A GPR174–CCL21 module imparts sexual dimorphism to humoral...
23
416 | Nature | Vol 577 | 16 January 2020 Article A GPR174–CCL21 module imparts sexual dimorphism to humoral immunity Ruozhu Zhao 1,2,3,4 , Xin Chen 1,2,3,4 , Weiwei Ma 1,2,3,9 , Jinyu Zhang 2,3,5 , Jie Guo 6 , Xiu Zhong 4 , Jiacheng Yao 4 , Jiahui Sun 1,2,3 , Julian Rubinfien 2,10 , Xuyu Zhou 6 , Jianbin Wang 4 & Hai Qi 1,2,3,4,7,8 * Humoral immune responses to immunization and infection and susceptibilities to antibody-mediated autoimmunity are generally lower in males 1–3 . However, the mechanisms underlying such sexual dimorphism are not well understood. Here we show that there are intrinsic differences between the B cells that produce germinal centres in male and female mice. We find that antigen-activated male B cells do not position themselves as efficiently as female B cells in the centre of follicles in secondary lymphoid organs, in which germinal centres normally develop. Moreover, GPR174—an X-chromosome-encoded G-protein-coupled receptor—suppresses the formation of germinal centres in male, but not female, mice. This effect is intrinsic to B cells, and correlates with the GPR174-enhanced positioning of B cells towards the T-cell–B-cell border of follicles, and the distraction of male, but not female, B cells from S1PR2-driven follicle-centre localization. Biochemical fractionation of conditioned media that induce B-cell migration in a GPR174-dependent manner identifies CCL21 as a GPR174 ligand. In response to CCL21, GPR174 triggers a calcium flux and preferentially induces the migration of male B cells; GPR174 also becomes associated with more Gαi protein in male than in female B cells. Male B cells from orchidectomized mice exhibit impaired GPR174-mediated migration to CCL21, and testosterone treatment rescues this defect. Female B cells from testosterone-treated mice exhibit male-like GPR174–Gαi association and GPR174-mediated migration. Deleting GPR174 from male B cells causes more efficient positioning towards the follicular centre, the formation of more germinal centres and an increased susceptibility to B-cell-dependent experimental autoimmune encephalomyelitis. By identifying GPR174 as a receptor for CCL21 and demonstrating its sex-dependent control of B-cell positioning and participation in germinal centres, we have revealed a mechanism by which B-cell physiology is fine-tuned to impart sexual dimorphism to humoral immunity. We began by comparing the formation of germinal centres by specific B cells from male and female MD4 mice. These particular B cells recog- nize hen egg lysozyme (HEL). We transferred MD4 B cells into the same male host mice together with OT-II helper T cells, which recognize the major histocompatibility complex (MHC) molecule I-A b in complex with chicken ovalbumin-derived peptide (OVA 323–339 ). Five days after immunization with HEL–OVA, female MD4 B cells made a substantially larger contribution to germinal centres than male cells (Extended Data Fig. 1a, b). Interestingly, at day 4 before visible germinal-centre for- mation, female MD4 cells were more concentrated in the follicular centre occupied by the follicular dendritic cell network, whereas male cells in the same follicle were more dispersed across the entire follicle (Extended Data Fig. 1c, d), suggesting that differential follicle-centre localization may underlie the differential germinal-centre formation by male and female B cells. A series of guidance receptors—including the chemokine recep- tors CXCR5 (refs. 4,5 ) and CCR7 (refs. 6,7 ), the sphingosine-1-phosphate receptor 2 (S1PR2; ref. 8 ) and the G-protein-coupled receptor GPR183 (refs. 9,10 )—orchestrates the sequential localization of antigen-activated B cells during a germinal-centre response. However, we did not detect differences in the expression of these receptors between the two sexes (Extended Data Fig. 2a). In a survey of additional G-protein-coupled receptors (GPCRs), we found that X-linked GPR174 was expressed by naive and germinal-centre B cells (Extended Data Fig. 2b). When https://doi.org/10.1038/s41586-019-1873-0 Received: 17 August 2018 Accepted: 31 October 2019 Published online: 25 December 2019 1 Tsinghua-Peking Center for Life Sciences, Tsinghua University, Beijing, China. 2 Laboratory of Dynamic Immunobiology, Institute for Immunology, Tsinghua University, Beijing, China. 3 Department of Basic Medical Sciences, School of Medicine, Tsinghua University, Beijing, China. 4 School of Life Sciences, Tsinghua University, Beijing, China. 5 Department of Microbiology and Biochemical Pharmacy, College of Pharmacy, Third Military Medical University, Chongqing, China. 6 Institute of Microbiology, Chinese Academy of Sciences, Beijing, China. 7 Beijing Key Laboratory for Immunological Research on Chronic Diseases, Tsinghua University, Beijing, China. 8 Beijing Frontier Research Center for Biological Structure, Tsinghua University, Beijing, China. 9 Present address: Centre for Immunology and Vaccinology, Chelsea and Westminster Hospital, Faculty of Medicine, Imperial College, London, UK. 10 Present address: Yale University, New Haven, CT, USA. *e-mail: [email protected]
Transcript of A GPR174–CCL21 module imparts sexual dimorphism to humoral...
416 | Nature | Vol 577 | 16 January 2020
Article
A GPR174–CCL21 module imparts sexual dimorphism to humoral immunity
Ruozhu Zhao1,2,3,4, Xin Chen1,2,3,4, Weiwei Ma1,2,3,9, Jinyu Zhang2,3,5, Jie Guo6, Xiu Zhong4, Jiacheng Yao4, Jiahui Sun1,2,3, Julian Rubinfien2,10, Xuyu Zhou6, Jianbin Wang4 & Hai Qi1,2,3,4,7,8*
Humoral immune responses to immunization and infection and susceptibilities to antibody-mediated autoimmunity are generally lower in males1–3. However, the mechanisms underlying such sexual dimorphism are not well understood. Here we show that there are intrinsic differences between the B cells that produce germinal centres in male and female mice. We find that antigen-activated male B cells do not position themselves as efficiently as female B cells in the centre of follicles in secondary lymphoid organs, in which germinal centres normally develop. Moreover, GPR174—an X-chromosome-encoded G-protein-coupled receptor—suppresses the formation of germinal centres in male, but not female, mice. This effect is intrinsic to B cells, and correlates with the GPR174-enhanced positioning of B cells towards the T-cell–B-cell border of follicles, and the distraction of male, but not female, B cells from S1PR2-driven follicle-centre localization. Biochemical fractionation of conditioned media that induce B-cell migration in a GPR174-dependent manner identifies CCL21 as a GPR174 ligand. In response to CCL21, GPR174 triggers a calcium flux and preferentially induces the migration of male B cells; GPR174 also becomes associated with more Gαi protein in male than in female B cells. Male B cells from orchidectomized mice exhibit impaired GPR174-mediated migration to CCL21, and testosterone treatment rescues this defect. Female B cells from testosterone-treated mice exhibit male-like GPR174–Gαi association and GPR174-mediated migration. Deleting GPR174 from male B cells causes more efficient positioning towards the follicular centre, the formation of more germinal centres and an increased susceptibility to B-cell-dependent experimental autoimmune encephalomyelitis. By identifying GPR174 as a receptor for CCL21 and demonstrating its sex-dependent control of B-cell positioning and participation in germinal centres, we have revealed a mechanism by which B-cell physiology is fine-tuned to impart sexual dimorphism to humoral immunity.
We began by comparing the formation of germinal centres by specific B cells from male and female MD4 mice. These particular B cells recog-nize hen egg lysozyme (HEL). We transferred MD4 B cells into the same male host mice together with OT-II helper T cells, which recognize the major histocompatibility complex (MHC) molecule I-Ab in complex with chicken ovalbumin-derived peptide (OVA323–339). Five days after immunization with HEL–OVA, female MD4 B cells made a substantially larger contribution to germinal centres than male cells (Extended Data Fig. 1a, b). Interestingly, at day 4 before visible germinal-centre for-mation, female MD4 cells were more concentrated in the follicular centre occupied by the follicular dendritic cell network, whereas male cells in the same follicle were more dispersed across the entire follicle
(Extended Data Fig. 1c, d), suggesting that differential follicle-centre localization may underlie the differential germinal-centre formation by male and female B cells.
A series of guidance receptors—including the chemokine recep-tors CXCR5 (refs. 4,5) and CCR7 (refs. 6,7), the sphingosine-1-phosphate receptor 2 (S1PR2; ref. 8) and the G-protein-coupled receptor GPR183 (refs. 9,10)—orchestrates the sequential localization of antigen-activated B cells during a germinal-centre response. However, we did not detect differences in the expression of these receptors between the two sexes (Extended Data Fig. 2a). In a survey of additional G-protein-coupled receptors (GPCRs), we found that X-linked GPR174 was expressed by naive and germinal-centre B cells (Extended Data Fig. 2b). When
https://doi.org/10.1038/s41586-019-1873-0
Received: 17 August 2018
Accepted: 31 October 2019
Published online: 25 December 2019
1Tsinghua-Peking Center for Life Sciences, Tsinghua University, Beijing, China. 2Laboratory of Dynamic Immunobiology, Institute for Immunology, Tsinghua University, Beijing, China. 3Department of Basic Medical Sciences, School of Medicine, Tsinghua University, Beijing, China. 4School of Life Sciences, Tsinghua University, Beijing, China. 5Department of Microbiology and Biochemical Pharmacy, College of Pharmacy, Third Military Medical University, Chongqing, China. 6Institute of Microbiology, Chinese Academy of Sciences, Beijing, China. 7Beijing Key Laboratory for Immunological Research on Chronic Diseases, Tsinghua University, Beijing, China. 8Beijing Frontier Research Center for Biological Structure, Tsinghua University, Beijing, China. 9Present address: Centre for Immunology and Vaccinology, Chelsea and Westminster Hospital, Faculty of Medicine, Imperial College, London, UK. 10Present address: Yale University, New Haven, CT, USA. *e-mail: [email protected]
Nature | Vol 577 | 16 January 2020 | 417
retrovirally overexpressed, GPR174 promoted B-cell localization towards the T-cell–B-cell border of secondary lymphoid organs (Fig. 1a, b) without increasing CCR7 expression (Extended Data Fig. 2c), and mark-edly inhibited germinal-centre formation (Fig. 1c and Extended Data Fig. 3a). To test whether GPR174 differentially regulates germinal-centre responses in the two sexes, we examined germinal-centre formation in GPR174-deficient male and female mice. Seven days after immuniza-tion with sheep red blood cells (SRBCs), the size of germinal centres was lower in males than in females; GPR174 deficiency led to a marked recovery of the germinal-centre size in males but did not affect females (Fig. 1d and Extended Data Fig. 3b). Males had lower levels of splenic plasma cells and anti-SRBC immunoglobulin G (IgG) titres, which also recovered substantially in the absence of GPR174 (Fig. 1e, f and Extended Data Fig. 3c). In a model of acute viral infection, GPR174 also differentially impinged on germinal-centre formation in different sexes (Extended Data Fig. 3d). Next, we constructed mixed bone-marrow chimaeras comprising 80% of bone-marrow cells from μMT mice (which cannot generate B cells) and 20% of wild-type or GPR174-deficient donor bone-marrow cells. One week after SRBC immunization, germinal-centre formation by Gpr174−/y B cells was higher than that by Gpr174+/y counterparts in male chimaeras, whereas female Gpr174+/+ and Gpr174−/− B cells did not differ in female chimaeras (Fig. 1g and Extended Data Fig. 3e). Splenic plasma cells and anti-SRBC titres followed the same trend (Fig. 1h, i and Extended Data Fig. 3f). Thus, GPR174 suppresses
the intrinsic ability of male, but not female, B cells to form germinal centres and produce plasma cells.
