A barcode for the authentication of the snappers (Lutjanidae) of...

lable at ScienceDirect

Food Control 38 (2014) 116e123

Contents lists avai

Food Control

journal homepage: www.elsevier .com/locate/ foodcont

A barcode for the authentication of the snappers (Lutjanidae) ofthe western Atlantic: rDNA 5S or mitochondrial COI?

Ivana Veneza a, Bruna Felipe a, Joiciane Oliveira a, Raimundo Silva a, Iracilda Sampaio b,Horacio Schneider b, Grazielle Gomes a,b,*a Laboratório de Genética Aplicada, Instituto de Estudos Costeiros, Universidade Federal do Pará, Campus Universitário de Bragança,Alameda Leandro Ribeiro s/n, Aldeia, Bragança, Pará, Brazilb Laboratório de Genética and Biologia Molecular, Instituto de Estudos Costeiros, Universidade Federal do Pará,Campus Universitário de Bragança, Brazil

a r t i c l e i n f o

Article history:Received 5 February 2013Received in revised form8 October 2013Accepted 9 October 2013

Keywords:COIrDNA 5SSnappersBarcodeLutjanids

* Corresponding author. Instituto de Estudos CostePará e Bragança, Alameda Leandro Ribeiro s/n, AldeiPA, Brazil. Tel.: þ55 091 3425 1593.

E-mail addresses: [email protected], graziell

0956-7135/$ e see front matter � 2013 Elsevier Ltd.http://dx.doi.org/10.1016/j.foodcont.2013.10.012

a b s t r a c t

The increasing demand for fishery resources in recent years has stimulated a growth in the output ofprocessed products, which has made the fraudulent substitution of species a common practice. In thepresent study two different protocols were evaluated for the molecular authentication of lutjanid species,one based on the banding pattern of the nuclear rDNA 5S gene, and the other on the sequences of themitochondrial Cytochrome Oxidase subunit I (COI) gene. A total of 132 samples were analyzed fromspecimens identified previously as belonging to seven lutjanid species (Lutjanus purpureus, Lutjanussynagris, Lutjanus vivanus, Lutjanus jocu, Lutjanus analis, Ocyurus chrysurus, and Rhomboplites aurorubens),as well as unidentified individuals. The results indicate the absence of a species-specific rDNA 5S bandingpattern in lutjanids. However, the 1131 bp fragment of the COI gene not only discriminated the identifiedlutjanid species systematically, but also defined the species of the unidentified specimens, identifyinganother two species from the database, Lutjanusbucanella and Lutjanuscyanopterus. The species wererepresented by well-defined consensual clades in the phylogenetic trees, supported by the interspecificdistances and the mutations characteristic of each species. This segment of the COI gene proved to be arobust tool for the molecular authentication of lutjanid species.

� 2013 Elsevier Ltd. All rights reserved.

1. Introduction

The trade in fishery products has expanded significantly inrecent years, with a total worldwide harvest of 154 million tons in2011, including both wild-caught and farmed produce (FAO, 2012).At the same time, there has been an ever-increasing tendency forthe diversification of the products being marketed, including filletsand steaks, smoked fish and canned goods, derived from a widerange of different fish species.

This growth in trade has been accompanied by an increase in thefraudulent substitution of more valuable species by inferior ones(Ward, 2000). In addition to the marked morphological similaritiesof species of some fish families, such as the Sciaenidae, Mugilidae,and Lutjanidae (Allen, 1985; Cervigón, 1993; Cervigón et al., 1993),

iros, Universidade Federal doa, Bragança, CEP: 68.600-000

[email protected] (G. Gomes).

All rights reserved.

processing can remove distinguishing features, and impede thediagnosis of species recognized solely on the basis of morphologicaltraits (Carvalho, Neto, Brasil, & Oliveira, 2011; Céspedes et al., 1999;Filonzi, Chiesa, Vaghi, & Marzano, 2010; Sales, Rodrigues-Filho,Haimovici, Sampaio, & Schneider, 2011; Sotelo, Piñeiro, Gallardo,& Pérez-Martín, 1993).

Inadequate product labeling can have serious consequences interms of public health, as well as having ecological and economicimplications. In addition to entailing potential risks for the con-sumer (Van Leeuwen et al., 2009), including financial costs e asshown by Marko et al. (2004) in the case of the snappers e it mayimpact management programs designed for the conservation of thestocks of certain species (Ward, 2000).

The lutjanids fishes known as snappers represent an importantfishery resource in all the regions where they occur (Allen, 1985;Cervigón, 1993; Matos-Caraballo, 2000; Mendoza & Larez, 1996;Prescod, Oxenford, & Taylor, 1996; Zhang & Liu, 2006). These me-dium to large-sized fishes are widely distributed in the Atlantic,Indian, and Pacific oceans. The family is composed of approximately108 species distributed among 17 genera, organized in four

Delta:1_given nameDelta:1_surnameDelta:1_given nameDelta:1_surnameDelta:1_given nameDelta:1_surnameDelta:1_given namemailto:[email protected]:[email protected]://crossmark.crossref.org/dialog/?doi=10.1016/j.foodcont.2013.10.012&domain=pdfwww.sciencedirect.com/science/journal/09567135http://www.elsevier.com/locate/foodconthttp://dx.doi.org/10.1016/j.foodcont.2013.10.012http://dx.doi.org/10.1016/j.foodcont.2013.10.012http://dx.doi.org/10.1016/j.foodcont.2013.10.012

I. Veneza et al. / Food Control 38 (2014) 116e123 117

subfamilies, the Etelinae, Apsilinae, Paradicichthyinae, and Lutja-ninae (Allen, 1985; Cervigón, 1993; Froese & Pauly, 2012; Moura &Lindeman, 2007; Nelson, 2006).

