A G-Quadruplex-Containing RNA Activates Fluorescence in a ... · A G-Quadruplex-Containing RNA...

1

Supplementary Information

A G-Quadruplex-Containing RNA Activates Fluorescence

in a GFP-Like Fluorophore

Hao Huang1, Nikolai B. Suslov2,3, Nan-Sheng Li2, Sandip A. Shelke2,

Molly E. Evans2, Yelena Koldobskaya1, Phoebe A. Rice2,*, Joseph A. Piccirilli1,2,*

1Department of Chemistry, University of Chicago, Chicago, IL, 60637, USA.

2Department of Biochemistry and Molecular Biology, University of Chicago,

Chicago, IL, 60637, USA.

3Present address: Takeda California, San Diego, CA, 92121, USA

*Corresponding author e-mail: [email protected] or [email protected]

Nature Chemical Biology: doi:10.1038/nchembio.1561

2

Supplementary Results

Supplementary Note - Synthesis protocol of fluorophore analogues

(Z)-4-(4-Hydroxybenzylidene)-1,2-dimethyl-1H-imidazol-5(4H)-one (HBI) was

synthesized according to a procedure described previously1. 1H NMR

(CD3OD/TMS) 8.00 (d, 2H, J = 9.0 Hz), 7.02 (s, 1H), 6.84 (d, 1H, J = 9.0 Hz)

3.19 (s, 3H), 2.40 (s, 3H).

(Z)-4-(3-Fluoro-4-hydroxybenzylidene)-1,2-dimethyl-1H-imidazol-5(4H)-one

(MFHBI). N-Acetylglycine (209 mg, 1.78 mmol), anhydrous sodium acetate (146

mg, 1.78 mmol), 3-fluoro-4-hydroxybenzaldehyde (250 mg, 1.78 mmol), and

acetic anhydride (0.58 mL) were stirred at 100 ºC for 2 h. After cooling the

reaction to R.T., cold ethanol (5 mL) was added and the reaction mixture was left

at 4 ºC overnight. The resulting solid was collected by filtration, washed with a

small amount cold ethanol, and dried under vacuum to afford (Z)-2-fluoro-4-((2-

methyl-5-oxooxazol-4(5H)-ylidene)methyl)phenyl acetate as a pale yellow solid,

359 mg (77% yield). 1H NMR (CDCl3/TMS) 8.15 (dd, 1H, J = 11.6, 2.0 Hz), 7.70

(d, 1H, J = 8.4 Hz) 7.20 (t, 1H, J = 8.0 Hz), 7.05 (s, 1H), 2.42 (s, 3H), 2.36 (s, 3H).

A mixture of (Z)-2-fluoro-4-((2-methyl-5-oxooxazol-4(5H)-ylidene)methyl)phenyl

acetate (346 mg, 1.32 mmol), ethanol (1.4 mL), 40% aqueous methylamine

(0.28 mL), and potassium carbonate (28 mg) were heated to reflux for 4 h. After

cooling to R.T., the mixture was diluted with water (14 mL), acidified with

concentrated HCl to pH 3, and left at 4 ºC overnight. The yellow solid was

collected by filtration, rinsed with a small amount cold ethanol to give product as


3

a yellow solid, 181 mg (59% yield). 1H NMR (DMSO-d6) 8.20 (dd, 1H, J = 13.0,

1.5 Hz), 7.76 (d, 1H, J = 8.0 Hz), 7.00 (t, 1H, J = 8.8 Hz), 6.90 (s, 1H), 3.09 (s,

3H), 2.35 (s, 3H); 13C NMR (DMSO-d6) 169.7, 163.4, 150.7 (d, JC-F = 241 Hz),

147.1 (d, JC-F = 13 Hz), 137.3, 129.6 (d, JC-F = 2.6 Hz), 126.0 (d, JC-F = 7.2 Hz),

124.1 (d, JC-F = 2.6 Hz), 118.8 (d, JC-F = 19 Hz), 117.7 (d, JC-F = 3.3 Hz), 26.2,

15.4; MS (MALDI-TOF) calcd for C12H12FN2O2 [MH+] 235.1, found 235.5.