We observed no difference in the follicular distribution of naive B cells sufficient or deficient in GPR174, and no difference in localization to the T-cell–B-cell border following acute activation9 (Extended Data Fig. 4). Upregulation of S1PR2 on activated B cells promotes follicle-centre localization before germinal-centre formation11, a process that can be mimicked with S1PR2 overexpression8. To examine whether endogenous GPR174 regulates this process in a sex-dependent manner, we transduced S1PR2 into male and female B cells. Following transfer into B6 mice, wild-type male and female B cells concentrated towards the follicular centre comparably; by contrast, this process was exagger-ated by GPR174 deficiency for male, but not female, B cells (exemplified in Fig. 1j and quantified with a dispersal index in Fig. 1k–m). These data suggest that in male, but not female, mice endogenous GPR174 guides activated B cells away from the follicular centre, and thereby inhibits germinal-centre formation.
Previous studies have suggested that lysophosphoserine (LysoPS) is a GPR174 ligand12, and that GPR174 plays a part in regulating the func-tions of regulatory T cells13. However, we found that LysoPS does not induce GPR174-dependent migration, whereas culture medium condi-tioned by a crude preparation of splenic stromal elements contained a strong chemoattractant activity for GPR174, irreplaceable by LysoPS (Extended Data Fig. 5a, b). Because this chemoattractant activity was
a
c
Vector GPR174
b
d e f
CD35B220 GFP
Dis
per
sal i
ndex
Vector S1PR2
0
0.5
1.0
1.5
2.00.0010.94Gpr174+/y–Vector Gpr174–/y–Vector
Gpr174+/y–S1PR2 Gpr174–/y–S1PR2
Gpr174+/+–Vector Gpr174–/––Vector
Gpr174+/+–S1PR2 Gpr174–/––S1PR2
GFP
B22
0 C
D3
g
Vector GPR174–1.0
–0.5
0.0
0.5
1.0
1.5 ****
Rel
ativ
e d
ista
nce
to T
zon
ei
j
k
l
Vector GPR1740
20
40
60
80
100 ****
0
2
4
6
8
10
+/y –/y +/+ –/–
0.04
Ger
min
al c
entr
e (%
)
0.38
0
0.5
1.0
1.5
SP
PC
(%)
0.04 0.44
Gpr174 (20%) μMT (80%)
0
5
10
15
20
25
Ger
min
al c
entr
e (%
)
0.006 0.07 h
Dis
per
sal i
ndex
Vector S1PR2
+/+ +/+–/– –/–
+/y +/y–/y –/y
+/y +/+–/y –/–+/y +/+–/y –/–+/y +/+–/y –/–+/y +/+–/y –/– +/y +/+–/y –/–
0.93 0.17
0
0.5
1.0
1.5
2.0
SR
BC
-sp
eci�
c Ig
G t
itre 0.210.003
103
104
105
106
0
2
4
6
SP
PC
(%)
0.04 0.93
Gpr174 (20%) μMT (80%)
103
104
1050.120.0008
Gpr174 (20%) μMT (80%)
GFP
B22
0 C
D35
Dispersal index =Cell density in B220+CD35– area
Cell density in CD35+ area
SR
BC
-sp
eci�
c Ig
G t
itre
m
Per
cent
age
FAS
hiG
L7hi in
tran
sduc
ed M
D4
cells
Fig. 1 | GPR174 regulates B-cell positioning and suppresses germinal-centre formation in male, but not female, mice. a, Splenic distribution patterns of mouse B cells retrovirally transduced with vector that expresses GFP alone or in combination with GPR174, 24 h after adoptive transfer. B220, the follicle; CD3, the T-cell zone. b, Summary statistics of the relative distance to the T-cell zone, defined as the ratio between the shortest distance from GFP+ B cells to the T-zone edge (yellow dashed lines in a) and the maximum depth of the follicle (white lines), with negative values indicating T-zone locations. Each symbol denotes one B cell (n = 218 and 232), with data pooled from three experiments. Scale bar, 50 μm. c, Germinal-centre (FAShiGL7hi) frequencies of transduced MD4 B cells five days after immunization. Each symbol denotes one mouse (n = 8 mice), with data pooled from two experiments. d, e, Statistics for germinal centres (d) and spleen plasma cells (SPPCs) (e) in mice of the indicated genotypes and sexes seven days after SRBC immunization. Blue and cyan symbols, males; red and pink symbols, females. Each symbol denotes one mouse (n = 14, 15, 16 and 15 from left to right). Data pooled from four experiments. f, SRBC-specific IgG titres in sera from mice of the indicated genotypes and sexes 14 days after SRBC immunization. Each symbol denotes one mouse (n = 12, 12, 13 and 13); data pooled from two experiments.
g, h, Statistics of germinal centres (g) and SPPCs (h) in mixed bone-marrow chimeric mice seven days after SRBC immunization. Each symbol denotes one mouse (n = 18, 19, 18 and 18), with data pooled from four experiments. i, SRBC-specific IgG titres in sera of mixed bone-marrow chimaeras 14 days after SRBC immunization. Each symbol denotes one mouse (n = 12, 12, 12 and 10), with data pooled from two experiments. j, Distribution patterns of B cells of the indicated genotypes and sexes, transduced to express control vector (top) or S1PR2 (bottom), 12 h after transfer into sex-matched B6 recipients. Yellow lines outline follicle borders; white dashed lines outline CD35+ follicular dendritic cell regions in each follicle; yellow circles highlight transferred B cells in the IgD+ CD35− area; white circles highlight transferred B cells in the CD35+ region. Scale bar, 50 μm. k, Definition of the dispersal index. l, m, Summary statistics of dispersal indices for male (l) and female (m) cells. Each symbol represents one follicle (n = 55, 58, 44, 48 biological replicates for males; n = 58, 49, 46, 49 for females). Data were pooled from two independent experiments. b–e, g–h, l–m, Short horizontal lines indicate mean. Two-tailed unpaired Student’s t-tests were used. f, i, Column height indicates median. Two-tailed Mann–Whitney U-tests were used. P values are given in graphs; ****P < 0.0001.
418 | Nature | Vol 577 | 16 January 2020
Article
lost after heating at 100 °C or incubation with proteinase K (Extended Data Fig. 5c), it is likely that GPR174 sensed a protein. GPR174 is highly conserved in mammalian species, and we confirmed that the mouse receptor responded to ligands from rat (data not shown) and porcine (Extended Data Fig. 5d) spleens. Subsequently, through a 6-step iso-lation procedure (Extended Data Fig. 5e), we concentrated from 16 porcine spleens sufficient amounts of ligand activities for mass-spec-trometry-based protein identification (Extended Data Fig. 5f–k). Frac-tion 5 from the final mono-S purification step contained the strongest
chemoattractant activity and gave rise to bands with enhanced intensi-ties on silver-stained gels (Extended Data Fig. 5k–l). By mass spectrom-etry, we identified numerous peptides that collectively cover 50% of the porcine CCL21 sequence.
To verify that CCL21 and potentially CCL19 are chemokine ligands for GPR174, we neutralized CCL21 and CCL19 in splenic-stroma-condi-tioned medium. We found that blocking either CCL21 or CCL19 reduced, and blocking both abrogated, the migration of GPR174-transduced B cells to stroma-conditioned medium (Extended Data Fig. 6a). GPR174-transduced B cells also vigorously migrated towards recombinant CCL21 or CCL19 (Extended Data Fig. 6b). GPR174 or CCR7 transfection of 293T cells—which do not endogenously express these proteins— conferred a comparable binding capacity to CCL21 (Extended Data Fig. 6c). Finally, GPR174- or CCR7-expressing 293T cells responded to CCL21 with calcium fluxes in a dose-dependent manner (Extended Data Fig. 6d, e). The estimated half maximal effective concentration (EC50) for CCL21 to trigger either GPR174 or CCR7 was around 15 nM (with 95% confidence intervals of 9–23 nM for GPR174 and 8–28 nM for CCR7). Therefore, similarly to CCR7, GPR174 is a binding and sig-nalling receptor for CCL21. This is consistent with the fact that CCL21 is produced by stromal cells in the T-cell zone, and that GPR174 overexpression led B cells to position towards the T-cell–B-cell border (Fig. 1a, b).