Many lutjanids, such as the red snappers (Lutjanus vivanus, L.purpureus, L. campechanus, L. bucanella, and L. peru), are highlysimilar morphologically (Cervigón, 1993; Cervigón et al., 1993;Nelson, 2006) and are difficult to identify reliably based onexternal characteristics. This problem is exacerbated by the in-dustrial processing of catches, which typically involves the removalof the fillets.

Based on the analysis of a fragment of the mitochondrial Cyto-chrome b gene, Marko et al. (2004) discovered that approximately80% of the fillets sold in the United States as red snapper(L. campechanus) were actually derived from other lutjanid species,presumably as a result of errors in the identification of specimensduring the production process and/or the intentional substitutionwith less popular and/or cheaper species.

Molecular studies based on nucleotide sequences havebecome increasingly popular for the identification of fishes and/or fishery products (Brown et al., 1996; Carrera et al., 2000; Chiu,Su, Pai, & Chang, 2012; De Salle & Birstein, 1996; Filonzi et al.,2010; Mackie et al., 1999; Rasmussen & Morrissey, 2008; Wen,Hu, Zhang, & Fan, 2011). One genomic region that has beenused successfully for molecular diagnosis is the CytochromeOxidase subunit I (COI) gene, which is considered to be a “bio-logical barcode” (Hebert, Cywinska, Ball, & de Waard, 2003). Anumber of studies have demonstrated the usefulness of differentfragments of this gene for the identification of fish species andthe products derived from them (Carvalho, Neto, et al., 2011;Carvalho, Oliveira, et al., 2011; Filonzi et al., 2010; Haye,Segovia, Vera, Gallardo, & Gallardo-Escárate, 2012; Rasmussen,Morrissey, & Hebert, 2009; Silva-Oliveira et al., 2011; Ward,Zemlak, Innes, Last, & Hebert, 2005; Yang, Huang, Hsieh, Huang,& Chen, 2012).

In addition to DNA sequences, a number of alternatives havebeen tested, based on faster and more practicable approaches,which allow for the analysis of PCR (Polymerase Chain Reaction)products directly in agarose gels (see Rodrigues-Filho et al., 2010),such as the banding pattern provided by the amplification of therDNA 5S gene. This marker is a multigenic family composed ofrepeated units in a conserved coding region with approximately120 base pairs arranged in tandem, separated by non-transcribedspacers (NTS) of variable length (Alves-Costa et al., 2008; Martins& Wasko, 2004; Pinhal et al., 2008; Rodrigues-Filho et al., 2010;Wasko, Martins, Wright, & Galetti, 2001). This arrangement pro-duces a unique banding pattern which is species-specific in many

Table 1List of the taxa analyzed in the present study, their common names, codes and the num

Family Species Common name

Lutjanidae Lutjanus purpureus Southern red snapperLutjanus synagris Lane snapperLutjanus jocu Dog snapperLutjanus analis Mutton snapperLutjanus vivanus Silk snapperRhomboplites aurorubens Vermellion snapperOcyurus chrysurus Yellowtail snapperIdentified SnapperUnidentified Snapper

Haemulidae Conodon nobilis Barred grutGenyatremus luteus Torroto grunt

Scombridae Scomberomorus brasiliensis Serra Spanish mackereSciaenidae Cynoscion sp. WeakfishCentropomidae Centropomus undecimalis Common snook

cases (see Céspedes et al., 1999; Rodrigues-Filho et al., 2010; Saleset al., 2011).

Given the marked morphological similarities among thedifferent lutjanid species and the fact that snappers are typicallymarketed in fillet form, which facilitates the illicit substitution ofspecies, an effective molecular species identification protocolwhich is both fast and inexpensive is urgently needed. In anattempt to provide an appropriate approach to this problem, thepresent study evaluated two different molecular methods e onebased on the banding patterns of the amplified rDNA 5S generesolved on an agarose gel, and the other, a more conventionalapproach, which has been shown to be effective in snappers (seeVictor, Hanner, Shivji, Hyde, & Caldow, 2009), based on the analysisof the sequences of a fragment of the mitochondrial COI gene. Thiscomparative analysis will provide an initial step towards thedevelopment of rapid and low-cost molecular protocols that pro-vide an unambiguous identification of snapper species.

2. Material and methods

2.1. Samples

A total of 132 lutjanid specimens (Table 1) were analyzed in thepresent study. The samples were obtained from the Lutjanidaetissue bank held by the Applied Genetics Laboratory at the CoastalStudies Institute of the Federal University of Pará in Bragança,Brazil. In all, 37 of the specimens had been identified previously(Allen, 1985; Cervigón, 1993; Cervigón et al., 1993; Menezes &Figueiredo, 1980), representing seven species, belonging to threegenera e Lutjanus (L. purpureus, L. synagris, L. jocu, L. analis, andL. vivanus), and the monotypic Rhomboplites aurorubens andOcyurus chrysurus. The remaining 95 specimens, which werecollected at a number of different locations around the Braziliancoast, were considered to be “unidentified snappers” or UISs forthis analysis. A number of additional specimens were included inthe analysis to provide a comparative perspective of rDNA 5Sbanding patterns at the family level. These specimens include threeindividuals representing two haemulidae species (Conodon nobilisand Genyatremus luteus), a scombridae (Scomberomorus brasi-liensis), a centropomidae (Centropomus undecimalis), and a sciae-nidae, Cynoscion sp. (Table 1).

The approach adopted here was to use the specimens identifiedaccording to their morphological traits as models for the identifi-cation of all the other samples, based on both the amplification ofthe rDNA 5S/NTS gene and the sequencing of the COI gene. Inaddition to evaluating the different molecular procedures for the

ber of samples used for the analysis of each genomic region.