(Z)-4-[(3-Fluorophenyl)methylene]-2-methyl-5(4H)-oxazolone (FBO). N-

Acetylglycine (4.68 g, 40 mmol), anhydrous sodium acetate (3.28 g, 40 mmol), 3-

fluorobenzaldehyde (5.0 g, 40 mmol), and acetic anhydride (25 mL) were stirred

at 100 ºC for 2 h. After cooling, cold ethanol (60 mL) was added and the reaction

mixture was left at 4 ºC overnight. The resulting solid was collected by filtration,

washed with a small amount cold ethanol, and dried under vacuum to afford

product as a pale yellow solid, 3.72 g (45% yield). 1H NMR (CDCl3/TMS) 7.99

(dd, 1H, J = 10.0, 2.0 Hz), 7.70 (d, 1H, J = 8.0 Hz), 7.40 (m, 1H) 7.20 (dt, 1H, J =

8.0, 2.0 Hz), 7.09 (s, 1H), 2.42 (s, 3H); 13C NMR (CDCl3) 167.6, 167.0, 162.9 (d,

JC-F = 246 Hz), 135.2 (d, JC-F = 8.6 Hz), 133.7, 130.4 (d, JC-F = 8.2 Hz), 129.8 (d,

JC-F = 3.0 Hz), 128.3 (d, JC-F = 2.9 Hz), 118.3 (d, JC-F = 12 Hz), 118.2 (d, JC-F = 11

Hz), 15.9; MS (ES-API) calcd for C11H9FNO2 [MH+] 206.1, found 206.0.

(Z)-4-(3-Fluorobenzylidene)-1,2-dimethyl-1H-imidazol-5(4H)-one (FBI) was

synthesized according to a procedure described previously2,3. 1H NMR

(CDCl3/TMS) 8.05 (m, 1H), 7.74 (d, 1H, J = 7.5 Hz), 7.37 (m, 1H), 7.07 (m, 1H),

7.05 (s, 1H), 3.20 (s, 3H), 2.40 (s, 3H).


4

(Z)-4-Benzylidene-1,2-dimethyl-1H-imidazol-5(4H)-one (BI) was synthesized

according to a procedure described previously2,3. 1H NMR (CDCl3/TMS) 8.13 (d,

2H, J = 8.0 Hz), 7.42 (m, 2H), 7.37 (m, 1H), 7.12 (s, 1H), 3.20 (s, 3H), 2.39 (s,

3H).

(Z)-4-(4-Methoxybenzylidene)-1,2-dimethyl-1H-imidazol-5(4H)-one (MeOBI) was


(CDCl3/TMS) 8.10 (d, 2H, J = 9.0 Hz), 7.05 (s, 1H), 6.92 (d, 2H, J = 9.0 Hz),

3.82 (s, 3H), 3.14 (s, 3H), 2.33 (s, 3H).

(Z)-4-(3-Bromobenzylidene)-1,2-dimethyl-1H-imidazol-5(4H)-one (BrBI) was


(CDCl3/TMS) 8.36 (s, 1H), 7.99 (d, 1H, J = 7.6 Hz), 7.49 (d, 1H, J = 7.2 Hz),

7.28 (m, 1H), 6.98 (s, 1H), 3.18 (s, 3H), 2.39 (s, 3H); 13C NMR (CDCl3) 170.6,

163.7, 139.7, 136.3, 134.5, 132.8, 130.7, 130.2, 125.2, 122.8, 26.7, 15.8.

(Z)-4-(3,5-difluoro-4-hydroxybenzylidene)-2-methyl-1-(2,2,2-trifluoroethyl)-1H-

imidazol-5(4H)-one (DFHBI-1T) was synthesized according to a procedure

described previously4. 1H NMR (CD3OD/TMS) 7.78 (dd, 2H, J = 8.0, 1.8 Hz),

6.92 (s, 1H), 4.42 (q, 2H, J = 8.8 Hz), 2.40 (s, 3H).


5

Supplementary Figure 1. Pre-crystallization characterization of the Spinach RNA. (A).