To test whether endogenous GPR174 contributes to CCL21-directed B-cell migration differently between the two sexes, we first examined naive B cells. As shown in Fig. 2a, naive B cells migrated to CCL21 weakly in general, with barely 20% migrating at CCL21 concentrations of 1,000 ng ml−1. GPR174 deficiency did not have any effect on female naive B cells (compare the red and pink titration curves in Fig. 2a); for male naive cells, however, GPR174 deficiency led to a slight but discernible
g
B-cell donors: normal B-cell donors: gonadectomized
Naive Activated Naive Activated
a b c d
e f
CCL21 (ng ml–1)
0 30 100 300
0
20
40
60
0.0006
0.0005 NS
NS
0.0002
****
MaleMale, ORX
FemaleFemale, OVX
CCL21 (ng ml–1)
Per
cent
age
of w
ild t
ype
min
us p
erce
ntag
e of
GP
R17
4-kn
ocko
ut m
igra
ted
Per
cent
age
of w
ild t
ype
min
us p
erce
ntag
e of
GP
R17
4-kn
ocko
ut m
igra
ted
****
0 100 300 1,000–10
0
10
20
0.03 NS
0.02
0.04
****
MaleMale, ORX
FemaleFemale, OVX
Male wild type, ORX
Male knockout, ORX
Female wild type, OVX
Female knockout, OVX
0
20
40
60
80
100
****
0.0005
****
0.23
0.0003
0.0002
****
0.002
****
0.11
0.004
0.006
****
CCL21 (ng ml–1) CCL21 (ng ml–1)CCL21 (ng ml–1) CCL21 (ng ml–1)
100 300 1,000 30 100 300 100 300 1,000 30 100 300
Mig
rate
d c
ells
(%)
Male wild type
Male knockout
Female wild type
Female knockout
Male wild type + vehicle
Male knockout + vehicle
Female wild type + vehicle
Female wild type + testosterone****M
igra
ted
cel
ls (%
)
CCL21 (ng ml–1)
30 100 3000
15
30
45
60
Mig
rate
d c
ells
(%)
CCL21 (ng ml–1)
30 100 3000
20
40
60
80Experiment 1 Experiment 2
****
****
0.007
****
****
****
****
Fig. 2 | Sexually dimorphic GPR174-mediated B-cell migration to CCL21. a–d, Transwell migration in response to the indicated CCL21 concentrations by naive B cells (a, c) or B cells that were stimulated with anti-IgM (10 μg ml−1) and anti-CD40 (10 μg ml−1) antibodies for 48 h (b, d), from GPR174-sufficient or -deficient littermates that were either unmanipulated (a, b) or gonadectomized, six weeks after surgery (c, d). The dashed line at 40% aids cross-panel comparison. ORX, orchidectomized; OVX, ovariectomized. Data represent three biological replicates for each condition from one of three independent experiments with similar results. Blue asterisks, wild-type versus GPR174-knockout male; red asterisks, wild-type versus GPR174-knockout female; green asterisks, wild-type male versus wild-type female. e, f, Summary statistics from the three experiments, showing GPR174-dependent migration of naive B cells (e) or activated B cells (f) in response to CCL21, calculated by subtracting the mean percentage migrated of GPR174-knockout B cells from the mean percentage migrated of corresponding wild-type B cells. Mean values from individual experiments are indicated with different symbols, and bar heights indicate averages of the three experiments. Blue asterisks, male versus male ORX; red asterisks, female versus female OVX; green asterisks, male versus female. g, Transwell migration of activated B cells that were isolated from GPR174-sufficient or -deficient male or GPR174-sufficient female littermate mice treated with either vehicle or testosterone. Data represent three biological replicates for each condition, from two independent experiments. Blue asterisks, male wild type versus knockout plus vehicle; red asterisks, female wild type vehicle versus testosterone. All statistical comparisons were made by two-way analysis of variance (ANOVA) with Bonferroni’s multiple comparisons; ****P < 0.0001. NS, not significant.
CCL21(300 ng ml–1)
IP: GFP
– – + + – – + +
IB: Gαi-1
IB: Gα13
IB: GFP
IB: Gαi-2
Inputa
40
40
70
170
40
GPR174–GFPdonors
CCL21(300 ng ml–1)
IP: GFP
+ + – +
IB: Gαi-1
IB: Gα13
IB: GFP
IB: Gαi-2
Input
+ –VehicleTestosterone – – + – – +
– – – + + +
+ + – + + –– – + – – +– – – + + +
b
40
40
70
170
40
GFP
-nor
mal
ized
inte
nsity
Gαi-1 Gαi-2 Gα130
0.2
0.4
0.6
MaleFemale
Gαi-1 Gαi-2 Gα130
0.2
0.4
0.6
0.8
1.0
GFP
-nor
mal
ized
inte
nsity
Male + vehicleFemale + vehicleFemale + testosterone
GPR174–GFPdonors
GPR174–GFPdonors
GPR174–GFPdonors
Fig. 3 | Sex and hormone dependence of CCL21-induced GPR174–Gαi association. a, Left and centre, immunoblots (IBs) of lysates (left) or GFP immunoprecipitates (centre) of B cells isolated from male or female GPR174–GFP BAC transgenic mice, activated with anti-IgM and anti-CD40, and left untreated or stimulated with 300 ng ml−1 CCL21. Right, normalized quantities of indicated Gα proteins in co-immunoprecipitation (IP) products from three similar experiments, each represented by a different colour and a connecting line. b, Left and centre, immunoblots of lysates or GFP immunoprecipitates of B cells from the indicated sources and treatments, as in a. Right, normalized quantities of indicated Gα proteins in co-immunoprecipitation products from two experiments, each represented by a different colour and a connecting line. Gαi-1 was probed in one of the two experiments. Vehicle, mice treated with sunflower seed oil; testosterone, mice treated with testosterone dissolved in sunflower seed oil. For gel source data, see Supplementary Fig. 1.
Nature | Vol 577 | 16 January 2020 | 419
reduction in migration to 1,000 ng ml−1 CCL21 (wild type, 20.5 ± 1.0% migrated; knockout, 14.5 ± 1.3%; P < 0.0001).
Next, we examined activated B cells. As shown in Fig. 2b, activated male B cells migrated more strongly than female B cells towards CCL21, reaching twice as high a percentage migrated as the female cells at all CCL21 concentrations (compare the blue and red curves). GPR174 deficiency led to a roughly 50% reduction in migration by male cells (blue and cyan curves), down to a level comparable to that seen with wild-type female cells (the cyan and red curves); GPR174 deficiency in female activated B cells also led to a reduction, but of a smaller mag-nitude (compare the red and pink curves).
To test whether sex hormones are responsible, we further examined B cells from gonadectomized male and female mice. GPR174-deficient naive B cells isolated from orchidectomized mice actually migrated more in response to 1,000 ng ml−1 CCL21 (Fig. 2c) (wild type, 12.0 ± 0.9%; knockout, 16.8 ± 1.8%; P = 0.0017). GPR174-deficient female naive B cells also migrated more than wild-type cells following ovariectomy (compare the red and pink curves in Fig. 2a, c). For activated male B cells, isolated from orchidectomized mice, CCL21-induced migration was down to a level similar to that of female B cells isolated from normal mice (compare the blue curve in Fig. 2d with the red curve in Fig. 2b) and, notably, to a level similar to that of GPR174-deficient B cells from normal or orchidectomized mice (compare the blue curve in Fig. 2d to the cyan curves in Fig. 2b, d). Thus, orchidectomy substantially reduced GPR174-mediated migration to CCL21 in male activated B cells. On the other hand, ovariectomy did not change the comparatively smaller effect of GPR174 on female B cells (red and pink curves in Fig. 2b, d).
The data presented in Fig. 2a–d are from one experiment. Summary statistics from three such independent experiments are presented in Fig. 2e, f, in which the migrated fraction in each GPR174-deficient group is subtracted from that in the corresponding wild-type group to quantify GPR174-dependent migration. For naive B cells, GPR174 mediates a small response only to high concentrations of CCL21 in the male, but this effect is absent in female cells or in male cells from orchidectomized mice (Fig. 2e). For activated B cells, GPR174 medi-ates much stronger migration (more so in males than in females), and orchidectomy abrogates the margin by which male outperform female cells (Fig. 2f).
Although testosterone treatment in vitro for up to two days did not alter B-cell migration to CCL21 (data not shown), two-week testoster-one treatment of orchidectomized mice rescued their B-cell migra-tion to CCL21 (Extended Data Fig. 7a). Furthermore, B cells isolated from testosterone-treated female mice became much more efficient in migrating to CCL21 (Fig. 2g). We did not detect any difference in GPR174 or CCR7 expression by B cells from male, female, gonadectomized or testosterone-treated mice (Extended Data Fig. 7b–g). Transcriptomic analyses of B cells from sham-operated or gonadectomized male or female mice revealed no differential expression of known guidance
receptors (R.Z. et al., unpublished observations). GPR174 expression did not differ between male and female B cells during an active response in vivo (Extended Data Fig. 7h). Therefore, the male hormone condi-tions GPR174-mediated B-cell migration to CCL21, although receptor expression is not the point of regulation.
GPCR-mediated chemotaxis depends on coupling with Gαi pro-teins, and coupling to Gα12/13 proteins inhibits directional migration towards ligands. The same GPCR can couple to different Gα proteins in different cell types or in the same cell type of different sexes, as in the case of the corticotropin-releasing-hormone receptor14. To test whether GPR174 is differentially coupled to Gαi and/or Gα12/13 proteins in male and female B cells, we created a transgenic mouse line in which bacterial artificial chromosomes (BACs) were used to express a functionally validated construct consisting of GPR174 fused to green fluorescent protein (GFP) (Extended Data Fig. 8). We then immunoprecipitated GPR174–GFP-associated proteins from primary B cells using the GFP as a tag. B cells did not markedly express Gαi-3 or Gα12 (data not shown), and our analyses thus focused on Gαi-1, Gαi-2 and Gα13. As shown in Fig. 3a, GPR174 in activated male or female B cells was associated with Gα13 but minimally with Gαi-1 or Gαi-2, consistent with Gα13 activation by GPR174 in an assay of transforming growth factor-α (TGFα) shedding12. We also found that, upon CCL21 stimulation, GPR174 association with Gα13 became higher and asso-ciation with Gαi-1 and Gαi-2 was markedly increased, consistent with GPR174-promoted migration to CCL21; notably, the GPR174–Gαi association was stronger in male than in female B cells, whereas the GPR174–Gα13 association showed no difference between the sexes. For B cells isolated from female GPR174–GFP mice that were treated with testosterone, the profile of Gα association became similar to that of male B cells, exhibiting overtly increased CCL21-dependent Gαi association and unchanged Gα13 association (Fig. 3b). These data show that ligand-engaged GPR174 is differentially coupled to Gαi in male and female B cells, and reveal a likely mechanism for the sexual dimorphism of GPR174-mediated migration to CCL21.