Code Samples used for 5S Samples used for COI

Lpu 3 6Lsy 3 8Ljo 3 5Lan 3 5Lvi 3 3Rau 3 3Och 3 7

37UIS 15 95TOTAL 36 132Cno 1 2Glu 1 1

l Sbr 1Csp 1Cun 1TOTAL 41 135

I. Veneza et al. / Food Control 38 (2014) 116e123118

identification of species, it was possible to recognize certain in-consistencies in the original identification of the specimens, whichwas based on morphological traits.

2.2. Isolation, amplification, and sequencing of the genetic material

The genetic material was isolated following the protocol ofSambrook and Russell (2001). The genomic regions (rDNA 5S andCOI) were amplified by Polymerase Chain Reaction (PCR) in a finalvolume of 25 ml, containing 4 ml of dNTP (1.25 mM), 2.5 ml of 10�buffer, 1 ml of MgCl2 (50 mM), 1 ml of each primer (50 ng/mL),approximately 100 ng of the total DNA, 0.2 ml of Taq DNA poly-merase (5 U/mL) (Invitrogen, Carlsbad, CA, USA), and purified waterto complete the final reaction volume.

The primers used to amplify the rDNA 5S gene were 5SA (50-TACGCCCGATCTCGTCCGATC-30) and 5SB (50-CAGGCTGGTATGGCCGTAAGC-30), as used by Sales et al. (2011), with the followingamplification conditions: initial denaturation at 95 �C for 4 min,followed by 35 cycles of 20 s at 95 �C, 50 s at 55 �C, and 30 s at 72 �C,and final extension of 7 min a 72 �C.

The COI gene was amplified using the primers FishF1, FishF2(Ward et al., 2005), COIF and COIA (Palumbi & Benzie, 1991)(Table 2), thus permitting the analysis of a fragment of 1131 bp forall species of Lutjanidae and Haemulidae. For each individual, weretwo reactions of PCR, first to amplify a fragment of about 550 bp,located in second portion of COI, using the primes described byPalumbi and Benzie (1991) (COIF and COIA), and then, a fragment ofapproximately 1200 bp, including the barcode region, with FishF1or FishF2 (Ward et al., 2005) and COI A (Palumbi & Benzie, 1991).The primers used for the sequencing were FishF1 or FishF2 andCOIF (Table 2).

The amplification conditions were: initial denaturation at 94 �Cfor 3 or 5 min, followed by 35 cycles of 30 or 40 s at 94 �C, 40 s or1min at 53 �Ce56.2 �C (Table 2), and 45 s or 2min at 72 �C, and finalextension of 10 min a 72 �C. The positive PCRs were sequencedusing the dideoxy-terminal method (Sanger, Nichlen, & Coulson,1977), with Big Dye kit reagents (ABI Prism� Dye Terminator

Table 2Primers used to amplify the fragment of COI gene (1131 bp) for each species ofLutjanidae and Haemulidae, with the respective hybridization temperature.

Species Combination of primers Hybridization(�C)

Lutjanussynagris

COIF-50CCTGCAGGAGGAGGAGAYCC30b,c

COIA-50AGTATAAGCGTCTGGGTAGTC30b

FishF1-50TCAACCAACCACAAAGACATTGGCAC30a,c


53.8

Lutjanusjocu

53.8

Ocyuruschrysurus

53.8

Lutjanuscyanopterus

53.8

Lutjanusanalis

56.2

Conodonnobilis

53,8

Genyatremusluteus

55

Lutjanuspurpureus

COIF-50CCTGCAGGAGGAGGAGAYCC30b,c


FishF2-50TCGACTAATCATAAAGATATCGGCAC30a,c


55

Lutjanusvivanus

55

Lutjanusbuccanella

55

Rhomboplitesaurorubens

55

a Ward et al. (2005).b Palumbi and Benzie (1991).c Primers used for sequencing.

Cycle Sequencing Reading Reaction e PE Applied Biosystems). Theprecipitated product was electrophoresed in an automatic capillarysequencer, model ABI 3500 xl (Applied Biosystems).

2.3. Analyses

2.3.1. Banding pattern e rDNA 5S/NTSThree specimens were selected from each of the seven lutjanid

species analyzed in the present study for the evaluation of intra-specific variation (Table 1), together with a number of the un-identified specimens (UISs). Two separate batteries of PCRs wereconducted. One included a single representative of each lutjanidspecies together with the specimens representing other perciformfamilies (Haemulidae, Scombridae, Centropomidae, and Sciaeni-dae), in an attempt to confirm species- or genus-specific bandingpatterns, or a pattern that is characteristic of the lutjanids. In thesecond battery, a number of different individuals of each specieswere included, together with the UISs.

The positive PCRs were submitted to further submarine elec-trophoresis, this time in concentrated (2%) agarose gel stained withethidium bromide, together with a ladder (DirectLoad� 50 bp StepLadder, containing 17 fragments) whichwas used as ametric for themeasurement of the observed bands. The electrophoretic run lastedan hour and a half with a current of approximately 70 V. The gel wassubsequently viewed under ultraviolet light in a transilluminatorand photographed for analysis.

2.3.2. The mitochondrial COI geneThe sequences obtained for the COI gene were aligned manually

using the BIOEDIT program (Hall, 1999). For the identification ofindividuals and species we created two databases, a reduced bankwith the 600 bp barcode region of all previously identified Lutja-nidae specimens and a total bank of all the 132 analyzed snapperswith the 1131 bp of COI. For the reduced dataset, we included onerepresentative of each previously identified lutjanid (initially sevenindividuals), obtained from the BOLD platform (Barcode of LifeDatabase) (Database available in www.boldsystems.org), Rhombo-plites aurorubens e ANGBF7605-12; Ocyurus chrysurus eANGBF7608-12; Lutjanus synagris e ANGBF7611-12; L. purpureus eDOACS017-08; L. vivanus e ANGBF7609-12; L. jocu e ANGBF7613-12; L. analis e ANGBF7686-12.