Binding of Fab BL3-6 to the Spinach_Tag aptamer containing the hairpin graft in P2.2

(GAAACAC). The fit of the data to the Hill equation gives KD = 25 ± 6 nM (open circles).

Wild-type (UUCG) Spinach does not bind to BL3-6 (closed circles). (B). Fluorescence

emission of DFHBI alone (blue), in the presence of Spinach_WT (UUCG, red), or

GAAACAC in the absence (green) or presence (purple) of Fab BL3-6. Excitation

wavelength is 468 nm; spectra are normalized to the molar concentrations of RNA using

the 502 nm emission peak. (C). Gel filtration chromatograms showing UV absorption

profiles. Peaks were normalized to the molar concentrations of samples. The 1:1 Fab-

RNA complex of Spinach_Tag eluted about 20 mL earlier than the RNA alone.

a b

c


6

Supplementary Figure 2. The Fab-RNA binding interfaces. (A). The antigenic interface.

The stem-loop of the GAAACAC tag (P2, blue ribbon) binds to a site created by Fab

heavy chain CDRs H1 (red), H2 (green), H3 (purple) and light chain CDR-L3 (orange).

CDR-L1 and -L2 do not make direct contact with the RNA, and do not make any crystal

contacts either. (B). Three other non-antigenic interfaces engaged by symmetry-related

Fabs (green) in the lattice. Contact residues on the Fabs are highlighted in dark grey.

a

b


7

Supplementary Figure 3. Fab interactions with the GAAACAC hairpin loop. (A)

Arginine residues 105 and 106 from CDR-H3 (purple) contact G37 (blue) at N7 and the

phosphate, respectively. (B). Phe95 from CDR-L3 (orange) stacks between Tyr62 from

CDR-H2 (green) and nucleobase A40 (blue). Arg110 of CDR-H3 contacts the 4’-oxygen

of the same nucleotide (C). CDR-H2 residue Tyr57 (green) forms a hydrogen-bond to

the 2’-OH of A38, and serines 58 and 60 interact with the W-C face of C41. Nucleotide

A39 stacks between G37 and Tyr 57. A38 also contacts CDR-H1 residue Tyr 34 (red)

by stacking plus a hydrogen bond.

a b

c


8

Supplementary Figure 4. Crystal packing and interfaces. (A). Crystal packing of the

Fab-Spinach RNA complex (Fab: green; RNA: brown) in a unit cell. In one dimension,

the arrangement of complexes extends via the terminal stem of the RNA protruding into

a cleft between heavy and light chains from two other symmetry-related molecules. Fab

contacts mediate extensions in the other dimensions. (B). Mode of Fab engaging the

RNA via crystal contacts. The RNA (brown) also contacts multiple Fabs (light green)

from symmetry-related molecules in the lattice, in addition to the paratope interaction

(circled; with the dark green Fab) via antigen-binding site as in Supplementary Fig. 2A.

(C). Fab-Fab interactions contributing to lattice packing. The predominant contacts take

place between the outer surfaces of the light chains (highlighted in red). The oval

indicates 2-fold symmetry along the y-axis (perpendicular to the page).

a

b c


9

Supplementary Figure 5. A lone RNA-RNA intermolecular contact involved in crystal

packing. The 5’-phosphate oxygens of G1 from P1 (magenta) form hydrogen bonds with

A38 of a symmetry-related molecule (cyan).


10

Supplementary Figure 6. Non-canonical base pairs in Spinach. (A). The non-canonical

purine-purine base pairs A20·G65 and A21·A64 open up stem P1.2 (magenta) at the

floor of the G-quadruplex region (brown-yellow and red). A20 and G65 use their W-C

faces to form two hydrogen bonds while A64 uses its Hoogsteen face to form one

hydrogen bond with the W-C face of A21. (B). Both A12·A73 and A13·A72 in P1

(magenta) form non-canonical base pairs via single N3-N6 hydrogen bonds, splitting P1

into two segments. (C). A non-canonical base pair forms between U18 and U67 towards

the middle of P1.2. Dashed lines indicate hydrogen bonds. Both upstream and

downstream G-C pairs are also displayed. Truncation analysis (Fig. 1C) revealed that

these non-canonical pairs in (B) and (C) are not essential for DFHBI binding and

fluorescence activation.

