-length TCTEX2B
gene from a λDashII (Stratagene) genomic DNA library previously constructed from
wild-type strain 1132D- (RPK and SMK, unpublished).
Preparation of Recombinant Protein and Antibody.
The coding region for Tctex2b was subcloned into the pMAL-c2 vector (New
England Biolabs, Inc.) across the XmnI and BamHI restriction sites. This resulted in the
Tctex2b protein fused to the C-terminus of maltose binding protein (MBP) via a 19-
residue linker containing a Factor Xa cleavage site. The over-expressed fusion protein
was purified by amylose affinity chromatography. The full-length fusion protein was
7
by guest on April 3, 2018
http://ww
w.jbc.org/
Dow
nloaded from
used as the immunogen to generate rabbit antiserum CT117. Nitrocellulose membrane
containing recombinant Tctex2b following separation from MBP was utilized to affinity
purify the antibody (37).
Swimming Speed Measurements.
For measurement of swimming speeds, cells were suspended in fresh TAP media
and ~ 30 µl of cells were placed on a microscope slide and examined using a Nikon E600
microscope equipped with a 100 W halogen light source and a Diagnostic Instruments
Spot RT monochrome camera. To avoid cell compression and possible impedance of
motility, cells were examined using a 10x PlanFluor objective (NA 0.25) without a
coverslip. Time-lapse images were generated (50 images in 7 seconds) and swimming
speed was measured using Diagnostic Instruments Spot Advanced imaging software. All
swimming speed data were calculated as the mean +/- standard deviation from a
minimum of two experiments and a total sample size of greater than 150 cells. The
Student's t-test was used to determine the significance of differences between means.
Microtubule Sliding Assay.
Flagella were resuspended in 10 mM Hepes, pH 7.4, 5 mM MgSO4, 1 mM DTT,
0.5 mM EDTA and 50 mM potassium acetate (HMDEKAc). Axonemes were prepared
by adding Nonidet P-40 (Calbiochem, La Jolla, CA) at a final concentration of 0.5%
(vol/vol) to remove flagellar membranes. Sliding velocity between doublet microtubules
was measured by the method of Okagaki and Kamiya (38) and as previously described
(15). Approximately 8 µl of axonemes were applied to a perfusion chamber and the
chamber washed with HMDEKAc containing 1 mM ATP to remove nonadherent
axonemes. To initiate microtubule sliding, the chamber was perfused with HMDEKAc
8
by guest on April 3, 2018
http://ww
w.jbc.org/
Dow
nloaded from
containing 1 mM ATP and 2 µg/ml Type VIII protease (P-5380; Sigma Chemical Co., St
Louis, MO). Microtubule sliding was observed using an Axioskop 2 microscope (Zeiss
Inc., Thornwood, NY) equipped for dark-field optics including a Plan-Apochromat 40x
oil immersion objective with iris and ultra dark-field oil immersion condenser. All
microtubule sliding velocity data were calculated as the mean +/- standard deviation from
a minimum of two experiments and a total sample size of greater than 45 axonemes. The
Student's t-test was used to determine the significance of differences between means.
Flagellar Beat Frequency Analysis.
Flagellar beat frequency was measured based on the method of Kamiya and
Hasegawa (39,40). This method uses a darkfield microscope equipped with a
photodetector fitted with a linear density gradient filter at the detection plane, and a Fast
Fourier Transform (FFT) analyzer. Chlamydomonas cells grown at low density in liquid
media were analyzed using an Olympus BX51 with a UPLANF1 20X/0.050 PH1
objective, a dry darkfield condenser (U-DCD, Olympus), and a red filter (Marumi, Japan)
placed on the light source. Cell movement was detected by the photodetector which was
constructed by Drs. Shoji Baba and Yoshihiro Mogami (Ochanomizu University, Tokyo,
Japan). Data were captured and analyzed using a sound card (Creative Live!, Creative
Sound Blaster) and SIGVIEW v1.81 FFT signal analysis software.
9
by guest on April 3, 2018
http://ww
w.jbc.org/
Dow
nloaded from
RESULTS Identification of a Novel Tctex2-Related Protein.
To identify additional dynein-associated flagellar components, we searched the
Chlamydomonas EST and nonredundant databases using LC2, the Tctex2 homolog from
the outer dynein arm (accession # U89649) as the initial query sequence. This search
identified a Chlamydomonas EST (accession #BE122193; P(n) = 5 X 10-15). The
BE122193 sequence exhibits 33% identity (63% similarity) with LC2. Consequently, we
surmised that this clone may encode a member (here termed Tctex2b) of the
Tctex1/Tctex2 family of dynein LCs. To further characterize this putative dynein LC,
the full-length cDNA was obtained from a λZapII cDNA library enriched for flagellar
messages. The cDNA is 1105 bp in length and contains a single open reading frame
encoding a 120 residue protein with a calculated molecular weight of 13,751 Da and a pI
of 5.31 (Fig. 1a).
Secondary structure analysis using Predictprotein (41) suggests that the LC
consists of two N-terminal α- helices followed by four β strands that occupy almost the
entire C-terminal portion of the polypeptide (Fig. 1c). This prediction is consistent with
structural studies of the related protein Tctex1 (42,43). Tctex1 is a dimeric protein
whereas LC2 from the outer arm is a monomer in solution (44). Analysis of the MBP-
Tctex2b fusion protein by native gel electrophoresis yielded a molecular weight of 107.4
kDa, compared to the calculated mass of 53.8 kDa. In contrast, the MBP-LacZ control
protein (calculated mass of 50.8 kDa) appeared to be monomeric with a measured native
molecular weight of 56.2 kDa. This suggests that Tctex2b forms dimers in solution.
10
by guest on April 3, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Tctex2b shares 31% identity (42% similarity) with murine Tctex2 and 30%
identity (49% similarity) with Chlamydomonas LC2. An unrooted phylogenetic tree for
the Tctex1/Tctex2 family suggests three major subdivisions (Fig. 1b). The Tctex1 group
includes Chlamydomonas flagellar Tctex1, human and mouse Tctex1, and human
cytoplasmic rp3. A group we now term Tctex2a includes Chlamydomonas outer arm
LC2, human and mouse Tctex2, and an EST identified in human glioblastoma. Tctex2b
appears to define a distinct branch of the Tctex2 subfamily that also includes several
mammalian ESTs which share 44% identity (55% similarity) with Chlamydomonas
Tctex2b.