The data were fed into the DnaSP v 5 program (Librado & Rozas,2009) to generate a list of haplotypes, which were used as abenchmark for the taxonomic identification of the samples.

Phylogenetic trees were constructed using the Neighbor-Joining(NJ) and Maximum Likelihood (ML) approaches. The NJ trees wereproduced in MEGA 5.0 (Tamura et al., 2011), using the K2P evolu-tionary model (Kimura, 1980), which is normally used for thismolecular marker (Hubert et al., 2008; Rasmussen et al., 2009;Victor et al., 2009; Ward et al., 2005). The ML trees were gener-ated by the PHYML 3.0 program (Guindon & Gascuel, 2003), usingthe evolutionary model suggested by JMODELTEST 0.1.1 (Posada,2008). The significance of the observed groupings was estimatedby bootstrap analysis, based on 1000 pseudoreplicates. The se-quences of the species Conodon nobilis and Genyatremus luteus(Haemulidae) were used as the outgroup.

Intra and interspecific genetic divergence was evaluated usingthe K2P (Kimura, 1980) distances obtained fromMEGA 5.0 (Tamuraet al., 2011). Preliminary analyses (list of haplotypes and phyloge-netic trees) permitted the allocation of individuals to differentgroups corresponding to each lutjanid species, including the UISs.Some of the UISs were not allocated to any established group,formed distinct groups. Overall, a total of 10 groups were identified,including the seven lutjanid species (L. purpureus, L. vivanus,L. synagris, L. analis, L. jocu, R. aurorubens, and O. chrysurus), two

http://www.boldsystems.org


others, designated UIS1 and UIS2, as well as the representatives ofthe outgroup (Haemulidae). The pattern of interspecific geneticdistances was supported by the polymorphic sites, demonstratingthe mutations that separate the different species, observed inMEGA 5.0 (Tamura et al., 2011).

In addition to the analyses performed, the “barcode” sequencesof all specimens were submitted to NCBI/BLAST (Basic LocalAlignment Search Tool) to confirm identification. This allowed theidentification of individuals UIS 1 and UIS 2 to the species level,with respective representatives later included in the reduceddataset (Lutjanus cyanopterus e ANGBF7616-12; Lutjanus bucanellae ANGBF7617-12).

3. Results

3.1. rDNA 5S/NTS gene

The amplification of the rDNA 5S/NTS gene in the seven lutjanidspecies resulted in bands of different sizes for the majority of theindividuals (Fig. 1), which included intraspecific differences and alack of any clear species- or genus-specific pattern. In addition,many individuals assigned to different species shared the samebanding pattern (Fig. 2). Most of the lutjanids, including the un-identified specimens, presented two bands, one of which (ofapproximately 200 bp) was shared by all individuals, while theothere of around 450 bpewas observed in all the different species(Figs. 1 and 2).

Overall, four distinct banding patterns were identified (Figs. 1and 2) e (a) a single band of approximately 200 bp, which isdenominated here as the “lutjanid family band”, (b) a double band,including the lutjanid family band and a second band of approxi-mately 450 bp, (c) a triple band, including the two bands in (b) plusa third band of approximately 600 bp, and (d) a triple band as (c),but with a third sequence of only 300 bp instead of 600 bp.

Comparing bands among different families, it was not possibleto identify a band that is unique to the Lutjanidae, given that eventhe 200 bp band identified as the “lutjanid family band”was in factfound in the common snook, Centropomus undecimalis. However, itwas possible to differentiate the lutjanids from the haemulidae andsciaenidae. Even so, the diagnosis of the family based on thismarker was inconclusive.

3.2. Mitochondrial COI gene

A 1131 bp fragment of the COI gene was obtained from thespecimens of the seven lutjanid species, as well as the unidentifiedspecimens and three haemulidae specimens, which were used asthe outgroup, resulting in a total of 135 sequences (GenbankAccession Number: KF633260eKF633393; KF646804). The 132lutjanids presented 880 conserved and 251 polymorphic sites.

Fig. 1. Image of the 2% agarose gel, showing the products of the amplification of the rDNaurorubens (Rau); Lutjanus purpureus (Lpu); Lutjanus vivanus (Lvi); Lutjanus synagris (Lsy); Luhaemulidae: Conodon nobilis (Cno); Genyatremus luteus (Glu); (3) one scombridae: Scombercentropomidae: Centropomus undecimalis (Cun). L (DNA Ladder- DirectLoad� Step Ladder,

Two databases were used for analysis, one containing all 135samples, with 132 Lutjanidae and three Haemulidae (1131 bp) andthe other, only the samples for the seven identified species (n¼ 37),together with the specimens UIS1 and UIS2 (n ¼ 3) and specimensfrom the BOLD platform (n ¼ 9), resulting in a total of 52 sequences(49 Lutjanidae and 3 Haemulidae) with a 600 bp barcode fragment.

A total of 52 haplotypes were identified in the 132 lutjanidsamples, of which the most common were those of the speciesL. synagris and O. chrysurus, shared by 38 and nine specimens,respectively. L. analis, O. chrysurus and L. jocu presented the largestnumber of haplotypes (21, eight and six, respectively), while allother species were represented by only one or a few haplotypes.The majority of the unidentified specimens had haplotypes typicalof one of the seven lutjanid species sampled.

The trees generated using the different methods (ML and NJ)produced exactly the same topology, so only the NJ tree is pre-sented here, although the ML bootstrap values are shown in theFig. 3. The lutjanid species form well-supported consensual cladesin both trees, which are well differentiated from the outgroup(Fig. 3A and B). All of the unidentified specimens were allocated toone of the seven species clades except for four individuals (speci-mens UIS1 and UIS2) (Fig. 3A). However, with the barcode fragmentit was possible to identify them as L. bucanella (UIS 1) andL. cyanopterus (UIS 2), and to confirm the identify of all specimensthat had a prior identification (Fig. 3B).