b c

a


11

Supplementary Figure 7. Secondary structure of the Spinach RNA aptamer (A) and

GAAACAC hairpin graft (B) as predicted by mFold1,5. The red circle highlights the hairpin

graft.

a b


12

Supplementary Figure 8. Hydroxyl radical (Fe-EDTA) footprinting of Spinach and

Spinach-Fab complex. (A). The P2 (AACAA) loop of Spinach becomes protected from

hydroxyl radical cleavage in the presence of 500 nM Fab. Blue balls in the structure

indicate the sole region of protection. (B). Color plot from footprinting data (blue = more

protection) showing significant reduction of cleavage (protection) from residues G37 to

A40. (C). Solvent accessibility (probe radius = 1.4 Å) by individual nucleotide on Spinach.

The calculated data match with the footprinting results.

a b

c


13

Supplementary Figure 9. Solution studies using SAXS. The experimental SAXS

curves (black; 1.0 mg/mL sample concentration) were fitted respectively with theoretical

curves (red) deduced from the crystal structure. In each panel: left – Spinach RNA; right

– Spinach-Fab complex. The model used to generate the theoretical curve is shown in

the bottom-left inset in each panel, and the corresponding Guinier analysis plots with

regression coefficients R are shown as insets at the top-right. The Guinier analysis plots

over the same range of Q values for the 2.0 mg/mL samples gave similar linear fits, R =

0.999 and 0.998, respectively) with no apparent curvature. The 2 number from fitting

suggests reasonable agreement between the observed and calculated profiles6,7. I -

intensities; Q – the scattering vector [(4/) sin]. (B). Experimental (black) and model

derived (red) pair-distance distribution curves for Spinach RNA and Spinach-Fab

complex. R is the distance measured within the molecule. Rg is the calculated radius of

gyration.

a

b


14

Supplementary Figure 9 continued. (C). Crystal structure of each model contoured by

the molecular envelope (grey, transparent) in two different views, calculated from the

corresponding pair-distance distribution curve. Envelopes were averaged from 12

repeating DAMMIF calculations assuming uniform density on each object, with no

normalized spatial discrepancy (NSD) outlier being detected and discarded (NSD =

0.728 ± 0.033 for the RNA model, and 0.717 ± 0.010 for the complex).

c


15

Supplementary Figure 10. Replacement P1 stems for Spinach truncates. All truncated

constructs retain the non-canonical purine-purine pairs (orange) at the base of the G-

quadruplex motif. Remaining parts of the RNA are omitted for clarity.


16

Supplementary Figure 11. Spinach-activated DFHBI fluorescence in the presence of

different cations. All samples contained 5 M RNA, 20 M DFHBI,10 mM Tris-Cl pH 7.5

and cations as indicated. K+ – 100 mM KCl; Na+ – 100 mM NaCl; NH4+ – 100 mM NH4Cl;

N/A – 0.5 mM EDTA pH 8.0 (with the no Mg2+ condition only). See Fig. 2C for full

titrations curves for K+, Na+, and NH4+ in the presence of 5 mM Mg2+.


17

Supplementary Figure 12. SHAPE analysis of Spinach and mutants. All lanes

represent products from primer extension reactions using radiolabeled primers. Lanes

labeled ‘Input’ contained primer extension reactions on RNA samples not exposed to the

SHAPE reagent. G and U indicate the lanes mapping the locations of Gs and Us in the

RNA sequence, respectively. Ligand, Mg2+ and K+ were varied as indicated. Data on

[Mg+/K+/DFH+] (lane #5) were analyzed and superimposed onto the crystal structure

(Fig. 2d). A more detailed interpretation of this data is provided in Online Methods.