A Southern blot of Chlamydomonas genomic DNA digested with either PstI or
BamHI and probed with the Tctex2b cDNA yielded single bands for each digest,
suggesting that a single gene exists for this protein (Fig. 2a). On northern blots, a single
mRNA of ~1.4 kb was observed that was greatly upregulated in cells actively
regenerating flagella (Fig. 2b). This suggested that Tctex2b may be a flagellar protein.
The TCTEX2B and PF16 Genes are Adjacent.
To determine the location of TCTEX2B within the Chlamydomonas genome, we
obtained an ~ 6.5 kb clone containing the TCTEX2B gene from a λDashII genomic DNA
library. Sequence analysis revealed that the TCTEX2B gene consists of an ~1.9 kb DNA
segment containing 5 exons (Fig. 2c). Furthermore, we found that the 5’ end of the
genomic clone also included a portion of the 5’ UTR of the PF16 gene (positioned in the
opposite orientation relative to TCTEX2B), indicating that the two genes are in close
proximity (within ~ 2 kb). A subsequent search of the previously published genomic
segment that includes the Chlamydomonas flagellar PF16 gene (accession #U40057) (29)
11
by guest on April 3, 2018
http://ww
w.jbc.org/
Dow
nloaded from
revealed that it contained part of TCTEX2B. Restriction fragment length polymorphism
analysis (RFLP) indicated that both the PF16 (29) and TCTEX2B genes map to linkage
group IX.
Generation of Antibody Against Tctex2b.
The Tctex2b coding sequence was subcloned into the pMAL-c2 vector (New
England Biolabs, Inc.) and expressed as an N-terminal fusion to maltose binding protein
(MBP). The purified fusion protein was used as the immunogen to generate rabbit
polyclonal antiserum CT117. The specificity of CT117 for Tctex2b was examined using
recombinant versions of each LC from the Chlamydomonas outer dynein arm as well as
the inner arm I1 LC, Tctex1. CT117 recognized only its target antigen, and specifically
did not react with the outer dynein arm LC2 (Tctex2a), or Tctex1 (Fig. 3a). Furthermore,
Tctex2b was not detected by antibodies against Tctex1 (R5205) or LC2 (R5391; not
shown). A single discrete band corresponding to Tctex2b was detected in wild-type
axonemes probed with the CT117 antibody (Fig 3b).
Tctex2b is a Component of Inner Arm I1.
To determine the location of Tctex2b, axonemes were isolated from
Chlamydomonas strains lacking various components (Fig. 4). Tctex2b was present in
wild type axonemes (cc124) as well as in mutants missing the I2 inner arm class (ida4),
the outer arms (oda9), the radial spokes (pf14) and the central pair microtubule complex
(pf18). The levels of Tctex2b were significantly reduced in ida1, which lacks inner arm
I1, as well as in the double mutant pf28pf30, which is missing both the outer arms and
inner arm I1. The markedly reduced levels seen in the ida1 and pf28pf30 strains
suggested that Tctex2b associates with inner arm I1. We also observed that the Tctex2b
12
by guest on April 3, 2018
http://ww
w.jbc.org/
Dow
nloaded from
protein is completely absent in axonemes isolated from pf16-D2, a null PF16 allele
generated by insertional mutagenesis (29).
To further confirm that Tctex2b is indeed a component of inner arm I1, high salt
extracts from wild type axonemes were fractionated using sucrose gradient centrifugation
(Fig. 5a). The majority of the inner arm I1 subunit, IC140 and Tctex2b cosedimented in
fractions 5 – 7. When inner arm I1 was purified from wild type axonemal salt extracts by
anion exchange chromatography, IC140 and Tctex2b again cofractionated (Fig 5b.).
These data strongly suggest that Tctex2b is a subunit of inner dynein arm I1.
IC140 from Inner Arm I1 Assembles in the Absence of Tctex2b.
To determine if Tctex2b is essential for assembly of inner arm I1, we took
advantage of the pf16-D2 strain that lacks this component. Immunoblot analysis of
isolated axonemes from pf16-D2 revealed that significant levels of IC140 were present
(Fig. 6). As IC140 is essential for assembly of this dynein (10), this result suggests that
inner arm I1 is present in pf16-D2 mutant axonemes, and that the lack of Tctex2b in this
strain does not prevent assembly of inner arm I1. Similar results were obtained with two
additional pf16-D2 strains rescued with a HA-tagged PF16 gene (pf16-D2HA4C and
pf16-D2HA5A) (Fig. 6). Moreover, Tctex1 is present in pf16-D2HA4C axonemes as
well as the double mutant, pf16-D2pf28 Resc. w/PF16, that lacks both Tctex2b and the
outer dynein arm (see Figure 7b, c). These data indicate that lack of the PF16 protein in
pf16-D2 is not responsible for the absence of Tctex2b, or for its failure to assemble. It is
unclear whether inner arm I1 is present at completely wild-type levels in strains lacking
Tctex2b.
13
by guest on April 3, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Absence of Tctex2b Destabilizes Inner Arm I1.
When salt extracts were prepared from wild type axonemes or axonemes lacking
the outer dynein arms, and fractionated using sucrose density gradients, all the known
components of inner arm I1 copurified at ~18S. For example, in the outer armless mutant
oda9, all three inner arm I1 ICs, as well as Tctex1 cosedimented in fractions 5-7 (Fig.
7a). However, when high salt extracts from axonemes lacking both the outer arms and
Tctex2b (pf16-D2pf28 Resc. w/PF16) were fractionated in a sucrose gradient, the inner
arm I1 complex was no longer found at 18S (Fig. 7b). The majority of IC140 was
present at ~10S, in fractions 7-11, indicating that the inner arm I1 complex had
dissociated. In addition, Tctex1 now appeared at the top of the gradient in fractions 12-
15. Similarly, when high salt extracts of axonemes lacking only Tctex2b were
fractionated, Tctex1 also appeared at the top of the gradient, indicating that it had
dissociated from inner arm I1 (Fig. 7c). These data suggest that the lack of Tctex2b alone
causes the instability of inner arm I1 and that this is independent of the status of the outer
arms.