Of the 95 UISs, 10 were identified as L. vivanus, 11 as O. chrysurus,32 as L. synagris, 24 as L. analis, one as L. purpureus, 14 as L. jocu, twowere allocated to UIS1 (L. bucanella) and one to UIS2(L. cyanopterus). Species-specific mutations were found in thepolymorphic sites representing all the species throughout thefragment of 1131 bp, however, due to the high number of poly-morphic sites, only those observed in the barcode fragment areshown in Fig. 4

The mean genetic distance (K2P) between the lujanids and theoutgroup for the 1.1 kb fragment varied from 18.2% for R. aurorubensand Haemulidae to 19.9% for L. cyanopterus and Haemulidae.Within the lutjanids, interspecific distances ranged from 3.1% (for L.purpureus vs. L. vivanus) to 12.7% (for R. aurorubens vs. L. cya-nopterus), although L. cyanopterus was the most divergent overall.Distances between genera varied from 6.6% to 11.4% for Ocyurus vs.Lutjanus, and 5.6%e12.7% for Rhomboplites vs. Lutjanus (Table 3).Mean divergence within species does not exceed 0.5% in any case.

4. Discussion

4.1. rDNA 5S bands or COI sequences?

The amplified products of the rDNA 5S gene did not provide aclear banding pattern capable of differentiating the lutjanid speciesanalyzed in the present study. In addition to the observed

A 5S/NTS gene. In (1) nine lutjanidae species: Ocyurus chrysurus (Och); Rhomboplitestjanus analis (Lan); Lutjanus jocu (Ljo); Unidentified Snappers (UIS) 68 and 44; (2) twoomorus brasiliensis (Sbr); (4) one sciaenidae of the genus Cynoscion (Csp); and (5) one50 bps, containing 17 fragments).

Fig. 2. Image of the 2% agarose gel, showing the products of the amplification of the rDNA 5S/NTS gene demonstrating the pattern of intraspecific variation. Ocyurus chrysurus(Och); Rhomboplites aurorubens (Rau); Lutjanus purpureus (Lpu); Lutjanus vivanus (Lvi); Lutjanus synagris (Lsy); Lutjanus analis (Lan) and Lutjanus jocu (Ljo), as well as UnidentifiedSnappers (UIS). L (DNA Ladder- DirectLoad� Step Ladder, 50 bps, containing 17 fragments).


intraspecific variation, the same banding pattern was recorded indifferent species, a situation also found in fishes such as mullets(Mugilidae). However, whereas equivalent banding patterns wereobserved in some mullet species, i.e., Mugil cephalus, M. liza, and

Fig. 3. Phylogenetic Neighbor-Joining trees for the fragment of the Cytochrome Oxidase sub(1131 bp) (A) and a subset for only the barcode region (600 bp) containing only the identified(B). The numbers above the nodes correspond to the bootstrap values for the Neighbor Joi

M. platanus, others e M. hospes, M. incilis, M. sp. and M. curema ewere differentiated (Rodrigues-Filho et al., 2010). In this case,however, the authors attributed the results to problems with thetaxonomy of the group, rather than the ineffectiveness of the

unit I gene for the whole data set, including 132 lutjanids and the outgroup (hamulids)lutjanids and UIS1 and UIS2 together with sequences retrieved from the BOLD platformning (left) and Maximum Likelihood (right) approaches.

Fig. 4. The approximately 145 polymorphic sites of the 600 bp of the barcode Cytochrome Oxidase subunit I (COI) gene sequences analyzed in the present study, showing themutations that separate the species. Rau ¼ Rhomboplites aurorubens; Och ¼ Ocyurus chrysurus; Lpu ¼ Lutjanus purpureus; Ljo ¼ Lutjanus jocu; Lsy ¼ Lutjanus synagris; Lan ¼ Lutjanusanalis; Lvi ¼ Lutjanus vivanus; Lbu (UIS 1) ¼ Lutjanus bucanella; Lcy (UIS 2) ¼ Lutjanus cyanopterus.


marker, as may have occurred in the lutjanids analyzed in thepresent study.

The discrimination of species using rDNA 5S banding patternsshould be possible due to differences in the size of the fragmentsamplified, which are related to variation in the NTSs. This shouldprovide a distinct banding pattern observable in the gel, as found inother fishery resources, such as cephalopods (Sales et al., 2011),salmonids (Pendás, Móran, Martínez, & Garcia-Vásquez, 1995), andsharks (Pinhal, Gadig, & Martins, 2009). However, many speciespresent fragments of the same size, and can be distinguished onlyby mutations (base substitutions), as found in the genus Brycon(Wasko et al., 2001) and members of the family Sciaenidae (Alves-Costa et al., 2008).

Four distinct banding patterns were observed in the lutjanids,which may indicate the existence of different classes of the rDNA5S gene in this family. A similar situation has been described for anumber of other fishes, such as Salmo salar (Pendás, Móran,Freije, & Garcia-Vásquez, 1994), Oncorhynchus mykiss (Móran,Martínez, Garcia-Vásquez, & Pendás, 1996), Oreochromis niloti-cus (Martins et al., 2002), and the genera Coregonus (Sajdak,Reed, & Phillips, 1998), Leporinus (Martins & Galetti, 2001) andBrycon (Wasko et al., 2001). Two different arrangements of theribosomal 5S gene have been found in sciaenidae fishes, asshown by Alves-Costa et al. (2008) in Isopisthus parvipinnis,which suggests that this may be a common arrangement in this

Table 3Mean genetic distances (k2P) between species (lutjanids and haemulidse outgroup)considering a 1131-bp fragment of the Cytochrome Oxidase subunit I (COI) gene.OG ¼ outgroup; Rau ¼ R. aurorubens; Och ¼ O. chrysurus; Lpu ¼ L. purpureus;Lvi ¼ L. vivanus; Lsy ¼ L. synagris; Lan ¼ L. analis; Ljo ¼ L. jocu; Lbu ¼ L. bucanella;Lcy ¼ L. cyanopterus.