In an active immune response, GPR174-deficient male B cells became more concentrated within the follicular dendritic cell network and made a much larger contribution to germinal-centre formation (Extended Data Fig. 9), whereas GPR174 made no difference to B-cell localization or germinal-centre magnitude in females (Extended Data Fig. 10 and data not shown). This indicates that the sexually dimorphic GPR174 response to CCL21 is one reason why humoral responses are weaker in males than in females. To test whether this GPR174 effect impinges on susceptibility to B-cell-dependent autoimmune diseases, we resorted to experimental autoimmune encephalomyelitis (EAE), which is induced in mice by immunization with human myelin oligo-dendrocyte glycoprotein (MOG1–120)—a model that recapitulates the requisite role of B cells in human multiple sclerosis15–17. We immunized male μMT:Gpr174+/y, male μMT:Gpr174−/y, female μMT:Gpr174+/+ and
a b
104
105
106
0.0002
Ant
i-hM
OG
1–12
0 Ig
G t
itre
0.33
Clin
ical
sco
re13 15 17 19 21 23 25 27 29 13 15 17 19 21 23 25 27 29
Day post immunization
0
1
2
3
μMT + wild typeμMT + knockout
μMT + wild typeμMT + knockout
μMT + wild typeμMT + knockout
0.02
Clin
ical
sco
re
Day post immunization
0
1
2
3
μMT + wild typeμMT + knockout
0.56
Fig. 4 | B-cell GPR174 reduces EAE susceptibility and autoantibody titres in male mice. a, EAE disease scores of 12-week-old mixed bone-marrow chimaeras of the indicated sexes, constructed with 80% μMT and 20% GPR174-sufficient or -deficient bone-marrow cells. Data (n = 10 mice each group) are from one of two independent experiments with similar results. b, Anti-MOG IgG titres in the indicated chimaera on day 30 after EAE induction. Data (n = 16 mice each
group) are pooled from two independent experiments. Data are plotted as mean ± s.e.m., compared by two-way ANOVA with Bonferroni’s multiple comparisons (a), or as individual mice with bars indicating median and compared by two-tailed Mann–Whitney U-test (b). P values are given in the graph.
420 | Nature | Vol 577 | 16 January 2020
Articlefemale μMT:Gpr174−/− bone-marrow (80/20) chimaeras with human MOG1–120 protein and followed the disease course. All mice developed symptoms of EAE, with females suffering a more severe disease course; GPR174 deletion did not change the disease course in females but did exacerbate it in males (Fig. 4a). Correlating with this finding, male μMT:Gpr174+/y chimaeras produced the lowest MOG1–120-specific anti-body titres, which were increased in male μMT:Gpr174−/y chimaeras to a level similar to that in females (Fig. 4b). Therefore, the sexually dimorphic functions of GPR174 in B cells contribute substantially to different disease susceptibilities in the two sexes.
Our study identifies GPR174 as a receptor for CCL21, and reveals its chemotactic effects on activated B cells as a mechanism for sexual dimorphism in humoral responses and autoimmunity. Testosterone-conditioned differential coupling to Gαi proteins underlies the different effects of GPR174 on male and female B-cell migration to CCL21. Given the well-established role of CCR7 in CCL21-mediated chemotaxis, it is an intriguing possibility that CCL21 binding might induce GPR174–CCR7 heterodimerization and achieve a signalling outcome that these two receptors cannot attain individually. When CCR7 is ablated in B cells, CCL21-induced GPR174–Gαi coupling and GPR174-mediated migration are markedly reduced (R.Z. et al., unpublished observations), suggest-ing a dual role for CCR7 in governing the B-cell migratory response to CCL21 via itself and GPR174. LysoPS restrains regulatory T cells in a GPR174-dependent manner13. Future studies will need to elucidate how tripartite CCL21–GPR174–CCR7 interactions regulate Gαi coupling and downstream signals in a testosterone-dependent manner, and whether and how LysoPS and CCL21 might compete or collaborate in trigger-ing GPR174-dependent functions. Although the functions of GPR174 in humans remain to be validated, antagonists that selectively target GPR174 binding to CCL21 or selectively inhibit GPR174–Gαi coupling in B cells might boost vaccine outcomes in otherwise poorly respond-ing men.
Online contentAny methods, additional references, Nature Research reporting sum-maries, source data, extended data, supplementary information,
acknowledgements, peer review information; details of author con-tributions and competing interests; and statements of data and code availability are available at https://doi.org/10.1038/s41586-019-1873-0.
1. Whitacre, C. C. Sex differences in autoimmune disease. Nat. Immunol. 2, 777–780 (2001).2. Klein, S. L. & Flanagan, K. L. Sex differences in immune responses. Nat. Rev. Immunol. 16,
626–638 (2016).3. Ghosh, S. & Klein, R. S. Sex drives dimorphic immune responses to viral infections. J.
Immunol. 198, 1782–1790 (2017).4. Ansel, K. M. et al. A chemokine-driven positive feedback loop organizes lymphoid
follicles. Nature 406, 309–314 (2000).5. Förster, R. et al. A putative chemokine receptor, BLR1, directs B cell migration to defined
lymphoid organs and specific anatomic compartments of the spleen. Cell 87, 1037–1047 (1996).
6. Nakano, H. et al. A novel mutant gene involved in T-lymphocyte-specific homing into peripheral lymphoid organs on mouse chromosome 4. Blood 91, 2886–2895 (1998).
7. Förster, R. et al. CCR7 coordinates the primary immune response by establishing functional microenvironments in secondary lymphoid organs. Cell 99, 23–33 (1999).
8. Green, J. A. et al. The sphingosine 1-phosphate receptor S1P2 maintains the homeostasis of germinal center B cells and promotes niche confinement. Nat. Immunol. 12, 672–680 (2011).
9. Pereira, J. P., Kelly, L. M., Xu, Y. & Cyster, J. G. EBI2 mediates B cell segregation between the outer and centre follicle. Nature 460, 1122–1126 (2009).
10. Gatto, D., Paus, D., Basten, A., Mackay, C. R. & Brink, R. Guidance of B cells by the orphan G protein-coupled receptor EBI2 shapes humoral immune responses. Immunity 31, 259–269 (2009).
11. Pereira, J. P. P., Kelly, L. M. & Cyster, J. G. Finding the right niche: B-cell migration in the early phases of T-dependent antibody responses. Int. Immunol. 22, 413–419 (2010).
12. Inoue, A. et al. TGFα shedding assay: an accurate and versatile method for detecting GPCR activation. Nat. Methods 9, 1021–1029 (2012).
13. Barnes, M. J. et al. The lysophosphatidylserine receptor GPR174 constrains regulatory T cell development and function. J. Exp. Med. 212, 1011–1020 (2015).
14. Bangasser, D. A. et al. Sex differences in corticotropin-releasing factor receptor signaling and trafficking: potential role in female vulnerability to stress-related psychopathology. Mol. Psychiatry 15, 896–904 (2010).
15. Lyons, J. A., San, M., Happ, M. P. & Cross, A. H. B cells are critical to induction of experimental allergic encephalomyelitis by protein but not by a short encephalitogenic peptide. Eur. J. Immunol. 29, 3432–3439 (1999).
16. Genain, C. P., Cannella, B., Hauser, S. L. & Raine, C. S. Identification of autoantibodies associated with myelin damage in multiple sclerosis. Nat. Med. 5, 170–175 (1999).
17. Mulero, P., Midaglia, L. & Montalban, X. Ocrelizumab: a new milestone in multiple sclerosis therapy. Ther. Adv. Neurol. Disorder. https://doi.org/10.1177/1756286418773025 (2018).
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
© The Author(s), under exclusive licence to Springer Nature Limited 2019
Methods
MiceThe following mice were originally from the Jackson Laboratory: C57BL/6 ( Jax664), μMT ( Jax2288), GFP-expressing ( Jax4353), cyan fluorescent protein (CFP)-expressing ( Jax 4218), dsRed-expressing ( Jax 6051), OVA323–339-specific T-cell-receptor transgenic OT-II ( Jax 4194) and HEL-specific Ig-transgenic MD4 ( Jax2595). GPR174-deficient mice were gener-ated by standard gene-targeting procedures to replace the Gpr174 open reading frame with a LacZ/neo cassette using the 129SvEvBrd embryonic stem cell line (Texas A&M Institute for Genomic Medicine, TG0128). These GPR174-deficient mice were backcrossed to C57BL/6 mice for 12 genera-tions. Relevant mice on the C57BL/6 background were interbred to obtain GFP-expressing MD4 mice and dsRed-expressing GPR174-sufficient or -deficient MD4 mice. Age-matched littermates between 6 and 12 weeks of age and of the indicated sexes were used for experiments. Sample sizes for mouse experiments were empirically determined, and mice were randomly assigned to control or experimental group. No blinding was necessary for the mouse experiments presented here. All mice were maintained under specific-pathogen-free conditions and were used in accordance with governmental and Tsinghua Institutional Animal Care and Use Committee guidelines for animal welfare.
GPR174–GFP BAC transgenic miceSequences coding for the glycine–glycine–glycine–serine (GGGS) linker (repeated four times) and enhanced GFP (EGFP) were inserted immediately before the stop codon of the GPR174 open reading frame in the mouse BAC clone RP23-206J14 by homologous recombination. The modified BAC was purified and microinjected into the pronuclei of fertilized ova to generate transgenic reporters. A founder mouse that was screened positive for GFP-expressing B cells in the blood was used to further breed with B6 mice to establish the GPR174–GFP BAC strain.
Cell culture, retrovirus and in vitro transductionNaive T cells or B cells were isolated using the Negative CD4 T-cell Isola-tion Kit or the Naive B-cell Isolation Kit (Miltenyi Biotec) according to the manufacturer’s protocols. To overexpress target genes in B cells, purified B cells were activated with 1 μg ml−1 lipopolysaccharide (Sigma) for 1 day before being spin-infected with retroviral supernatants at 1,500g for 2 h, as described18.
Construction of bone-marrow chimaerasB6 recipient mice were lethally irradiated by X-ray (5.5 Gy, twice) and then given an intravenous transfer of 3 × 106 sex-matched bone-marrow cells, consisting of 80% μMT cells and 20% GPR174-sufficient or -defi-cient cells. Chimaeras were used for experiments six to eight weeks after reconstitution.
GonadectomyMice after weaning were anaesthetized with avertin (2.5%, 0.015 ml g−1 body weight) intraperitoneally. For ovariectomy of female mice, ova-ries on both sides were exposed and removed through bilateral dorsal incisions. For orchidectomy in male mice, a median abdominal incision was made to expose and remove testicles on both sides. Sham-operated control mice underwent surgery including bilateral dorsal incisions or a median abdominal incision without removal of ovaries or testicles. Surgical wound openings were sutured, and antibiotics and analgesics were applied locally. Mice were allowed to recover for eight weeks before subsequent experiments.