Rescue of pf16-D2 with Both PF16 and TCTEX2B Genes.
Isolation of the PF16 gene from a bacteriophage λ library originally created from
wild-type genomic DNA yielded several overlapping clones that included “λ8b” (29).
This ~12-13 kb clone was transformed into both pf16-D2 and pf16A (the original allele,
(45)) and rescued the paralyzed phenotype of both strains, signifying the presence of a
functional PF16 gene. At that time, however, it was not known that TCTEX2B existed,
that it mapped in the immediate vicinity of PF16, or that it might be present in the
14
by guest on April 3, 2018
http://ww
w.jbc.org/
Dow
nloaded from
isolated λ clone. To determine whether Tctex2b was encoded within λ8b, the PCR was
performed with TCTEX2B specific primers using λ8b as the template. A DNA fragment
of the expected size (~1.2 kb) for the genomic region of TCTEX2B encompassing all 5
exons (see Fig. 4) was amplified (data not shown). In order to rescue both the pf16 and
tctex2b defects, λ8b was transformed into the pf16-D2 strain. Cells were screened based
on their ability to swim and a transformant (pf16-D2λ8b) was isolated. Immunoblot
analysis of axonemes from the rescued strain revealed that Tctex2b was expressed and
incorporated into the axonemes (Fig. 8a). This verified that the λ8b clone encodes
functional PF16 and TCTEX2B genes.
Lack of Tctex2b Results in Reduced Swimming Speeds and Microtubule Sliding
Velocities.
While transformation of the pf16-D2 insertional allele with the wild-type PF16
gene rescued both the motility and the central apparatus defects in this mutant (29),
subsequent observation revealed that the rescued strain exhibited somewhat reduced
swimming speeds compared to wild-type cells (Fig. 8b). To quantitate these differences,
we measured the swimming speeds of wild-type cells, pf16-D2 cells rescued with the
wild-type PF16 gene, and pf16-D2 cells rescued with the λ8b clone. The average
swimming speed of pf16-D2 cells transformed with only the PF16 gene was significantly
slower (~72%) than that of wild-type cells (P<<0.001). In contrast, the average
swimming speed of pf16-D2 cells transformed with both the PF16 and TCTEX2B genes
was not significantly different from that of wild-type cells or from pf16A cells
transformed with the wild-type PF16 gene. These results indicate that transformation of
15
by guest on April 3, 2018
http://ww
w.jbc.org/
Dow
nloaded from
pf16-D2 with the wild-type PF16 gene alone does not completely restore wild-type
motility.
To further investigate differences in motility between wild-type cells and pf16-D2
cells rescued with either PF16 or the PF16 and TCTEX2B genes, we measured dynein
motor activity using a microtubule sliding assay. In this assay, microtubule sliding is
uncoupled from flagellar bending and, therefore, dynein activity is quantified as the
velocity at which the doublet microtubules slide past one another (e.g. (38)). Microtubule
sliding velocities of axonemes isolated from both pf16A and pf16-D2 were approximately
one-half that of wild-type axonemes as previously reported (46). In the present study,
microtubules from pf16A exhibited similar sliding velocities (~60% compared to wild-
type) and regained near wild-type sliding levels when rescued with the wild-type PF16
gene (pf16A Resc. w/PF16) (Fig.9a). Velocities for the pf16tctex2b double mutant (pf16-
D2) were measured at only ~36% of wild-type and ~61% of the pf16 single mutant,
which suggests that the absence of Tctex2b further impairs sliding speeds. Evidence that
a loss of Tctex2b may alter axonemal function can be seen in the mutant lacking only
Tctex2b (pf16-D2 Resc. w/PF16). Unlike the pf16A mutant rescued with PF16, this
mutant displays sliding velocities significantly different from wild-type levels
(P<<0.001), presumably due to the missing dynein subunit. Alternatively, the presence
of less than wild-type levels of inner arm I1 might account for this reduction. The double
mutant rescued with both PF16 and TCTEX2B (pf16-D2λ8b) regains wild-type
microtubule sliding velocities supporting the hypothesis that Tctex2b is essential for
wild-type motor function.
16
by guest on April 3, 2018
http://ww
w.jbc.org/
Dow
nloaded from
This reduction in inner arm dynein activity is even more dramatic in strains
lacking the outer dynein arms. We compared microtubule sliding velocities in mutant
axonemes lacking only the outer dynein arms (pf28) with those of a double mutant strain
lacking both the outer dynein arms and Tctex2b (pf16-D2pf28 double mutant rescued
with the PF16 gene). In the absence of the outer dynein arms and Tctex2b, microtubule
sliding velocities were reduced to ~1.6 µm/sec. compared to 5.8 µm/sec. measured for
axonemes lacking only the outer dynein arms.
Absence of Tctex2b Results in Reduced Flagellar Beat Frequency.
To further investigate the functional significance of Tctex2b in vivo, we analyzed
flagellar beat frequency of wild-type and mutant strains. The paralyzed pf16-D2
insertional mutant strain, when rescued only with PF16, exhibited a beat frequency that
peaked at ~28-32 Hz (Fig. 9b). In contrast, when this strain was rescued with both PF16
and TCTEX2B, the peak beat frequency rose to ~33-40 Hz, with a significant shoulder at
close to 50 Hz. This value is similar to the parental strain (A54-e18) used to generate
pf16-D2, which exhibited two significant peaks between ~38-42 Hz with a smaller
population at >50 Hz. These observations suggest that the lack of Tctex2b contributes to
a reduction in flagellar beat frequency. Together with the swimming speed and
microtubule sliding data, these results suggest that although Tctex2b is not essential for
incorporation of inner arm I1 into the axoneme, it does increase the stability of the
enzyme and thus enhances the overall performance of the inner dynein arm system.
17
by guest on April 3, 2018
http://ww
w.jbc.org/
Dow
nloaded from
DISCUSSION Tctex2b Defines a New Subfamily of Dynein LCs.