Nucleotide divergence (%)

1 2 3 4 5 6 7 8 9

1 OG2 Rau 18.23 Och 18.8 8.34 Lpu 18.7 5.6 7.65 Lvi 19.5 6.7 6.6 3.16 Lsy 19.5 6.3 7.6 7.3 7.27 Lan 19 6.5 7.1 6.1 6.7 5.78 Ljo 18.6 11 11 10.9 11.5 10.9 10.49 Lbu 18.9 7.4 7 6.8 6.6 6.2 5.2 11.310 Lcy 19.9 12.7 11.4 11.8 12 11.5 11.1 11.4 12.5

group of vertebrates, hampering molecular identification usingthis marker.

By contrast, a large number of studies have emphasized theeffectiveness of the COI gene for the reliable discrimination of taxa,in both invertebrates (Greenstone et al., 2005; Haye et al., 2012;Hogg & Hebert, 2004; Silva-Oliveira et al., 2011; Smith, Woodley,Janzen, Hallwachs, & Hebert, 2006) and vertebrates, including avariety of fishes, such as teleosts, rays, chimaeras, and sharks(Ardura, Linde, Moreira, & Garcia-Vazquez, 2010; Hubert et al.,2008; Ward, Hanner, & Hebert, 2009; Ward et al., 2005). Many ofthe studies of fishes have focused on the discrimination ofcommercially-important species, providing an important tool forthe identification of fraudulent practices in the fishery trade. Spe-cific cases include Filonzi et al. (2010) study of Dicentrarchus labrax,Sparus aurata, and Mullus surmuletus, Barbuto et al. (2010) onMustelus spp., Rasmussen et al. (2009) on salmon and trout, andcatfish (Siluriformes), studied by Wong et al. (2011) and Carvalho,Neto, et al. (2011).

The results of the present study have shown that it is possible toidentify all the lutjanid species using the COI gene, further rein-forcing the efficiency of this marker as a reliable bio-identifier. Inaddition to the seven species identified initially, two other specieswere discriminated using the COI barcode fragment, resulting in atotal of nine species of Lutjanidae analysed.

Most COI studies have analyzed a fragment located in the firsthalf of this gene, which is considered to be a “barcode” (Hebertet al., 2003; Rock et al., 2008; Ward et al., 2005). The presentstudy includes an alternative segment, located in the second half ofthe gene e approximately between nucleotides 770 and 1300 ewhich together with the barcode region produced a fragment withapproximately 1130 bp.

The arrangement of polymorphic sites in the region of COIanalyzed here revealed the presence of species-specific mutationsthroughout the segment, reinforcing its effectiveness for the dif-ferentiation of species.

The separation of the lutjanids in the phylogenetic trees wasreinforced by the genetic distances found among species, whichreflects the interspecific polymorphism mentioned above, weretypical of those found within and between fish species in otherstudies. For the divergence between families e Lutjanidae andHaemulidae (outgroup) e the values found in the present studywere similar to those recorded by Ward et al. (2005), althoughHubert et al. (2008) reported mean values greater than 19%.


The genetic distances between genera recorded in the presentstudy were lower than those recorded by Ward et al. (2005) andCarvalho, Oliveira, et al. (2011), and in some cases, such asL. purpureus vs. R. aurorubens and L. vivanus vs O. chrysurus, weremore characteristic of intrageneric comparisons. Gold, Voelker, andRenshaw (2011) proposed a molecular phylogeny for some lutja-nids using mitochondrial markers (NADH-subunit 4, COI and Cy-tochrome b) and discussed the close relationship between Ocyurus,Lutjanus, and Rhomboplites, which they interpreted as beingconsistent with that of a single genus, as proposed by Miller andCribb (2007).

In the present study, mean interspecific distances were over2.5% in all cases, and well above the mean distances observedwithin populations (0.5%), reflecting the presence of well-definedand coherent groups equivalent to species. Comparing DNA bar-coding sequences in L. analis and L. cyanopterus, Victor et al. (2009)found a divergence of over 11%. Ward et al. (2005) detected a meandistance of approximately 9.9% for comparisons between species ofthe same genus and 0.4% for intra-population comparisons, whichare similar to the values of 8.3% and 0.3%, respectively, recorded byHubert et al. (2008). A similar pattern was observed in the presentstudy.

Overall, the results presented here, including genetic diver-gence, the distribution of polymorphic sites, and tree topology,confirm the hypothesis that different regions of the COI gene maybe used successfully to create a reliable authentication system forfishery products. This procedure thus constitutes a powerful toolfor biological identification, given that it is able to discriminate notonly intraspecific variation, but also interspecific differences reli-ably enough to permit the identification of species.

4.2. Using COI sequences to authenticate lutjanids

The banding pattern of the rDNA 5S gene observed directly inagarose gel, without the need for sequencing, would be in principlea more practical alternative for the routine identification of species.However, no species- or genus-specific patternwas observed in thepresent study, indicating that this molecular marker is not appro-priate for the discrimination of the species in this group.

By contrast, the COI fragment analyzed (barcode and non bar-code region) in this study proved to be an extremely effective andreliable tool for the diagnosis of the authenticity of fishery productsderived from lutjanids. All of the unidentified specimens (100%)could be assigned unequivocally to a species.

The characterization of genomic regions with potential for bio-identification, represents a fundamental first step towards thedevelopment of rapid and reliable molecular protocols for theauthentication of processed fishery products. This technique maybe an important tool for the identification of frauds or the acci-dental substitution of one fish species for another, which mayhappen frequently during the processing and marketing of fisheryproducts.

Acknowledgements

This study was supported by CNPq.