Testosterone treatmentSix- to eight-week-old mice were subcutaneously injected with tes-tosterone (10 mg kg−1 body weight) dissolved in sunflower seed oil every other day for two weeks. Vehicle control mice were treated with sunflower seed oil alone.
Adoptive transfer, immunization and viral infectionTo measure germinal-centre formation by MD4 B cells, 105 OT-II T cells and 5 × 105 MD4 B cells of indicated genotypes were intravenously trans-ferred into male B6 recipients, which were subsequently immunized subcutaneously with 0.5 μg lipopolysaccharide and 30 μg HEL–OVA conjugate antigen in alum (Thermo Scientific). The HEL–OVA was made by chemical crosslinking with a HydraLink conjugation kit (SoluLink) as previously described19. To measure germinal-centre formation in response to SRBC immunization or lymphocytic choriomeningitis virus (LCMV) infection, mice were injected intraperitoneally with 5 × 108 SRBCs (from Z. Baiji) or 2 × 105 plaque-forming units of the LCMV Arm-strong virus (from L. Ye and R. Ahmed).
EAE by MOG protein immunizationThe sequence encoding the first 120 amino acids of human MOG was amplified by polymerase chain reaction (PCR) from a human brain complementary DNA library, and cloned between the NdeI and XhoI sites of the pET22b+ expression vector (Novagen). Human MOG pro-tein was expressed in BL21(DE3) Escherichia coli and purified by its carboxy-terminal histidine (His) tag. Protein purity and concentra-tion were assessed by SDS–PAGE and bicinchoninic acid (BCA) protein assay, respectively. Recombinant proteins were stored at −80 °C until use. To induce EAE, bone-marrow-chimeric animals of indicated types were immunized subcutaneously at the flank with 200 μg recombinant human MOG protein emulsified in complete Freund’s adjuvant on day 0. Mice were injected intravenously with 200 ng of pertussis toxin (Invitrogen) on days 0 and 2. Mice were monitored daily in a blind man-ner for disease progression from day 1. Disease severity was scored as following: 0, no clinical signs; 1, paralysed tail; 2, loss of coordinated movement and paresis of hind limbs; 2.5, paralysis of one hind limb; 3, paralysis of both hind limbs; 3.5, paralysis of both hind limbs and weakness in forelimbs; 4, paralysis of forelimbs; and 5, moribund. To compare disease severity, we studied ten mice per condition per experi-ment, and analysed disease scores over time with two-way ANOVA.
Flow cytometrySingle-cell suspensions were incubated in MACS buffer (phosphate-buffered saline (PBS) supplemented with 1% fetal bovine serum (FBS) and 5 mM EDTA) containing 20 μg ml−1 2.4G2 (BioXcell) for 20 min before being stained with indicated monoclonal antibodies. Stain-ing reagents included: BV421-anti-CD4 (GK1.5), APC-Cy7-anti-CD19 (1D3), PE-Cy7-anti-CD95 ( Jo2), AlexaFluor-700-anti-B220 (RA3-6B2), eFlour450-anti-B220 (RA3-6B2) and APC-anti-CD138 (281-2) from BD Biosciences; and eFlour450-anti-GL7 (GL-7) and FITC-anti-GL7 (GL-7) from eBioscience; PerCP Cy5.5 anti-IgD (HK1.4), biotinylated anti-CCR7 (4B12), and streptavidin-APC (405207) from Biolegend. Dead cells were excluded from analysis by staining with 7-AAD (Biotium) or using the Zombie Yellow Fixable Viability kit (Biolegend). All cytometry data were collected on an LSR II or FACSAria III cytometer (BD Biosciences) and analysed with FlowJo software (TreeStar).
Measurement of antigen-specific antibody titresTo measure SRBC-specific antibody titres, we lysed 5 × 108 SRBCs with 1 ml double-distilled water and centrifuged them at 15,000 r.p.m. for 20 min. The pellet was resuspended in PBS and used to coat MaxiSorp enzyme-linked immunosorbent assay (ELISA) plates (Nunc Maxisorp) overnight at 4 °C. To measure MOG-specific serum antibodies, we used 2 μg ml−1 purified recombinant human MOG to coat the ELISA plates. Nonspecific binding was blocked with 1% bovine serum albu-min (BSA) in PBS with Tween-20 (PBST) for 2 h at 37 °C, followed by incubation with 2× serial dilutions of serum samples of immunized mice for 1 h at 37 °C. Plates were washed and incubated with horse-radish peroxidase (HRP)-conjugated anti-mouse IgG secondary anti-body (1/20,000) for 1 h at 37 °C. Plates were washed, developed with
Article3,3′,5,5′-tetramethylbenzidine (TMB) and stopped with 1 M HCl. We set blank wells as zero, and recorded absorbance at 450 nm. We used sera from unimmunized mice as the negative control; the cut-off value was the optical density at 450 nm (OD450) of the negative control multiplied by 2.1. A well with an OD450 value of no less than the cut-off value was considered positive. The highest dilution of a sample that gave positiv-ity is the titre of the sample.
Distribution of B cells by immunohistochemistryFor various experiments, naive B cells, B cells activated for 1 h with 10 μg ml−1 F(ab′)2 goat anti-mouse IgM ( Jackson Immunoresearch), or B cells transduced with retrovirus were transferred into B6 recipients. When required, these cells were labelled with 1 μM tetramethylrho-damine (TAMRA), 4-chloromethyl-6,8-difluoro-7-hydroxycoumarin (CMF2HC) or 5-chloromethylfluorescein diacetate (CMFDA) (Invit-rogen). Spleens or inguinal lymph nodes of the recipient mice were fixed with 1% paraformaldehyde for 12 h and then dehydrated in 30% sucrose solution for 12 h at 4 °C. To ensure maximum representation of different organ regions in the final dataset, we processed nonconsecu-tive tissue sections and stained them with indicated antibodies. Stain-ing reagents included eFluor450-IgD (eBioscience), APC-CD35 (BD), PE-CD3 (BD), eFluor450-B220 (eBioscience), rabbit anti-GFP (abcam), and AF488 goat anti-rabbit IgG (Invitrogen). Slides were mounted with the ProlongGold Antifade reagent (Invitrogen) and examined with an Olympus FV1000 upright microscope. Images were analysed with Imaris (Bitplane) and ImageJ 1.46r (National Institutes of Health).
Splenic stroma preparationSpleens from mice, rats or pigs were repeatedly pressed and ground against a metal mesh to release red blood cells and lymphocytes. The remaining unsuspendable, amorphic stromal tissue elements were thoroughly washed with PBS before being placed in B27 serum-free culture medium (Invitrogen) and incubated at 37 °C for 12 h. For mice, stromal elements from three animals were cultured in 1 ml medium. For pigs, stromal elements from 1 spleen were cultured in 80 ml. The resultant culture was centrifuged at 10,000 r.p.m. for 60 min to obtain the conditioned medium, which was either immediately used for experi-ments or frozen at −20 °C until use.
Transwell assayB cells activated with 1 μg ml−1 lipopolysaccharide for 60 h were used to assay different fractions resulting from biochemical fractionation. Naive B cells or B cells activated with 10 μg ml−1 F(ab′)2 goat anti-mouse IgM ( Jackson Immunoresearch) and 10 μg ml−1 anti-CD40 (clone FGK4.5, Bio X Cell) were used to assay CCL21-induced migration. When B cells of different genotypes were compared, at least three donor mice of each genotype and treatment were used to isolate B cells in each experi-ment, and littermates were always used. B cells were suspended at 106 cells per millilitre and rested in RPMI medium containing 1% FBS at 37 °C for 1 h. Next a total of 100 μl cell suspension was added to the upper chamber in a 5-μm-pore Transwell (Corning Costar), and a total of 150 μl attractant-containing solutions was added to the bottom chamber. These solutions included culture medium conditioned with crude mouse splenic stroma preparation, culture medium conditioned with crude porcine splenic stroma preparation, elution fractions from chromatography, culture medium containing recombinant CCL21 and CCL19 (Peprotech), or 18/0 LysoPS (Avanti Polar Lipids) of indicated concentrations. For some experiments, murine stroma-conditioned medium was first supplemented with a final concentration of 5 μg ml−1 neutralizing antibodies against mouse CCL21 or CCL19 (R&D system) or goat IgG isotype control, and incubated at 4 °C for 3 h before being used for the transwell assay. The antibody dose was at least sufficient to neutralize 100 ng ml−1 CCL21 or CCL19, as determined in preliminary experiments. Cells were allowed to transmigrate for 3 h at 37 °C in an incubator. Cells that had migrated to the bottom wells were enumerated
by flow cytometry, with fluorescent A20 cells of known numbers added immediately before reading as an internal counting standard. Each condition was measured in triplicate wells unless indicated otherwise.
Biochemical fractionationChromatography was carried out using an ÄKTApurifer 10 fast protein liquid chromatography (FPLC) system (GE Healthcare) at 4 °C, with the exception of the last step, which was carried out using an ÄKTAmicro FPLC system (GE Healthcare). A total of 1,200 ml porcine stroma-con-ditioned medium was applied to an anion-exchange column (250 ml bed volume) equilibrated with buffer I (25 mM Hepes, pH 7.0). The column was washed with three column volumes before being eluted with three column volumes of buffer I supplemented with 1 M NaCl. The flow-through was buffer-changed with buffer II (25 mM Tris-HCl, pH 8.5) into 100 ml and reapplied to an anion-exchange column equilibrated with buffer II. The column was washed with two column volumes of buffer II and eluted with two column volumes of a 0.1–0.5 M linear NaCl gradient. Fractions of 10 ml each were collected, and aliquots were buffer-changed with RPMI 1640 for the transwell assay. Active fractions were pooled and buffer-changed into 10 ml with buffer II and loaded onto a heparin column (5 ml bed volume) equilibrated with buffer II. The column was washed with 12 column volumes of buffer II and eluted with 4 column volumes of 0–2 M linear NaCl gradient. Fractions of 2 ml each were collected and aliquots were buffer-changed with RPMI 1640 for the transwell assay. Active fractions were again pooled, buffer-changed into 0.5 ml buffer I and loaded onto a Superdex-75 column (24 ml bed volume) equilibrated with buffer I. The column was then eluted with one-column volume of buffer I. Fractions of 0.5 ml each were collected, and aliquots were buffer-changed with RPMI 1640 for the transwell assay. Active fractions were pooled and concentrated into 0.5 ml to load onto a Mono S column (1 ml bed volume) equilibrated with buffer I. The column was washed with 12 column volumes of buffer I and eluted with 25 column volumes of 0–0.5 M linear NaCl gradient. Fractions of 1 ml each were collected, and aliquots were buffer-changed with RPMI 1640 for the transwell assay. Active fractions were pooled, buffer-changed and concentrated into 50 μl with buffer I, and reloaded onto the Mono S column equilibrated with buffer I. The column was washed with three column volumes of buffer I containing 0.3 M NaCl, and eluted with 24 column volumes of 0.3–0.4 M linear NaCl gradient. Fractions of 1 ml each were collected, and aliquots were buffer-changed with RPMI 1640 for the final transwell assay to identify the fraction that contained the strongest chemoattractant activity.