18

Supplementary Figure 13. Crystal structure of DFHBI fluorophore (Deposition code:

CCDC-956054). (A). ORTEP (Oak Ridge Thermal Ellipsoid Plot) diagram of DFHBI

molecule showing the (Z)-configuration. (B). DFHBI packing in the unit cell.

b

a


19

Supplementary Figure 14. The Spinach core structure displayed with electron density

maps. (A). DFHBI in its binding site, contoured with the |Fobs|-|Fcal| difference map (green

mesh, RMSD = 3.5σ) from a simulated annealing refinement omitting the ligand. (B) The

binding site and (C) the G-quadruplex in the presence of DFHBI, contoured with feature-

enhanced 2|Fobs|-|Fcal| maps (RMSD = 1.0σ for black mesh, and 2.5σ for blue mesh;

carve = 2.0). The black arrow indicates the linker of DFHBI fluorophore. Color codes of

nucleotides and ligand atoms match Figure 3a.

c

b a


20

Supplementary Figure 14 continued. (D) and (E). Two additional projections showing

DFHBI in its binding site contoured with the |Fobs|-|Fcal| difference map (green mesh,

RMSD = 3.5σ) from a simulated annealing refinement omitting the ligand.

d

e


21


22

Supplementary Figure 15. Additional data defines the ligand orientation. The panels

show the fit of a conceptual model ligand containing both bromophenyl and N-

trifluoroethyl groups. Of the eight combinations of ligand geometry and orientation

considered, only one (top left) fits well with both the highest peak in the Br anomalous

difference map and the –CF3 omit map while also agreeing with the overall location of

the ligand outlined by the 2|Fobs|-|Fcal| map. For a higher-resolution 2|Fobs|-|Fcal| map of

the native ligand, see Supplementary Fig 14. Phenix was used to calculate maps and

then superimpose them (to accommodate small unit cell variations)8. The figure was

made using Pymol, with the “carve” parameter set to 1.6 Å (which was necessary to

remove density for neighboring residues in the 2|Fobs|-|Fcal| map).


23

Supplementary Figure 16. Mutations in the G-quadruplex and adjacent region diminish

DFHBI fluorescence activation. DFHBI – the unbound fluorophore in buffer; ΔQ1 – first

layer of the G-quadruplex (G23, G27, G54, G59) mutated into pyrimidines; ΔQ2 –

second layer of the G-quadruplex (G22, G26, G57, G61) mutated into pyrimidines; ΔPP

– the A20·G65 and A21·A64 purine pairs at the quadruplex floor (Supplementary Fig. 6a)

mutated into canonical G-C pairs; ΔAdj – three adjacent guanines to the fluorophore

(G23, G28, G54) mutated into pyrimidines. All samples contained 5 M RNA, 20 M

DFHBI in 10 mM Tris-Cl pH 7.5, 100 mM KCl, 5 mM MgCl2.


24

Supplementary Figure 17. Deoxynucleotide substitutions in Spinach affect DFHBI

binding and fluorescence activation. Fits of the data to Hill equation gave KD = 380 ±

60 nM for Spinach WT and 1.1 ± 0.3 M for dU50 mutant. Spinach variants containing

either dG23 or dA53 exhibited very little fluorescence activation. These experiments

used the truncated form of Spinach and variants containing a 5 base pair P1 stem from

enzymatic ligation.


25

Supplementary Figure 18. Affinity of Spinach for various fluorophore analogs.

(A).Dependence of fluorescence activation on ligand concentration. Assays were

conducted at 30 nM RNA. (B). Inhibition of DFHBI fluorescence activation by competitive

binding of non-fluorescent analogs. The competitive assay included 300 nM (at the KD)

of Spinach and 300 nM DFHBI. A fit of the data to the Hill equation followed by a

calculation with the Cheng-Prusoff equation gave the indicated values of Ki = IC50 / 2. (C).

Chemical structure and KD/KI for each analog.

a b

c


26

Supplementary Figure 19. Fluorophore (green) interactions in EGFP and Spinach. (A).

The hydroxybenzylidene imidazolinone fluorophore in EGFP (purple), generated from

residues Tyr66, Thr65 and Gly67, makes hydrogen bonds to amino acid side chains

(PDB code: 2Y0G). (B). Spinach RNA (light blue) mediates hydrogen bonds to DFHBI.