To date, three members of the Tctex1/Tctex2 family have been identified in
Chlamydomonas: Tctex1, an inner arm I1 subunit (13) which also functions as a
component of cytoplasmic dynein (22); LC2 (24), an outer arm LC which is required for
assembly of that dynein (28), and Tctex2b that is described here. Identification of
Tctex2b allowed us to subdivide the Tctex2 family into two major groups. The branch
designated Tctex2a contains sea urchin LC1 and Chlamydomonas LC2 which are outer
dynein arm LCs, and the eponymous human and mouse flagellar Tctex2 proteins.
Chlamydomonas Tctex2b establishes the second branch of this protein family and is most
closely related to ESTs identified from both human B cell lymphocytic leukemia (EST
AI492091), human kidney (EST AW612564), and murine embryo (EST W64276)
libraries. These mammalian proteins are, as yet, undescribed, so it remains unknown
whether they have a common function with Chlamydomonas Tctex2b.
Tctex2b is a Component of Inner Arm I1.
All characterized Tctex2 family LCs are flagellar components (24,47). Here we
have shown that, in Chlamydomonas, Tctex2b is encoded by a single gene and that its
message is upregulated in response to deflagellation, suggesting that it functions in the
flagellum. Furthermore, we observed that Tctex2b levels are drastically reduced only in
Chlamydomonas strains that do not assemble inner arm I1 (i.e., ida1 that lacks I1, and
pf28pf30, which is missing both I1 and the outer arms). That even minor amounts of this
LC are present in these strains implies that Tctex2b can partially assemble within the
axoneme even in the absence of intact inner arm I1. This notion is consistent with earlier
18
by guest on April 3, 2018
http://ww
w.jbc.org/
Dow
nloaded from
data demonstrating that low levels of IC140 assemble in pf28pf30 and pf9-3 axonemes
which completely lack the 1α HC (11). In addition, reconstitution experiments revealed
that a 53 kDa, C-terminal portion of IC140 binds only to axonemes lacking inner arm I1,
and is presumably localized to the correct axonemal location independent of additional
inner arm I1 subunits (11).
Further evidence that Tctex2b is associated with inner arm I1 was obtained
following sucrose gradient centrifugation and anion exchange chromatography of
axonemal extracts. Tctex2b copurified with known components of inner arm I1 (notably
LC8, Tctex1, IC110, IC138, and IC140) which, under wild-type conditions, sediment
together as a complex at ~18S (7,48). Based on these biochemical and genetic data, we
conclude that Tctex2b is an integral component of inner arm I1. This novel LC is the
first Tctex2 protein to be identified within the inner arm system. As Tctex1 is present in
both inner arm I1 and cytoplasmic dynein (13,22), it will be interesting to determine
whether Tctex2b also functions as a cytoplasmic dynein subunit.
It was initially established in studies of Chlamydomonas and sea urchin sperm
outer arm dynein that the ICs localize to the base of the soluble dynein particle and that
they interact with each other and a series of LCs to form a basal or cargo-binding
complex (49-53). Thus, it is likely that the related IC140 of inner arm I1 also has several
binding partners. For example, chemical crosslinking of pf28 axonemes or purified
dynein using the zero-length reagent l-ethyl-3-(3-dimethylaminopropyl)carbodiimide
(EDC) suggests that IC140 also interacts with IC110 (11). The presence of both Tctex2b
and IC140 in strains that lack other components of this inner arm raises the possibility
that these two dynein polypeptides also interact.
19
by guest on April 3, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Inner Arm I1 Components Assemble in the Absence of Tctex2b.
Both the 1α and 1β HCs and IC140 are required for inner arm I1 assembly (8-
10,14,48), and mutants lacking this motor display an impaired swimming phenotype due
to alterations in waveform. Of the previously identified I1-associated LCs (LC8 and
Tctex1), LC8 is apparently required for assembly as the LC8 null mutant (fla14) produces
short flagella, due to defects in intraflagellar transport (IFT) (21), that have inner arm,
outer arm, and radial spoke defects (LC8 is a component of all three complexes)
(12,13,20). No tctex1 mutant has been identified in Chlamydomonas. However, in
Drosophila, a homozygous mutant at the dtctex1 locus is viable, although males are
sterile due to defects in sperm motility (54). This suggests that Tctex1 is not required for
cytoplasmic dynein function but does play an essential role in either sperm development,
sperm axonemal function, or perhaps both. In contrast to the requirement for LC2
(Tctex2a) in outer arm dynein assembly (28), we found that axonemes from mutants
lacking either Tctex2b or both PF16 and Tctex2b contained significant amounts of
IC140, suggesting that this novel LC is not essential for assembly of inner arm I1.
Tctex2b Maintains the Integrity of Inner Arm I1.
Although Tctex2b does not appear to be required for the assembly of inner arm
I1, our data suggest that it augments the stability of this dynein motor. In wild type
axonemal salt extracts, inner arm I1 (including Tctex2b) sediments as an ~18S particle.
Furthermore, this association occurs in both the presence and absence of outer arms,
eliminating the possibility of this dynein influencing the localization of Tctex2b as is the
case for a novel member of the LC7/Roadblock family (DiBella and King, in
preparation). However, the lack of Tctex2b did result in a very different sedimentation
20
by guest on April 3, 2018
http://ww
w.jbc.org/
Dow
nloaded from
pattern for inner arm I1. In these strains, the subunits of this dynein no longer remained
associated following extraction from the axoneme. IC140 sedimented at ~10S and
Tctex1 no longer cofractionated with the higher molecular weight ICs, indicating that the
entire complex had disassembled. This suggests that Tctex2b stabilizes the inner dynein
arm through salt-insensitive associations.
Tctex2b is Required for Dynein Motor Function.
We have demonstrated that in the absence of Tctex2b, inner arm I1 is unstable in
vitro. Furthermore, our microtubule sliding data indicate that the in situ inner arm
lacking Tctex2b displays deficiencies in motor function as well. Using axonemes
prepared from a Tctex2b null mutant (pf16-D2 rescued with PF16), we observed an
~25% reduction in microtubule sliding velocity relative to the parental strain. An even
more dramatic reduction occurred in the absence of the outer arm. When Tctex2b was
reintroduced back into the null strain, sliding velocities recovered to those of the parent.