Mass spectrometry analysisFractions from the last purification step were concentrated into 50 μl and analysed on 12% NuPAGE gels (Invitrogen). Gels were stained with the Pierce silver stain for mass spectrometry (Thermo Fisher Scientific) according to the manufacturer’s protocol. Bands of increased intensi-ties in the fraction containing the strongest chemoattractant activity were excised and subjected to in-gel digestion before being analysed with a Q Exactive HF mass spectrometer (Thermo Fisher Scientific). Mass spectrometry data were analysed using the Swissprot database with the MASCOT search engine.
His-tagged recombinant CCL21 and binding assayThe mouse CCL21 coding sequence was amplified from C57BL/6 mouse spleen cDNA and cloned between the NdeI and XhoI sites of the pET22b+ expression vector (Novagen), which provides a C-terminal His tag. The recombinant protein was expressed in BL21(DE3) mice and purified by its His tag. Protein purity and concentration were assessed by SDS–PAGE and BCA assay, respectively, and bioactivity was verified using a calcium mobilization assay. Recombinant proteins were stored at −80 °C until use. To measure CCL21–His binding to GPR174, with CCR7 as a positive control, 293T cells were transfected with GPR174–GFP or CCR7–GFP fusion constructs. Aliquots of transfected cells were then
incubated with CCL21–His protein at indicated concentrations at 37 °C for 30 min, washed twice with cold PBS, and fixed immediately with 4% paraformaldehyde. After washings in PBS, the fixed cells were stained with a phycoerythrin-conjugated anti-His antibody (clone J095G46, Biolegend) and analysed by flow cytometry. GFP− cells in each sample served as a nonspecific background staining internal control, and the mean fluorescence intensity (MFI) of GFP+ cells stained with phyco-erythrin-conjugated anti-His antibody, with the MFI of corresponding GFP− cells subtracted, was used to quantify specific CCL21 binding.
Measurement of chemokine-triggered calcium fluxesMouse Gpr174 and Ccr7 were amplified by PCR and cloned into the pRK5 plasmid. HEK293T cells were transiently transfected with GPR174-expressing, CCR7-expressing or control plasmid. Cells were physically detached from the culture vessel 48 h after transfection, washed twice with PBS, and stained with 1 μM Indo-1 (Invitrogen) in PBS at 37 °C for 30 min. After being washed twice with PBS, cells were resuspended with Hanks’ balanced salt solution (Invitrogen) containing 25 mM Hepes and 1% FBS, and kept on ice. When subjected to chemokine stimulation, cells were first brought into a water batch at 37 °C for 5 min of incubation, and then assessed on an LSR II cytometer (BD Biosciences) to establish the baseline for the unstimulated state. Cells were stimulated with a concentration series of recombinant CCL21 ranging from 0.1 ng ml−1 to 10 μg ml−1. Cells at each condition were continuously monitored and recorded for 2 min. At the end, ionomycin (Sigma) was further added to the sample at a final concentration of 1 μg ml−1, and the sample was further monitored and recorded for 1 min. Indo-1(bound)/Indo-1(free) ratios were used to indicate intracellular Ca2+ concentrations, as ana-lysed in FlowJo (TreeStar). The highest Ca2+ concentration stimulated by ionomycin was used as 100% to normalize the calcium response induced by CCL21. The EC50 was estimated in GraphPad by fitting a three-parameter, nonlinear dose–response curve.
Immunoprecipitation and western blottingFreshly isolated mouse B cells from GPR174–GFP BAC transgenic mice were activated with 10 μg ml−1 F(ab′)2 goat anti-mouse IgM and 10 μg ml−1 anti-CD40 for 48 h. These activated B cells were then suspended at 2 × 107 cells per millilitre in RPMI medium containing 1% FBS, and left untreated or stimulated with 300 ng ml−1 CCL21 at 37 °C for 30 min. B cells were then immediately lysed in 1% NP-40 lysis buffer (25 mM Tris-HCl, pH 7.4, 137 mM NaCl, 1% Nonidet P-40, 20% glycerol and protease inhibitors). For immunoprecipitation of GFP-tagged GPR174, lysates of 108 B cells were incubated overnight with 20 μl of GFP–Trap beads (ChromoTek). After repeated washings, immunoprecipitates were eluted by incubation in 0.2 M Glycine buffer (pH 3.0) for 10 min at room temperature, and then neutralized with 1 M Tris-HCl (pH 8.5). Proteins were separated by SDS–PAGE and transferred to polyvinylidene mem-brane (Millipore). Membranes were blocked with Tris-buffered saline containing 5% BSA and 0.1% Tween 20. To detect target molecules by immunoblotting, we used rabbit anti-GFP (Abcam), rabbit anti-Gαi-1 (Abcam), rabbit anti-Gαi-2 (Abcam) and rabbit anti-Gα13 (Abcam) anti-bodies. HRP-conjugated goat anti-rabbit antibody was purchased from Bioeasytech. Immunoblots were detected using enhanced chemilumi-nescence (Thermo Fisher Scientific), and images were analysed with ImageJ software.
Quantitative PCRCells of desired types were sorted with a FACSAria III and subjected to total RNA extraction with the RNeasy Plus Mini or Micro kit (Qiagen)
according to the manufacturer’s instructions. RNA was reverse- transcribed with All-In-One RT MasterMix (Abm). Quantitative PCR was performed with qPCR MasterMix (Abm) on a 7500 Real-Time PCR sys-tem (Applied Biosystems). Primers used were as follows: Gapdh sense 5′-TGTTCCTACCCCCAATGTGTC, antisense 5′-TAGCCCAAGATGCC CTTCAGT; Gpr174 sense 5′-AGGCCACACACCTTTTTCCC, antisense 5′-CAGGCCAGGACATCATGGAA; S1pr2 sense 5′-CAACTCCGGGACATA GACCG, antisense 5′-CCAGCGTCTCCTTGGTGTAA; Gpr183 sense 5′- CATAAAAGGACGCCTGCTCG, antisense 5′- TTTCCCACCAGCCC AATGAT; Ccr7 sense 5′-GGTGGCTCTCCTTGTCATTTTC, antisense 5′- TACGTCAGTATCACCAGCCC; Cxcr5 sense 5′- ACTACCCACTAAC CCTGGACA, antisense 5′- CGAGGTGGAACAGGAAGGTC. Relative expression of target genes among different samples was compared after normalization against expression of the housekeeping genes Actb or Gapdh.
Statistical data analysisStatistics and graphing were conducted in Prism (Graphpad). Unless indicated otherwise, two-tailed unpaired Student’s t-tests were used to compare endpoint means of different groups.
Reporting summaryFurther information on research design is available in the Nature Research Reporting Summary linked to this paper.
Data availabilityData generated here are included within the paper (and its Supplemen-tary Information files) or available from the corresponding author upon reasonable request. Source Data for Figs. 1–4 and Extended Data Figs. 1–10 are provided with the paper. 18. Wang, Y. et al. Germinal-center development of memory B cells driven by IL-9 from
follicular helper T cells. Nat. Immunol. 18, 921–930 (2017).19. Xu, H. et al. Follicular T-helper cell recruitment governed by bystander B cells and ICOS-
driven motility. Nature 496, 523–527 (2013).
Acknowledgements We thank the Protein Preparation and Characterization Core Facility at the Tsinghua University Branch of the China National Center for Protein Sciences for chromatography support; and T. Li, K. He and H. Wang at the National Center of Biomedical Analysis for expert advice and assistance with mass spectrometry. This work was funded in part by the National Natural Science Foundation of China (grants 81621002, 31830023, 81761128019 and 81425011), the Tsinghua-Peking Center for Life Sciences and the Beijing Municipal Science and Technology Commission. This work was also funded in part by the Bill and Melinda Gates Foundation and the Howard Hughes Medical Institute. The findings and conclusions within are those of the authors and do not necessarily reflect the positions or policies of the Bill and Melinda Gates Foundation or the Howard Hughes Medical Institute.
Author contributions R.Z. conducted a majority of the experiments and designed parts of the study. X.C. made the initial observation of GPR174-mediated positioning effects, developed conditioned media for ligand identification and, together with W.M., conducted baseline characterization of GPR174-deficient mice. X.C., J.G. and X. Zhou generated GPR174–GFP BAC transgenic mice. J.Z. conducted antibody titre analyses. J.Y., J.S. and J.W. conducted RNA-sequencing analyses. X. Zhong and J.R. helped with transwell and immunohistochemistry analyses, respectively. H.Q. conceptualized the study, supervised the work and wrote the paper with R.Z.
Competing interests The authors declare no competing interests.
Additional informationSupplementary information is available for this paper at https://doi.org/10.1038/s41586-019-1873-0.Correspondence and requests for materials should be addressed to H.Q.Peer review information Nature thanks Andrew Luster, Charles Mackay and the other, anonymous, reviewer(s) for their contribution to the peer review of this work.Reprints and permissions information is available at http://www.nature.com/reprints.
Article
Extended Data Fig. 1 | Intrinsic differences between male and female B cells in forming geminal centres. a, Representative contour plots and frequencies of dsRed-expressing and GFP-expressing MD4-derived cells of the indicated sexes, found in the initial transfer inoculum (left panels) or in the germinal-centre compartment in draining lymph nodes five days after subcutaneous immunization (middle and right panels) of male recipient mice. b, Summary statistics of the dsRed/GFP ratio in MD4 germinal centres (GCs), normalized against the dsRed/GFP ratio in transfer inoculum. Each symbol represents one mouse (n = 17 and 16); data were pooled from three independent experiments
with similar results. c, Representative distribution patterns of dsRed-expressing and GFP-expressing MD4 cells of the indicated sexes in follicles 90 h after immunization. Scale bar, 50 μm. d, Definition of the centre concentration index (CCI) and summary statistics of the CCI of dsRed+ tester cells of the indicated sexes, normalized against the CCI of GFP+ male control cells in the same follicle. Each symbol denotes one follicle (n = 38 and 46). Data pooled from two independent experiments with similar results. Scatter plots have horizontal lines denoting mean (b, d); two-tailed unpaired Student’s t-tests were used to calculate the P values at the top of each graph.