Dashed lines indicate inferred hydrogen-bond contacts to the fluorophores. Atom color

code: O = red, N = blue, F = cyan.

a

b


27

Supplementary Figure 20. The overall model and accompanying electron density omit

maps. (A). The Spinach RNA (backbone in orange) with the 2|Fobs|-|Fcal| composite omit

map from simulated annealing, contoured at 2.0σ and carved within 2.0 Å of selected

atoms. (B). Display of the RNA with the same map at 1.0σ and carved within 2.0 Å of

selected atoms.

b a


28

Supplementary Figure 21. Conceptual models of the (E)-isomer of DFHBI in the

Spinach binding site. The imidazolinone exocyclic oxygen faces (A) G28 or (B) 2’-

hydroxyl of A53, respectively. Hypothetical hydrogen bonds and hydrophobic

interactions are indicated with dashed lines. U29 is omitted for clarity. Color codes match

Figure 3a.

a

b


29

Supplementary Table 1. Data collection and refinement statistics of RNA-

Fab complex structures with DFHBI and its analogs

Ligand DFHBI Ligand-free BrBI DFHBI-1T

Data collection

Beamline APS NECAT

24-ID-C

APS NECAT

24-ID-C

APS GM/CA

23-ID-D

APS NECAT

24-ID-E

Wavelength (Å) 0.9795 0.9795 0.9184 0.9795

Space group C 1 2 1 C 1 2 1 C 1 2 1 C 1 2 1

Cell dimensions

a, b, c (Å) 148.4, 79.6, 95.2 146.9, 80.1, 94.5 146.5, 79.7, 95.3 147.5, 79.0, 94.4

() 90.0, 111.7, 90.0 90.0, 111.9, 90.0 90.0, 111.5, 90.0 90.0, 112.4, 90.0

Resolution (Å) 46.69-2.19

(2.30-2.19)*

2.2, 2.2, 2.4**

45.37-2.40

(2.53-2.40)*

2.4, 2.4, 2.5**

46.43-2.03

(2.07-2.03)*

2.0, 2.4, 2.4**

67.68-3.12

(3.29-3.12)*

3.1, 4.0, 3.1**

Rmerge (%) 5.9 (61.5) 6.6 (53.6) 15.1 (58.9) 19.1 (80.7)

I /I 10.6 (1.8) 10.9 (1.9) 12.8 (0.8) 7.8 (1.6)

Completeness (%) 98.2 (98.3) 96.5 (95.3) 91.1 (44.5) 98.5 (98.4)

Redundancy 3.0 (2.9) 2.9 (2.9) 5.0 (1.9) 3.1 (3.2)

Refinement

Resolution (Å) 46.69-2.19 45.37-2.40 46.43-2.45;

(98.5% completeness)

67.68-3.12

No. reflections 52457 38250 72602

(37296 non-anomalous)

17701

Rwork / Rfree 0.179 / 0.211 0.186 / 0.224 0.184 / 0.220 0.205 / 0.253

No. atoms 5644 5417 5431 5174

Protein 3321 3321 3321 3303

RNA 1815 1819 1815 1815

Ligand/ions 48 2 24 23

Water 460 275 271 33

B-factors (overall) 43.9 44.2 64.0 87.1

Protein 30.5 31.6 44.2 68.8

RNA 70.2 68.9 102.1 120.3

Water 35.9 33.3 45.6 43.1

R.m.s. deviations

Bond lengths (Å) 0.007 0.008 0.002 0.003

Bond angles () 1.17 1.10 0.70 0.54

PDB code 4KZD 4KZE 4Q9Q 4Q9R

*Values in parentheses are for highest-resolution shell.