These in vitro data implicating Tctex2b as a factor required for efficient motor function
were also supported by in vivo observations. Cells lacking Tctex2b exhibited reductions
of ~27% and 29% in both swimming speed and beat frequency, respectively, compared to
the parental strain. This indicates that the Tctex2b deficiency translates into functional
inadequacies in vivo. It has been shown that the Tctex2a family members in salmonid
and sea urchin sperm outer arm dynein are subject to phosphorylation that occurs
coincident with the activation of sperm motility (47), suggesting that these LCs perform a
regulatory function within the axoneme. Unlike the sperm Tctex2a proteins however,
Chlamydomonas Tctex2b lacks any predicted phosphorylation sites and inner arm I1 LCs
do not appear to be phosphorylated in vivo (55). Together, these data suggest that the
21
by guest on April 3, 2018
http://ww
w.jbc.org/
Dow
nloaded from
reintroduction of Tctex2b corrects impaired motor function by increasing the structural
stability of the motor rather than through a direct regulatory mechanism.
A Model for the Organization of Inner Arm I1.
This dynein consists of two distinct heavy chains (1α and 1β), three ICs and
several LCs including Tctex1, Tctex2b and LC8. Previously, we observed an additional
12 kDa component (13) that may represent a member of the LC/Roadblock family of
dynein LCs (DiBella and King, in preparation). Current models for the arrangement of
proteins within this dynein (7,10) place the ICs and LCs at the base of the particle by
analogy with the known location of outer arm and cytoplasmic dynein components. In
axonemes from the double mutant pf28pf30, which lacks both the outer arm and inner
arm I1, we detected both IC140 and Tctex2b. This observation implies that these two
subunits can assemble in the absence of other dynein components and suggests that they
may interact directly with an inner arm docking complex (analogous to that needed for
outer arm assembly) (56), that is presumably necessary to specify the appropriate binding
site within the axoneme.
In cytoplasmic dynein, Tctex1 binds the consensus (K/R)(K/R)XX(K/R) within
IC74 (43). A perfect copy of this motif is present in Chlamydomonas IC140 (residues
269-273) and may mediate association of Tctex1 with inner arm I1. However, this
cannot be the sole interaction involved in Tctex1 binding as we found that this protein
completely dissociates from the I1 complex in the absence of Tctex2b. Quantitative
densitometry indicated that two copies of Tctex1 are present within the inner arm
complex (13). However, we have found that Tctex1 and Tctex2b precisely comigrate in
SDS-polyacrylamide gels. As Tctex1 and Tctex2b form dimers, it is possible that inner
22
by guest on April 3, 2018
http://ww
w.jbc.org/
Dow
nloaded from
arm I1 actually contains a heterodimer formed from these two LCs. Alternatively,
different classes of inner arm may exist depending on whether they contain a Tctex1 or
Tctex2b homodimer.
In conclusion, we describe here a novel component of the Chlamydomonas inner
dynein arm I1 that defines a distinct subfamily within the Tctex2 class of dynein LCs and
is required for the structural integrity and motor function of this enzyme. Tctex2b has the
intriguing property that it can assemble within the axoneme in the absence of many other
components of this dynein. Further analysis will provide insight into the structural
mechanisms by which Tctex2b modulates dynein motor activity.
23
by guest on April 3, 2018
http://ww
w.jbc.org/
Dow
nloaded from
ACKNOWLEDGEMENTS
We thank Dr. Winfield Sale (Emory University School of Medicine) for
Chlamydomonas strain pf28pf30 and for the polyclonal antibody to IC140, and Drs.
Carolyn Silflow and Paul Lefebvre (University of Minnesota) for mapping the TCTEX2B
gene. We also thank the following for their help in developing the beat frequency
analysis system: Drs. Ritsu Kamiya, Shinji Kamimura, and Toshiki Yagi (University of
Tokyo), Drs. Shoji A. Baba and Yoshihiro Mogami (Ochanomizu University), and Dr.
Miho Sakato (University of Connecticut Health Center). This study was supported by
grants GM51293 (to S.M.K.) and GM51379 (to E.F.S., as a consortium agreement, P.A.
Lefebvre, University of Minnesota), from the National Institutes of
Health, grant #5-FY99-766 (to E.F.S.) from the March of Dimes Birth Defects
Foundation, and a postdoctoral fellowship from the Lalor Foundation (to K.W.). SMK is
an investigator of the Patrick and Catherine Weldon Donaghue Medical Research
Foundation.
FOOTNOTES
1. Abbreviations used: FFT, fast Fourier transform; HA, hemagglutinin; HC, heavy
chain; IC, intermediate chain; IFT, intraflagellar transport; LC, light chain.