Extended Data Fig. 2 | Expression of guidance GPCRs in male and female cells, differential GPR174 expression by naive and germinal-centre B cells, and lack of influence on CCR7 expression. a, Relative mRNA expression of Cxcr5, S1pr2, CCR7 and Gpr183 in male or female dsRed-expressing MD4 B cells, normalized against that in cotransferred male GFP-expressing MD4 B cells (Extended Data Fig. 1), 90 h after immunization. Data are shown as pairs of three individual experiments. b, Relative Gpr174 mRNA levels in indicated splenic B cell subsets, normalized against Gapdh expression. The results are
shown as scatter plots of three biological replicates, with lines indicating mean, and are representative of two independent experiments with similar results. c, Surface CCR7 levels on B cells that were retrovirally transduced with a control or GPR174-expressing vector. GFP+, infected cells after transduction; GFP−, uninfected cells after transduction; representative of three independent experiments. Two-tailed paired (a) or unpaired (b) Student’s t-tests were used to calculate P values, given at the top of each graph; ****P < 0.0001.
Article
Extended Data Fig. 3 | GPR174 suppresses germinal-centre formation in male, but not female, mice. a, Representative cytometric profiles of FAShiGL7hi frequencies of transduced MD4 B cells in B6 recipients five days after immunization. b, c, Representative cytometric profiles of germinal centres (b) and SPPCs (c) in mice of the indicated genotypes and sexes seven days after SRBC immunization, matching the summary statistics presented in Fig. 1d, e, respectively. d, Representative cytometric profiles (left panels) and summary statistics (right panel) of germinal centres in littermate mice of the indicated
genotypes and sexes, eight days after infection with LCMV Armstrong (105 plaque-forming units per mouse). The scatter plot (right) shows individual mice with lines denoting mean (n = 15, 15, 14 and 14 mice, from left to right). Data pooled from three independent experiments with similar results. A two-tailed unpaired Student’s t-test was used. e, f, Representative cytometric profiles of germinal centres (e) and SPPCs (f) in mixed bone-marrow (BM) chimeric mice of indicated types seven days after SRBC immunization, matching the summary statistics presented in Fig. 1g, h, respectively.
Extended Data Fig. 4 | Endogenous GPR174 does not affect the follicular distribution of naive B cells or the accumulation of freshly activated B cells to the T-cell–B-cell border. a, Splenic distribution of GPR174-sufficient and -deficient naive B cells 24 h after adoptive transfer. WT, wild type; KO, knockout. Data are representative of two independent experiments involving either male or female cells. Scale bars, 50 μm. b, Left, splenic distribution of GPR174-sufficient or -deficient B cells that were stimulated with anti-IgM, 6 h
after adoptive transfer. Scale bar, 50 μm. Middle, definitions of follicular area, the T-cell–B-cell border and the T-cell zone, based on IgD and CD3 staining. Right, relative abundance of transferred B cells in the indicated regions. Data (n = 24 biological replicates) represent two independent experiments with similar results. Lines in scatter plots denote mean. We used two-way ANOVA with Bonferroni’s multiple comparisons; ns, not significant.
Article
Extended Data Fig. 5 | See next page for caption.
Extended Data Fig. 5 | Minimal LysoPS effects on GPR174-dependent B-cell migration and GPR174 ligand identification. a, Transwell migration of lipopolysaccharide-activated GPR174-sufficient or -deficient B cells in response to LysoPS of indicated concentrations. Data are plotted as mean ± s.e.m. of the percentage of cells that migrated in triplicated wells at each concentration, fitted with three-parameter log dose–response curves; two-way ANOVA was used to compare the two groups. One of two independent experiments with similar results is shown. b–d, Transwell migration of lipopolysaccharide-activated B cells that were transduced with a control or GPR174-expressing vector, in response to stroma-conditioned medium (stroma), dimethylsulfoxide (DMSO) control or LysoPS of indicated concentrations (b); or in response to stroma-conditioned medium (stroma), conditioned medium heated at 100 °C for 10 min (heated), conditioned medium treated with the proteinase K inhibitor PMSF alone (PMSF), conditioned medium treated with proteinase K and then PMSF (PK + PMSF), or conditioned media treated as above and then further supplemented with 300 ng ml−1 CXCL13 (PK + PMSF + CXCL13) to exclude cell damage owing to remaining proteinase activity (c); or in response to blank culture medium, or
mouse or porcine stroma-conditioned media (d). All data are plotted as the mean percentages of cells that migrated in triplicated wells, from one experiment representative of three with similar results. Two-way ANOVA with Bonferroni’s multiple comparison tests were used to compare vector and GPR174 groups, with P values given in the graphs. ****P < 0.0001; ns, not significant. e, Workflow showing the six-step biochemical fractionation method for identifying GPR174 ligands in splenic stroma-conditioned medium. See Methods for details. CV, column volume. f–k, Chromatography traces and putative ligand activities as detected by the transwell assay in d in relevant fractions during the six steps of e. AU, arbitrary units; mS, millisiemens. l, Left, silver staining of the indicated fractions from k resolved on 12% SDS–PAGE; the black box on fraction 5 marks bands subjected to liquid chromatography-mass spectrometry (LC-MS)/MS analysis. Right, identified unique porcine CCL21-derived peptides (solid underlines) aligned against porcine, human and murine CCL21 protein sequences. For gel source data, see Supplementary Fig. 1. Data shown in f–l are from one of two independent experiments with similar results. FT, flow-through.
Article
Extended Data Fig. 6 | CCL21 and CCL19 are chemoattractant ligands of GPR174. a, b, Transwell migration of lipopolysaccharide-activated B cells that were transduced with a control or GPR174-expressing vector: a, in response to stroma-conditioned medium (stroma) or 100 ng ml−1 recombinant CCL21 or CCL19, in the presence of control IgG or 5 μg ml−1 CCL21- or CCL19-blocking antibody, individually or in combination; b, in response to recombinant mouse CCL21 (left) or CCL19 (right). Data represent triplicated wells for each condition from one of three independent experiments with similar results. Two-tailed unpaired Student’s t-tests; ****P < 0.0001. c, Cytometric profiles and MFI of CCL21 binding to HEK293T cells transfected with control GFP, GPR174–GFP or CCR7–GFP fusion constructs, with background staining on the GFP− fraction subtracted from the corresponding GFP+ fraction. Left, gating of GFP− and GFP+ cells in each group (top) and histograms of anti-His staining (bottom) of cells that were incubated with different doses of His-tagged recombinant
CCL21. PE, phycoerythrin. Right, data represent three biological replicates for each condition, from one of three independent experiments with similar results. Two-way ANOVA tests were used to compare groups, with P values given in the graph; red asterisks, GFP versus GPR174–GFP; blue asterisks, GFP versus CCR7–GFP; green asterisks, GPR174–GFP versus CCR7–GFP; ****P < 0.0001. d, e, Exemplary calcium responses of HEK293T cells transfected with vector, GPR174 or CCR7, following stimulation with CCL21 or the calcium ionophore ionomycin at the indicated concentrations (d); and the magnitude of CCL21-triggered calcium responses as a fraction of the ionomycin-triggered maximum of the same cells, overlaid with three-parameter log dose–response curves on top (e). The two different symbols indicate data from two independent experiments. P values obtained from an extra sum-of-squares F-test of the null hypothesis that the GPR174 and CCR7 curves have the same EC50.
Extended Data Fig. 7 | See next page for caption.
ArticleExtended Data Fig. 7 | Testosterone dependence of the GPR174-mediated migratory response to CCL21 does not involve modulation of GPR174 or CCR7 expression. a, CCL21-induced transwell migration of B cells from GPR174-sufficient (WT) or -deficient (KO) male littermate mice that were sham-operated (sham) or orchidectomized (ORX), allowed to recover for six weeks, and then treated with either vehicle or testosterone for two weeks. Data represent three biological replicates from one of two independent experiments with similar results. Blue asterisks, male sham wild type plus vehicle versus sham GPR174-knockout plus vehicle; red asterisks, male ORX wild type plus vehicle versus male ORX wild type plus testosterone; green asterisks, male sham wild type plus vehicle versus male ORX wild type plus testosterone. b, Relative Gpr174 mRNA levels normalized to Gapdh expression in naive and activated B cells from male or female mice that were either sham-operated or gonadectomized. Data (n = 3 biological replicates) represent three independent experiments with similar results. c, Surface CCR7 levels on naive or activated B cells isolated from mice of the indicated GPR174 genotypes, sexes and gonadectomies. Data shown are histogram overlays (coloured lines,
CCR7; grey lines, isotype staining control) and CCR7 MFIs after isotype staining background subtraction. Each symbol in the MFI data represents one mouse, and data represent three independent experiments with similar results. d, e, Relative Gpr174 mRNA levels (d) and surface CCR7 levels (e) on activated B cells from male mice that were sham-operated or orchidectomized and then treated with either vehicle or testosterone. Data represent three mice per group from one of three independent experiments with similar results. f, g, Relative Gpr174 mRNA levels (f) and surface CCR7 levels (g) on activated B cells from male or female mice that were treated with either vehicle or testosterone. Data represent three mice per group from one of three independent experiments with similar results. h, Relative expression of Gpr174 mRNA in male or female dsRed-expressing MD4 B cells normalized against that in cotransferred male GFP-expressing MD4 B cells 90 h after activation by HEL–OVA immunization (as in Extended Data Fig. 1); three line-connected pairs indicate three independent experiments. Two-way ANOVA with Bonferroni’s multiple comparisons (a) or two-tailed unpaired (b–g) or paired (h) Student’s t-tests were used for statistical comparisons, with P values given in the graph.