References

Allen, G. R. (1985). FAO species catalogue. In Snappers of the world (Vol. 6 (pp. 208).N� . 125.

Alves-Costa, F. A., Martins, C., Matos, F. D. C., Foresti, F., Oliveira, C., & Wasko, A. P.(2008). 5S rDNA characterization in twelve Sciaenidae fish species (Teleostei,Perciformes): depicting gene diversity and molecular markers. Genetics andMolecular Biology, 31, 303e307.

Ardura, A., Linde, A. R., Moreira, J. C., & Garcia-Vazquez, E. (2010). DNA barcoding forconservation and management of Amazonian commercial fish. Biological Con-servation, 143, 1438e1443.

Barbuto, M., Galimberti, A., Ferri, E., Labra, M., Malandra, R., Galli, P., et al. (2010).DNA barcoding reveals fraudulent substitutions in shark seafood products: theItalian case of ‘‘palombo” (Mustelus spp.). Food Research International, 43, 376e381.

Brown, J. R., Beckenbach, K., Beckenbach, A. T., & Smith, M. J. (1996). Length vari-ation, heteroplasmy and sequence divergence in the mitochondrial DNA of fourspecies of Sturgeon (Acipmer). Genetics, 142, 525e535.

Carrera, E., Garcia, T., Céspedes, A., Gonzalez, I., Fernandez, A., Asensio, L. M., et al.(2000). Differentiation of smoked Salmo salar, Oncorhynchus mykiss and Bramaraii using the nuclear marker 5S rDNA. International Journal of Food Science &Technology, 35, 401e406.

Carvalho, D. C., Neto, D. A. P., Brasil, B. S. F., & Oliveira, D. A. A. (2011). DNA barcodingunveils a high rate of mislabeling in a commercial freshwater catfish fromBrazil. Informa Healthcare, 22(S1), 97e105.

Carvalho, D. C., Oliveira, D. A. A., Pompeu, P. S., Leal, C. G., Oliveira, C., & Hanner, R.(2011). Deep barcode divergence in Brazilian freshwater fishes: the case of theSão Francisco River basin. Informa Healthcare, 22(S1), 80e86.

Cervigón, F. (1993) (2th ed.).. Los peces marinhos de Venezuela (Vol. II (pp. 498)Caracas, Venezuela: Fundacion Científica Los Roques.

Cervigón, F., Capriani, F., Fischer, W., Garibaldi, L., Hendrickx, M., Lemus, A. J., et al.(1993). FAO species identification sheets for fishery purpose. Field guide to thecommercial marine and Brackish-water resources of the Northerrn Coast of SouthAmerica (pp. 513). Rome: FAO.

Céspedes, A., Garcia, T., Carrera, E., Gonzalez, I., Fernandez, A., Hernandez, P. E., et al.(1999). Identication of sole (Solea solea) and Greenland halibut (Reinhardtiushippoglossoides) by PCR amplication of the 5S rDNA gene. Journal of Agriculturaland Food Chemistry, 47, 1046e1050.

Chiu, T. H., Su, Y. C., Pai, J. Y., & Chang, H. C. (2012). Molecular markers for detectionand diagnosis of the giant grouper (Epinephelus lanceolatus). Food Control, 24,29e37.

De Salle, R., & Birstein, V. J. (1996). PCR identification of black caviar. Nature, 381,197e198.

FAO. (2012). The state of world fisheries and aquacultura. Disponível em: . Acesso em: ago. 2012.

Filonzi, L., Chiesa, S., Vaghi, M., & Marzano, F. N. (2010). Molecular barcoding revealsmislabelling of commercial fish products in Italy. Food Research International, 43,1383e1388.

Froese, R., & Pauly, D. (2012). In FishBase (Ed.), World wide web electronic publica-tion. Disponível em: www.fishbase.org. Acesso em: ago.2012.

Gold, J. R., Voelker, G., & Renshaw, M. A. (2011). Phylogenetic relationships oftropical western Atlantic snappers in subfamily Lutjaninae (Lutjanidae: Perci-formes) inferred from mitochondrial DNA sequences. Biological Journal of theLinnean Society, 102, 915e929.

Greenstone, M. H., Rowley, D. L., Heimbach, U., Lundgren, J. G., Pfannenstiel, R. S., &Rehner, S. A. (2005). Barcoding generalist predators by polymerase chain re-action: Carabids and Spiders. Molecular Ecology, 14, 3247e3266.

Guindon, S., & Gascuel, O. (2003). A simple, fast, and accurate algorithm to estimatelarge phylogenies by maximum likelihood. Systematic Biology, 52, 696e704.

Hall, T. A. (1999). BioEdit: a user-friendly biological sequence alignment editor andanalysis program for Windows 95/98/NT. Nucleic Acids Symposium Series, 41,95e98.

Haye, P. A., Segovia, N. I., Vera, R., Gallardo, M. A., & Gallardo-Escárate, C. (2012).Authentication of commercialized crab-meat in Chile using DNA barcoding.Food Control, 25, 239e244.

Hebert, P. D. N., Cywinska, A., Ball, S. L., & de Waard, J. R. (2003). Biological iden-tifications through DNA barcodes. Proceedings of the Royal Society of LondonSeries B, Biological Sciences, 270, 313e332.

Hogg, I. D., & Hebert, P. D. N. (2004). Biological identification of springtails (Col-lembola: Hexapoda) from the Canadian Arctic, using mitochondrial DNA barc-odes. Canadian Journal of Zoology, 82, 749e754.

Hubert, N., Hanner, R., Holm, E., Mandrak, N. E., Taylor, E., Burridge, M., et al. (2008).Identifying Canadian freshwater fishes through DNA barcodes. PLoS One, 3, 2490.

Kimura, M. (1980). A simple method for estimating evolutionary rate of base sub-stitutions through comparative studies of nucleotide sequences. Journal ofMolecular Evolution, 16, 111e120.