24
by guest on April 3, 2018
http://ww
w.jbc.org/
Dow
nloaded from
TABLE 1. Strains Used in This Study
Strain Description References
cc124 wild-type
A54-e18 wild-type (57)
oda9 Missing outer arms/slow swimming (58)
ida1 Missing inner arm I1/slow swimming (48,58)
ida4 Lacks inner arm species a, c and d (58)
pf14 Radial spoke defect/paralyzed flagella (59)
pf16A Lacks C1 tubule protein/paralyzed flagella (45)
pf16A Resc. w/PF16 pf16A defect rescued (29,45)
pf16-D2 Missing C1 tubule protein and Tctex2b/ paralyzed flagella (29)
pf16-D2 Resc. w/PF16 pf16 defect rescued/Lacks Tctex2b (29); this study
pf16-D2HA4C pf16 defect rescued w/HA-tagged gene/ Lacks Tctex2b (29); this study
pf16-D2HA5A pf16 defect rescued w/HA-tagged gene/ Lacks Tctex2b (29); this study
pf18 Lacks central pair/paralyzed flagella
pf28 (oda2) Missing outer arms/slow swimming (60)
pf16-D2pf28 Resc. w/PF16 pf16 defect rescued/Lacks outer arms and Tctex2b (29); this study
pf16-D2λ8b pf16 and tctex2b defects rescued (29); this study
________________________________________________________________________________________
25
by guest on April 3, 2018
http://ww
w.jbc.org/
Dow
nloaded from
REFERENCES
1. Vale, R. D. (2003) Cell 112, 467-480
2. King, S. M. (2002) in Molecular Motors (Schliwa, M., ed), pp. 45-78, Wiley-
VCH GmbH, Munchen, Germany
3. Kamiya, R., and Okamoto, M. (1985) J Cell Sci 74, 181-191
4. Brokaw, C. J., and Kamiya, R. (1987) Cell Motil Cytoskeleton 8, 68-75
5. DiBella, L. M., and King, S. M. (2001) Int Rev Cytol. 210, 227-268
6. Kamiya, R. (2002) Int Rev Cytol. 219, 115-155
7. Piperno, G., Ramanis, Z., Smith, E. F., and Sale, W. S. (1990) J Cell Biol 110,
379-389
8. Kamiya, R., Kurimoto, E., and Muto, E. (1991) J Cell Biol 112, 441-447
9. Myster, S. H., Knott, J. A., O'Toole, E., and Porter, M. E. (1997) Mol Biol Cell 8,
607-620
10. Perrone, C. A., Yang, P., O'Toole, E., Sale, W. S., and Porter, M. E. (1998) Mol
Biol Cell 9, 3351-3365
11. Yang, P., and Sale, W. S. (1998) Mol Biol Cell 9, 3335-3349
12. King, S. M., and Patel-King, R. S. (1995) J Biol Chem 270, 11445-11452
13. Harrison, A., Olds-Clarke, P., and King, S. M. (1998) J Cell Biol 140, 1137-1147
14. Perrone, C. A., Myster, S. H., Bower, R., O'Toole, E. T., and Porter, M. E. (2000)
Mol Biol Cell 11, 2297-2313
15. Smith, E. F., and Sale, W. S. (1992) Science 257, 1557-1559
16. Habermacher, G., and Sale, W. S. (1995) Cell Motil Cytoskeleton 32, 106-109
17. Habermacher, G., and Sale, W. S. (1997) J Cell Biol 136, 167-176
26
by guest on April 3, 2018
http://ww
w.jbc.org/
Dow
nloaded from
18. King, S. J., and Dutcher, S. K. (1997) J Cell Biol 136, 177-191
19. Habermacher, G., and Sale, W. S. (1996) J Cell Sci 109, 1899-1907
20. Yang, P., Diener, D. R., Rosenbaum, J. L., and Sale, W. S. (2001) J Cell Biol.
153, 1315-1326
21. Pazour, G. J., Wilkerson, C. G., and Witman, G. B. (1998) J Cell Biol 141, 979-
992
22. King, S. M., Dillman, J. F., III, Benashski, S. E., Lye, R. J., Patel-King, R. S., and
Pfister, K. K. (1996) J Biol Chem 271, 32281-32287
23. King, S. M., Barbarese, E., Dillman, J. F., III, Benashski, S. E., Do, K. T., Patel-
King, R. S., and Pfister, K. K. (1998) Biochemistry 37, 15033-15041
24. Patel-King, R. S., Benashski, S. E., Harrison, A., and King, S. M. (1997) J Cell
Biol 137, 1081-1090
25. Lader, E., Ha, H. S., O'Neill, M., Artzt, K., and Bennett, D. (1989) Cell 58, 969-
979
26. Huw, L. Y., Goldsborough, A. S., Willison, K., and Artzt, K. (1995) Dev Biol
170, 183-194
27. Tai, A. W., Chuang, J. Z., Bode, C., Wolfrum, U., and Sung, C. H. (1999) Cell 97,
877-887
28. Pazour, G. J., Koutoulis, A., Benashski, S. E., Dickert, B. L., Sheng, H., Patel-
King, R. S., King, S. M., and Witman, G. B. (1999) Mol. Biol. Cell 10, 3507-3520
29. Smith, E. F., and Lefebvre, P. A. (1996) J Cell Biol. 132, 359-370
30. Silflow, C.D., LaVoie M., Tam, L.W., Tousey, S., Sanders, M., Wu, W.,
Borodovsky, M., Lefebvre, P.A. (2001) J Cell Biol. 153, 63-74
27
by guest on April 3, 2018
http://ww
w.jbc.org/
Dow
nloaded from
31. Smith, E.F., Lefebvre, P.A. (1997) Mol. Biol. Cell 8, 455-467
32. Debuchy, R., Purton, S., Rochaix, J.D. (1989) EMBO J. 8, 2803-2809
33. Kindle, K.L. (1990) Proc Natl Acad Sci USA 87, 1228-1232
34. King, S. M., Otter, T., and Witman, G. B. (1986) Methods Enzymol 134, 291-306
35. Nakamura, K., Wilkerson, C. G., and Witman, G. B. (1997) Cell Motil
Cytoskeleton 37, 338-345
36. Merril, C. R., Goldman, D., Sedman, S. A., and Ebert, M. H. (1981) Science 211,
1437-1438
37. Olmsted, J. B. (1986) Methods Enzymol 134, 467-472
38. Okagaki, T., and Kamiya, R. (1986) J Cell Biol 103, 1895-1902
39. Kamiya, R., and Hasegawa, E. (1987) Exptl. Cell Res. 173, 299-304
40. Kamiya, R. (2000) Methods. 22, 383-387
41. Rost, B., and Sander, C. (1993) J. Mol. Biol. 232, 584-599
42. Wu, H., Maciejewski, M. W., Benashski, S. E., Mullen, G. P., and King, S. M.
(2001) J Biomol NMR 20, 89-90
43. Mok, Y. K., Lo, K. W., and Zhang, M. (2001) J Biol Chem 276, 14067-14074
44. DiBella, L. M., Benashski, S. E., Tedford, H. W., Harrison, A., Patel-King, R. S.,
and King, S. M. (2001) J Biol Chem 276, 14366-14373
45. Huang, B., Piperno, G., and Luck, D. J. L. (1979) J. Biol. Chem. 254, 3091-3099
46. Smith, E. (2002) Cell Motil Cytoskeleton 52, 33-42
47. Inaba, K., Kagami, O., and Ogawa, K. (1999) Biochem Biophys Res Commun