Extended Data Fig. 8 | Characterization of GPR174–GFP transgenic mice. a, Diagrams of the GPR174–GFP fusion (top) and GPR174–GFP BAC construct (bottom) in the context of the Gpr174 genomic locus, with the five exons numbered in italics. b, Transwell migration of lipopolysaccharide-activated B cells that were transduced with a control, GPR174-expressing or GPR174-GFP-expressing vector in response to stroma-conditioned medium (stroma) or 10 ng ml−1 or 50 ng ml−1 recombinant CCL21. Data represent three biological replicates from one of two independent experiments with similar results.
c, d, Histograms (c) and geometric MFI (geo.mean) (d) of GFP fluorescence from naive and germinal-centre B cells in B6 (grey histograms) or GPR174–GFP BAC (open histograms) transgenic mice. Each symbol in the MFI plot represents one mouse, and data represent two independent experiments with similar results. Two-way ANOVA with Bonferroni’s multiple comparisons (b) or two-tailed unpaired Student’s t-test (d) was used for comparisons between groups. ****P < 0.0001; ns, not significant.
Article
Extended Data Fig. 9 | GPR174 retards follicular-centre localization and germinal-centre formation by male B cells. a, Representative distribution patterns of dsRed-expressing and GFP-expressing MD4 cells of the indicated genotypes in follicles of the draining lymph nodes 90 h after immunization of male recipient mice. Scale bar, 50 μm. b, Summary statistics of ratios between CCIs, as defined in Extended Data Fig. 1d, of dsRed+ cells and GFP+ cells of the indicated genotypes in the same follicles. Each symbol denotes one follicle (n = 42 and 43), with lines denoting mean. Data are pooled from two independent experiments with similar results. c, Representative contour plots
and frequencies of dsRed-expressing and GFP-expressing cells of the indicated genotypes in the transferred MD4 (left panels) or in the germinal-centre compartment five days after immunization (middle and right panels). d, Summary statistics of the dsRed/GFP ratio in MD4 germinal centres normalized against the dsRed/GFP ratio in transferred MD4. Each symbol denotes one mouse (n = 19 and 19), with lines denoting mean. Data are pooled from three independent experiments with similar results. Two-tailed unpaired Student’s t-tests were used to compare groups, with P values given in the graph.
Extended Data Fig. 10 | GPR174 does not affect germinal-centre formation by female B cells. a, Representative contour plots and frequencies of dsRed-expressing and GFP-expressing cells of the indicated genotypes in the transferred MD4 (left panels) or in the germinal-centre compartment five days after immunization (middle and right panels) of male recipient mice.
b, Summary statistics of the dsRed/GFP ratio in MD4 germinal centres, normalized against the dsRed/GFP ratio in transferred MD4 cells. Each symbol denotes one mouse, with lines showing mean. Data (n = 8 and 8) are pooled from two independent experiments with similar results. Two-tailed unpaired Student’s t-test was used to compare groups.
1
nature research | reporting summ
aryO
ctober 2018
Corresponding author(s): Hai Qi
Last updated by author(s): 2019/10/19
Reporting SummaryNature Research wishes to improve the reproducibility of the work that we publish. This form provides structure for consistency and transparency in reporting. For further information on Nature Research policies, see Authors & Referees and the Editorial Policy Checklist.
StatisticsFor all statistical analyses, confirm that the following items are present in the figure legend, table legend, main text, or Methods section.
n/a Confirmed
The exact sample size (n) for each experimental group/condition, given as a discrete number and unit of measurement
A statement on whether measurements were taken from distinct samples or whether the same sample was measured repeatedly
The statistical test(s) used AND whether they are one- or two-sided Only common tests should be described solely by name; describe more complex techniques in the Methods section.
A description of all covariates tested
A description of any assumptions or corrections, such as tests of normality and adjustment for multiple comparisons
A full description of the statistical parameters including central tendency (e.g. means) or other basic estimates (e.g. regression coefficient) AND variation (e.g. standard deviation) or associated estimates of uncertainty (e.g. confidence intervals)
For null hypothesis testing, the test statistic (e.g. F, t, r) with confidence intervals, effect sizes, degrees of freedom and P value noted Give P values as exact values whenever suitable.
For Bayesian analysis, information on the choice of priors and Markov chain Monte Carlo settings
For hierarchical and complex designs, identification of the appropriate level for tests and full reporting of outcomes
Estimates of effect sizes (e.g. Cohen's d, Pearson's r), indicating how they were calculated
Our web collection on statistics for biologists contains articles on many of the points above.
Software and codePolicy information about availability of computer code
Data collection Flowcytometry data were collected using BD FACSDIVA V8.0.1. Imaging data were collected using FV10-ASW V3.1. Protein purification data were collected using UNICORN V7.0.
Data analysis Flowcytometry data were processed and analyzed using FlowJo V10. Imaging data were processed and analyzed using Imaris V7.6.5 and ImageJ 1.52. Protein purification data were processed and analyzed using UNICORN V7.0
For manuscripts utilizing custom algorithms or software that are central to the research but not yet described in published literature, software must be made available to editors/reviewers. We strongly encourage code deposition in a community repository (e.g. GitHub). See the Nature Research guidelines for submitting code & software for further information.
DataPolicy information about availability of data
All manuscripts must include a data availability statement. This statement should provide the following information, where applicable: - Accession codes, unique identifiers, or web links for publicly available datasets - A list of figures that have associated raw data - A description of any restrictions on data availability
Data generated during this study are included in this published article (and its supplementary information files) or available from the corresponding author upon reasonable request.
2
nature research | reporting summ
aryO
ctober 2018
Field-specific reportingPlease select the one below that is the best fit for your research. If you are not sure, read the appropriate sections before making your selection.
Life sciences Behavioural & social sciences Ecological, evolutionary & environmental sciences
For a reference copy of the document with all sections, see nature.com/documents/nr-reporting-summary-flat.pdf
Life sciences study designAll studies must disclose on these points even when the disclosure is negative.
Sample size The sample size for each experiment is indicated in the figure legend. The sample size was chosen empirically to provide a sufficient level of statistical power for detecting indicated biological effects. No statistical methods were used to pre-determine the sample size.
Data exclusions No data were excluded from analyses.
Replication All experimental findings were reproducible across multiple independently repeated experiments, as indicated.
Randomization Where applicable, littermate animals of desired genotypes were randomly assigned into experimental and control groups.
Blinding Imaging analyses were conducted in a blinded manner.
Reporting for specific materials, systems and methodsWe require information from authors about some types of materials, experimental systems and methods used in many studies. Here, indicate whether each material, system or method listed is relevant to your study. If you are not sure if a list item applies to your research, read the appropriate section before selecting a response.
Materials & experimental systemsn/a Involved in the study
Antibodies
Eukaryotic cell lines
Palaeontology
Animals and other organisms
Human research participants
Clinical data
Methodsn/a Involved in the study
ChIP-seq
Flow cytometry
MRI-based neuroimaging
AntibodiesAntibodies used Antibodies included BV421-anti-CD4 (GK1.5, 562891), APC-Cy7-anti-CD19 (1D3, 557655), PE-Cy7-anti-CD95 (Jo2, 557653),
AlexaFluor-700-anti-B220 (RA3-6B2, 557957), eFlour450-anti-B220 (RA3-6B2, 558108), APC-anti-CD138 (281-2, 558626) from BD Biosciences; eFlour450-anti-GL7 (GL-7, 48-5902-82) and FITC-anti-GL7 (GL-7, 53-5902-82) from eBioscience; PerCP Cy5.5 anti-IgD (HK1.4, 405709), biotinylated anti-CCR7 (4B12, 120103), and streptavidin-APC (405207) from Biolegend. Antibodies were used at 1:200 dilution for staining cells or tissue sections.
Validation Based on information provided by commercial vendors.
Eukaryotic cell linesPolicy information about cell lines
Cell line source(s) A20 and 293T cell lines were originally from the American Type Culture Collection (Manassas, VA, USA).
Authentication No specific procedure was taken to authenticate the cell line identity.
Mycoplasma contamination The cell lines have been tested negative for mycoplasma contamination.
Commonly misidentified lines(See ICLAC register)
No cell lines used are in the database of commonly misidentified cell lines.
3
nature research | reporting summ
aryO
ctober 2018
Animals and other organismsPolicy information about studies involving animals; ARRIVE guidelines recommended for reporting animal research
Laboratory animals C57BL/6 (Jax664), μMT (Jax2288), GFP-expressing (Jax4353), CFP-expressing (Jax 4218), dsRed-expressing (Jax 6051), OVA323– 339-specific T-cell receptor transgenic OT-II (Jax 4194), and HEL-specific Ig-transgenic MD4 (Jax2595) mice were originally from the Jackson Laboratory. GPR174-deficient mice were generated by standard gene targeting procedures to replace the Gpr174 open reading frame with a lacZ/neo cassette using 129SvEvBrd embryonic stem cell line (Texas A&M Institute for Genomic Medicine, TG0128). These mutant mice were backcrossed to C57BL/6 for 12 generations. Relevant mice on the C57BL/6 background were interbred to obtain GFP-expressing MD4 mice and dsRed-expressing GPR174-sufficient or -deficient dsRed MD4 mice. Age-matched littermates between 6 and 12 weeks of age and of indicated sexes were used for experiments. All mice were maintained under specific-pathogen free conditions and were used in accordance of governmental and Tsinghua guidelines for animal welfare.
Wild animals The study did not involve wild animals.
Field-collected samples The study did not involve samples collected from the field.
Ethics oversight Identify the organization(s) that approved or provided guidance on the study protocol, OR state that no ethical approval or guidance was required and explain why not.
Note that full information on the approval of the study protocol must also be provided in the manuscript.
Flow CytometryPlots
Confirm that:
The axis labels state the marker and fluorochrome used (e.g. CD4-FITC).
The axis scales are clearly visible. Include numbers along axes only for bottom left plot of group (a 'group' is an analysis of identical markers).
All plots are contour plots with outliers or pseudocolor plots.
A numerical value for number of cells or percentage (with statistics) is provided.
Methodology
Sample preparation Spleen and LN single-cell suspension was incubated in MACS buffer (phosphate-buffered saline (PBS) supplemented with 1% fetal bovine serum (FBS) and 5 mM EDTA) containing 20 μg/ml 2.4G2 (BioXcell) for 20 min before being stained with indicated monoclonal antibodies.
Instrument LSR II or FACSAria III cytometer (BD Biosciences)
Software Flowcytometry data were processed and analyzed using FlowJo V10.
Cell population abundance At least 10000 events were acquired for cells in the defined gate.
Gating strategy For all experiments FSC-A/ SSC-A gates of the starting cell population were used to identify viable cells. Singlet cells were identified using FSC-H/ FSC-W gating. Isotype control was used to distinguish between background and marker-positive events.
Tick this box to confirm that a figure exemplifying the gating strategy is provided in the Supplementary Information.