**Anisotropic resolution limits along a, b, c directions, calculated by using Diffraction Anisotropy Server9.


30

Supplementary Table 2. Data collection and refinement of DFHBI structure

DFHBI (C12H9F2N2O2)

Data collection

Formula weight 251.21

Space group P21/c

Cell dimensions

a, b, c (Å) 3.85, 12.55, 21.92

() 90.0, 98.6, 90.0

Crystal system Monoclinic

Wavelenth (Å) 0.71073

Temperature (K) 100

Theta range 1.87 – 23.39 o

Refinement

Highest resolution (Å) 0.90

No. reflections 8353

Independent reflections 1,532

Reflections with I > 4 (Fo) 774

Rint 0.0671

Goodness-of-fit on F2 0.887

Final R indices [I > 2 sigma(I)] R1 = 0.0647, wR2 = 0.1394

R indices (all data) R1 = 0.1334, wR2 = 0.1590

Largest diff. peak and hole 0.257, -0.222 eÅ -3


31

Supplementary Table 3. Summary of the Spinach mutant sequences used

in this work.

RNA Sequence

WT

(Spinach_tag)

5’GGACGCGACCGAAAUGGUGAAGGACGGGUCCAGUGCGAAACACGCACUG

UUGAGUAGAGUGUGAGCUCCGUAACUGGUCGCGUC 3’

G28A 5’GGACGCGACCGAAAUGGUGAAGGACGGAUCCAGUGCGAAACACGCACUG


G28U 5’GGACGCGACCGAAAUGGUGAAGGACGGUUCCAGUGCGAAACACGCACUG


G28C 5’GGACGCGACCGAAAUGGUGAAGGACGGCUCCAGUGCGAAACACGCACUG


A53U 5’GGACGCGACCGAAAUGGUGAAGGACGGGUCCAGUGCGAAACACGCACUG

UUGUGUAGAGUGUGAGCUCCGUAACUGGUCGCGUC 3’

Q1 5’GGACGCGACCGAAAUGGUGAAGCACGUGUCCAGUGCGAAACACGCACUG

UUGACUAGAUUGUGAGCUCCGUAACUGGUCGCGUC 3’

Q2 5’GGACGCGACCGAAAUGGUGAACGACUGGUCCAGUGCGAAACACGCACUG

UUGAGUACAGUUUGAGCUCCGUAACUGGUCGCGUC 3’

PP 5’GGACGCGACCGAAAUGGUGCGGGACGGGUCCAGUGCGAAACACGCACUG

UUGAGUAGAGUGUGCGCUCCGUAACUGGUCGCGUC 3’

Adj 5’GGACGCGACCGAAAUGGUGAAGCACGGUUCCAGUGCGAAACACGCACUG

UUGACUAGAGUGUGAGCUCCGUAACUGGUCGCGUC 3’

16 bp

Truncate

5’GGACGCGACCGAUGGAGAAGGACGGGUCCAGUGCGAAACACGCACUGUU

GAGUAGAGUGUGAGCUCCAUCGGUCGCGUC 3’

5 bp

Truncate

5’GGGGAGAAGGACGGGUCCAGUGCGAAACACGCACUGUUGAGUAGAGUGU

GAGCUCCC 3’

3 bp

Truncate

5’GGAGAAGGACGGGUCCAGUGCGAAACACGCACUGUUGAGUAGAGUGUGA

GCUC 3’

1 bp

Truncate

5’GGAAGGACGGGUCCAGUGCGAAACACGCACUGUUGAGUAGAGUGUGAGC

3’

0 bp

Truncate

5’GAAGGACGGGUCCAGUGCGAAACACGCACUGUUGAGUAGAGUGUGAG 3’

WT-acceptor 5’ GGGGAGAAGGACGGGUCCAGUGC 3’

WT-donor 5’ pGAAACACGCACUGUUGAGUAGAGUGUGAGCUCCC 3’

dG23-acceptor 5’ GGGGAGAAGdGACGGGUCCAGUGC 3’

dU50-donor 5’ pGAAACACGCACUGdUUGAGUAGAGUGUGAGCUCCC 3’

dA53-donor 5’ pGAAACACGCACUGUUGdAGUAGAGUGUGAGCUCCC 3’

Ligation

Splint (DNA)

5’ ACAGTGCGTGTTTCGCACTGGACCCGTC 3’