256, 177-183
48. Porter, M. E., Power, J., and Dutcher, S. K. (1992) J Cell Biol 118, 1163-1176
28
by guest on April 3, 2018
http://ww
w.jbc.org/
Dow
nloaded from
49. Pfister, K. K., Fay, R. B., and Witman, G. B. (1982) Cell Motil 2, 525-547
50. Tang, W. J., Bell, C. W., Sale, W. S., and Gibbons, I. R. (1982) J Biol Chem 257,
508-515
51. Sale, W. S., Goodenough, U. W., and Heuser, J. E. (1985) J Cell Biol 101, 1400-
1412
52. Mitchell, D. R., and Rosenbaum, J. L. (1986) Cell Motil Cytoskeleton 6, 510-520
53. King, S. M., and Witman, G. B. (1990) J Biol Chem 265, 19807-19811
54. Caggese, C., Moschetti, R., Ragone, G., Barsanti, P., and Caizzi, R. (2001) Mol
Genet Genomics. 265, 436-444
55. King, S. M., and Witman, G. B. (1994) J Biol Chem 269, 5452-5457
56. Takada, S., and Kamiya, R. (1994) J Cell Biol 126, 737-745
57. Tam, L. W., and Lefebvre, P. A. (1993) Genetics 135, 375-384
58. Kamiya, R. (1988) J Cell Biol 107, 2253-2258
59. Luck, D., Piperno, G., Ramanis, Z., and Huang, B. (1977) Proc Natl Acad Sci 74,
3456-3460
60. Mitchell, D. R., and Rosenbaum, J. L. (1985) J Cell Biol 100, 1228-1234
29
by guest on April 3, 2018
http://ww
w.jbc.org/
Dow
nloaded from
FIGURE LEGENDS
Figure 1. Molecular Cloning and Phylogenetic Analysis of Tctex2b.
(a) Nucleotide and predicted amino acid sequence of the cDNA clone encoding Tctex2b.
The 5’ UTR contains four in-frame stop codons upstream of the first Met and the 3’UTR
contains a perfect copy of the Chlamydomonas polyadenylation signal (underlined).
These sequence data are available from Genbank under accession #BE122193. (b)
Phylogenetic analysis of the Tctex1/Tctex2 family of LCs. Distances were calculated
using PROTDIST and FITCH from the Phylip group of programs and the unrooted tree
was generated using DRAWTREE. The tree reveals two Tctex2 subfamilies designated
as Tctex2a and Tctex2b. Chlamydomonas Tctex2b shares 44% identity with a homolog
from human kidney (AW612564) and a mouse embryo EST (W64276). The Tctex2a
family members include Chlamydomonas flagellar LC2 (489649), human testis Tctex2
(AA781436), mouse Tctex2 (U21673), human glioblastoma EST (AI421187), and
Anthocidaris crassispina flagellar LC1 (BAA24185). Members of the Tctex1 subfamily
are murine Tctex1 (A32995), human Tctex1 (U56255), Anthocidaris crassispina Tctex1
(AB004251), Chlamydomonas flagellar Tctex1 (AF039437) and human rp3 (U02556).
We have also identified three distantly-related Caenorhabditis elegans proteins (D1009-
5, C48724 and T05C12-5) in this family. (c) The secondary structure of Tctex2b was
predicted using PredictProtein. E = Extended sheet, H = helix.
Figure 2. Southern and Northern Blot Analysis of TCTEX2B.
(a) Southern blot of Chlamydomonas wild-type genomic DNA digested with either
SmaI, PvuII, PstI, or BamHI. A probe generated from the full-length TCTEX2B coding
30
by guest on April 3, 2018
http://ww
w.jbc.org/
Dow
nloaded from
region detects single bands in SmaI- and BamHI-digested DNA, suggesting a single gene.
(b) Northern blot of total RNA isolated from non-deflagellated cells (NDF) and cells
actively regenerating their flagella for 30 minutes (30’postDF). A faint signal at ~1.3 kb
was detected in NDF RNA and a highly upregulated band of the same size was observed
in 30’postDF RNA. (c) Map of the TCTEX2B genomic region. Restriction fragment
length polymorphism (RFLP) analysis revealed that the TCTEX2B gene maps to linkage
group IX. Sequencing of this genomic region indicated that this gene was ~ 2 kb
downstream of the PF16 gene. TCTEX2B spans an ~1.9 kb region; 5’ and 3’ untranslated
regions (UTRs, dark grey), 5 exons (black) and a portion of the PF16 5’ UTR (light grey)
are indicated.
Figure 3. Specificity of the Tctex2b Polyclonal Antibody.
In panels (a) and (b), gels were either stained with Coomassie brilliant blue, or transferred
to nitrocellulose. (a) Maltose binding protein (MBP) fusions to Tctex2b, Tctex1 and LC2
were digested with Factor Xa, and the LCs separated from MBP by SDS-PAGE. Blots
were probed with either affinity purified rabbit polyclonal antibody CT117 (Tctex2b) or
R5205 (Tctex1)(22). Both antibodies are specific and only recognize their respective LC.
(b) Approximately 50 µg wild-type (cc124) axonemes were electrophoresed in a 5-15%
polyacrylamide mini-gel. The blot was probed with affinity purified CT117 which
detected a single discrete band of ~Mr14,000.
31
by guest on April 3, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Figure 4. Localization of Tctex2b in Chlamydomonas axonemes.
Approximately 150 µg isolated axonemes from various strains were electrophoresed on
5-15% gradient acrylamide gels and stained with Coomassie blue (upper panel), or
transferred to nitrocellulose, and probed with CT117 (lower panel). Strains used include
wild type (cc124), and mutants lacking various axonemal components: ida1 (inner arm
I1), oda9 (outer arm), ida4 (inner arm subtypes a, c and d from I2), pf28pf30 (outer arm
and inner arm I1), pf14 (radial spokes), pf16-D2 (C1 tubule from central pair), and pf18
(central pair). Levels of Tctex2b are significantly reduced in axonemes that lack inner
arm I1 (ida1 and pf28pf30); this protein is completely absent in pf16-D2. Molecular
weight markers are indicated on the left.
Figure 5. Tctex2b is a Component of Inner Arm I1.