32

Supplementary Table 4. SAXS data collection and scattering derived

parameters

Fab-Spinach complex Spinach RNA

Data collection

Instrument SIBYLS beamline Advanced Light Source Berkeley CA

Beam geometry Superbend synchrotron light 100x100 micron

Wavelength (Å) 1.03

Q range (Å-1) 0.009 – 0.320

Exposure time (s) 1.0

Concentration (mg/mL) 1.0, 2.0

Temperature (K) 283

Structural parameters

Dmax (Å) 160.0 98.0

Rg (Å) from P(r) 46.96 ± 0.74 29.94 ± 0.11

Rg (Å) from Guinier 43.52 ± 0.14 32.04 ± 0.39

46.64 ± 0.14* 31.54 ± 0.24*

I(0) from P(r) (cm-1) 419 460

I(0) from Guinier (cm-1) 410 509

Molecular envelope NSD 0.717 ± 0.010 0.728 ± 0.033

Software employed

Intensity curve fitting CRYSOL10

Guinier analysis AUTORG11

Pair-distance distribution GNOM12

Ab initio analysis DAMMIF13

Structure superposition SUPCOMB14

* For the 2.0 mg/mL sample concentration


33

Supplementary References

1. Paige, J.S., Wu, K.Y. & Jaffrey, S.R. RNA Mimics of green fluorescent protein. Science 333, 642-646 (2011).

2. Kowalik, J., Baldridge, A. & Tolbert, L. Efficient synthesis of new 4-arylideneimidazolin-5-ones related to the GFP chromophore by 2+3 cyclocondensation of arylideneimines with imidate ylides. Synthesis 2010, 2424-2436 (2010).

3. Baldridge, A., Samanta, S.R., Jayaraj, N., Ramamurthy, V. & Tolbert, L.M. Steric and electronic effects in capsule-confined green fluorescent protein chromophores. Journal of the American Chemical Society 133, 712-715 (2011).

4. Song, W., Strack, R.L., Svensen, N. & Jaffrey, S.R. Plug-and-play fluorophores extend the spectral properties of Spinach. Journal of the American Chemical Society 136, 1198-1201 (2014).

5. Zuker, M. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Research 31, 3406-3415 (2003).

6. Stoddard, C.D. et al. Free state conformational sampling of the SAM-I riboswitch aptamer domain. Structure 18, 787-797 (2010).

7. Rambo, R.P. & Tainer, J.A. Improving small-angle X-ray scattering data for structural analyses of the RNA world. RNA 16, 638-646 (2010).

8. Afonine, P.V., Grosse-Kunstleve, R.W. & Adams, P.D. The Phenix refinement framework. CCP4 Newsletter 42, 8 (2005).

9. Strong, M. et al. Toward the structural genomics of complexes: Crystal structure of a PE/PPE protein complex from Mycobacterium tuberculosis. Proceedings of the National Academy of Sciences 103, 8060-8065 (2006).

10. Svergun, D., Barberato, C. & Koch, M.H.J. CRYSOL - a program to evaluate X-ray solution scattering of biological macromolecules from atomic coordinates. Journal of Applied Crystallography 28, 768-773 (1995).

11. Petoukhov, M.V., Konarev, P.V., Kikhney, A.G. & Svergun, D.I. ATSAS 2.1 - towards automated and web-supported small-angle scattering data analysis. Journal of Applied Crystallography 40, s223-s228 (2007).

12. Svergun, D.I. Determination of the regularization parameter in indirect-transform methods using perceptual criteria. Journal of Applied Crystallography 25, 495-503 (1992).

13. Franke, D. & Svergun, D.I. DAMMIF, a program for rapidab-initioshape determination in small-angle scattering. Journal of Applied Crystallography 42, 342-346 (2009).

14. Kozin, M.B. & Svergun, D.I. Automated matching of high- and low-resolution structural models. Journal of Applied Crystallography 34, 33-41 (2001).


A G-Quadruplex-Containing RNA Activates Fluorescence in a ... · A G-Quadruplex-Containing RNA...

Documents

Transcript of A G-Quadruplex-Containing RNA Activates Fluorescence in a ... · A G-Quadruplex-Containing RNA...