(a) A 0.6 M NaCl extract of wild-type axonemes was loaded onto a 5-20% sucrose
gradient. After sedimentation, fractions were electrophoresed in 5-15% acrylamide gels
and either stained with Coomassie blue (upper panel) or blotted to detect Tctex2b and
IC140 from inner arm I1. Tctex2b comigrates with the peak of inner arm I1 in fractions
5-7. Molecular weight markers are indicated at left. (b) Wild type high salt extracts
were subject to anion exchange chromatography. A linear KCl gradient was used to elute
the various dynein subspecies. Fraction “f” (inner arm I1) eluted at ~ 380-400 mM salt.
Tctex2b copurified with the peak IC140 fractions. IC138 and IC140 (from inner arm I1)
and IC1 and IC2 (from the outer arm) are indicated at right.
32
by guest on April 3, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Figure 6. Inner Arm I1 Components Can Assemble in the Absence of Tctex2b.
Axonemes from wildtype (cc124) and mutant strains lacking either PF16 and Tctex2b
(pf16-D2) or only Tctex2b (pf16-D2HA4C, pf16-D2HA5A) were electrophoresed in 5-
15% acrylamide gels and either stained with Coomassie blue (upper panel) or blotted to
detect Tctex2b and IC140. IC140 assembles even in the absence of Tctex2b.
Figure 7. Absence of Tctex2b Results in Instability of Inner Arm I1 In Vitro.
In (a-c), Coomassie blue-stained 5-15% acrylamide gels are shown in the upper panel and
immunoblots in the lower panel(s). (a) Sucrose gradient analysis of a high salt extract
from oda9 axonemes. Tctex1 comigrates with the inner arm I1 ICs at ~18S (fractions 5-
7). Thus, the absence of the outer arm alone does not result in dissociation of inner arm
I1. (b) Sucrose gradient analysis of a salt extract from the Tctex2b “knockout” (pf16-
D2) rescued for PF16 in the pf28 (lacks outer arms) background (pf16-D2pf28 Resc.
w/PF16). Tctex1 is dissociated from the I1 complex and migrates near the top of the
gradient whereas most IC140 is present in fractions 7-12. (c) Sucrose gradient analysis
of a high salt extract from Tctex2b “knockout” axonemes (pf16-D2HA4C). In the
absence of Tctex2b alone, Tctex1 no longer migrates at ~18S but appears near the top of
the gradient (similar to panel b), indicating that the absence of outer arms is not
responsible for the instability of Tctex1. Due to the high levels of protein in the pf16-
D2HA4C fractions and the high affinity of the IC140 antibody, a blot containing ~20%
the level of protein shown in the CBB-stained gel was probed to obtain the IC140 signal
shown in (c).
33
by guest on April 3, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Figure 8. Lack of Tctex2b Results in Decreased Swimming Speeds.
(a) Approximately 150 µg axonemes from wild-type (cc124), pf16-D2 (lacking both
PF16 and Tctex2b), pf16-D2HA4C (lacking only Tctex2b), and pf16-D2λ8b (transformed
with both PF16 and TCTEX2B genes) were electrophoresed in 5-15% acrylamide
gradient gels and either stained with Coomassie blue or transferred to nitrocellulose.
Western blot analysis using affinity purified CT117 verified that pf16-D2λ8b expressed
Tctex2b and that it is localized to the axoneme. (b) Swimming speeds for A54-e18
(parental strain to pf16-D2), Tctex2b “knockout” (pf16-D2 Resc. w/PF16), pf16-D2λ8b
(pf16-D2 resc. with both the PF16 and TCTEX2B genes) and pf16A resc. with PF16 were
calculated using Diagnostic Instruments Spot Advanced imaging software. The
histogram reveals the mean swimming speeds (+/- standard deviation) in µm/sec from
total sample sizes of >150 cells, from a minimum of two experiments.
Figure 9. Microtubule Sliding Velocity and Flagellar Beat Frequency Analysis.
(a) Isolated axonemes from various strains were demembranated before initiation of
microtubule sliding by addition of protease and ATP. Strains analyzed were parental
strain (A84-e18), a pf16 point mutant (pf16A), pf16A rescued with PF16, the pf16 and
tctex2b double mutant (pf16-D2), pf16-D2 rescued for only PF16, pf16-D2 rescued for
both PF16 and Tctex2b (pf16-D2λ8b), an outer armless mutant (pf28), and a double
mutant lacking both Tctex2b and outer arms (pf16-D2pf28 Resc. w/PF16). Microtubule
sliding velocities are expressed in µm/sec as the mean +/- standard deviation. (b)
Flagellar beat frequency was determined using the Fast Fourier Transform (FFT)
method. Cells from strains that lack Tctex2b (pf16-D2, pf16-D2 Resc. w/PF16) show a
34
by guest on April 3, 2018
http://ww
w.jbc.org/
Dow
nloaded from
decreased beat frequency compared to the parental strain (A84-e18) or cells rescued for
PF16 and Tctex2b (pf16-D2λ8b).
Figure 10. Model for the Organization of Inner Arm I1
This inner arm subspecies is composed of two HCs (1α and 1β) whose N-terminal stems
lead to a basal/cargo binding region that also includes three ICs (IC140, IC138, and
IC110) and several LCs (LC8, Tctex1, and Tctex2b, and an unidentified 12 kDa
component). The arrangement of ICs and LCs at the base of the dynein particle is
hypothetical. Based on chemical crosslinking data, IC140 and IC110 are thought to
interact (11). Tctex1 is positioned near the N-terminus of IC140 as this region contains a
Tctex1-binding consensus sequence (42). A potential interaction between Tctex2b and
IC140 is predicted based on the ability of both proteins to assemble in small amounts in
inner arm I1-defective strains. An additional association between Tctex2b and Tctex1 is
predicted, because in high salt extracts Tctex1 dissociates from inner arm I1 in the
absence of Tctex2b.
35
by guest on April 3, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Stephen M KingLinda M. DiBella, Elizabeth F. Smith, Ramila S. Patel-King, Ken-ichi Wakabayashi and
motor function in the chlamydomonas flagellumA novel Tctex2-related light chain is required for stability of Inner dynein arm I1 and
published online March 11, 2004J. Biol. Chem.
10.1074/jbc.M313540200Access the most updated version of this article at doi:
Alerts:
When a correction for this article is posted•
When this article is cited•
to choose from all of JBC's e-mail alertsClick here
by guest on April 3, 2018
http://ww
w.jbc.org/
Dow
nloaded from