Librado, P., & Rozas, J. (2009). DnaSP v5: a software for comprehensive analysis ofDNA polymorphism data. Bioinformatics, 25, 1451e1452.

Mackie, I. M., Pryde, S. E., Gonzales-Sotelo, C., Medina, I., Pérez-Martín, R.,Quinteiro, J., et al. (1999). Challenges in the identification of species of cannedfish. Trends in Food Science & Technology, 10, 9e14.

Marko, P. B., Lee, S. C., Rice, A. M., Gramling, J. M., Fitzhenry, T. M., McAlister, J. S.,et al. (2004). Mislabelling of a depleted reef fish. Nature, 430, 309e310.

Martins, C., & Galetti, P. M., Jr. (2001). Organization of 5S rDNA in species of the fishLeporinus: two different genomic locations are characterized by distinct non-transcribed spacers. Genome, 44, 903e910.

Martins, C., & Wasko, A. P. (2004). Organization and evolution of 5S ribosomal DNAin the fish genome. In C. R. Williams (Ed.), Focus on genome research (pp. 289e318). Hauppauge: New Science Publishers.

Martins, C., Wasko, A. P., Oliveira, C., Porto-Foresti, F., Parise-Maltempi, P. P.,Wright, J. M., et al. (2002). Dynamics of 5S rDNA in the tilapia (Oreochromisniloticus) genome: repeat units, inverted sequences, pseudogenes and chro-mosome loci. Cytogenetic and Genome Research, 98, 76e85.

http://refhub.elsevier.com/S0956-7135(13)00535-5/sref1http://refhub.elsevier.com/S0956-7135(13)00535-5/sref1http://refhub.elsevier.com/S0956-7135(13)00535-5/sref1http://refhub.elsevier.com/S0956-7135(13)00535-5/sref2http://refhub.elsevier.com/S0956-7135(13)00535-5/sref2http://refhub.elsevier.com/S0956-7135(13)00535-5/sref2http://refhub.elsevier.com/S0956-7135(13)00535-5/sref2http://refhub.elsevier.com/S0956-7135(13)00535-5/sref2http://refhub.elsevier.com/S0956-7135(13)00535-5/sref3http://refhub.elsevier.com/S0956-7135(13)00535-5/sref3http://refhub.elsevier.com/S0956-7135(13)00535-5/sref3http://refhub.elsevier.com/S0956-7135(13)00535-5/sref3http://refhub.elsevier.com/S0956-7135(13)00535-5/sref4http://refhub.elsevier.com/S0956-7135(13)00535-5/sref4http://refhub.elsevier.com/S0956-7135(13)00535-5/sref4http://refhub.elsevier.com/S0956-7135(13)00535-5/sref4http://refhub.elsevier.com/S0956-7135(13)00535-5/sref5http://refhub.elsevier.com/S0956-7135(13)00535-5/sref5http://refhub.elsevier.com/S0956-7135(13)00535-5/sref5http://refhub.elsevier.com/S0956-7135(13)00535-5/sref5http://refhub.elsevier.com/S0956-7135(13)00535-5/sref6http://refhub.elsevier.com/S0956-7135(13)00535-5/sref6http://refhub.elsevier.com/S0956-7135(13)00535-5/sref6http://refhub.elsevier.com/S0956-7135(13)00535-5/sref6http://refhub.elsevier.com/S0956-7135(13)00535-5/sref6http://refhub.elsevier.com/S0956-7135(13)00535-5/sref7http://refhub.elsevier.com/S0956-7135(13)00535-5/sref7http://refhub.elsevier.com/S0956-7135(13)00535-5/sref7http://refhub.elsevier.com/S0956-7135(13)00535-5/sref7http://refhub.elsevier.com/S0956-7135(13)00535-5/sref8http://refhub.elsevier.com/S0956-7135(13)00535-5/sref8http://refhub.elsevier.com/S0956-7135(13)00535-5/sref8http://refhub.elsevier.com/S0956-7135(13)00535-5/sref8http://refhub.elsevier.com/S0956-7135(13)00535-5/sref9http://refhub.elsevier.com/S0956-7135(13)00535-5/sref9http://refhub.elsevier.com/S0956-7135(13)00535-5/sref10http://refhub.elsevier.com/S0956-7135(13)00535-5/sref10http://refhub.elsevier.com/S0956-7135(13)00535-5/sref10http://refhub.elsevier.com/S0956-7135(13)00535-5/sref10http://refhub.elsevier.com/S0956-7135(13)00535-5/sref11http://refhub.elsevier.com/S0956-7135(13)00535-5/sref11http://refhub.elsevier.com/S0956-7135(13)00535-5/sref11http://refhub.elsevier.com/S0956-7135(13)00535-5/sref11http://refhub.elsevier.com/S0956-7135(13)00535-5/sref11http://refhub.elsevier.com/S0956-7135(13)00535-5/sref12http://refhub.elsevier.com/S0956-7135(13)00535-5/sref12http://refhub.elsevier.com/S0956-7135(13)00535-5/sref12http://refhub.elsevier.com/S0956-7135(13)00535-5/sref12http://refhub.elsevier.com/S0956-7135(13)00535-5/sref13http://refhub.elsevier.com/S0956-7135(13)00535-5/sref13http://refhub.elsevier.com/S0956-7135(13)00535-5/sref13http://www.%20fao.org/docrep/016/i2727e/i2727e00.htmhttp://www.%20fao.org/docrep/016/i2727e/i2727e00.htmhttp://refhub.elsevier.com/S0956-7135(13)00535-5/sref15http://refhub.elsevier.com/S0956-7135(13)00535-5/sref15http://refhub.elsevier.com/S0956-7135(13)00535-5/sref15http://refhub.elsevier.com/S0956-7135(13)00535-5/sref15http://www.fishbase.orghttp://refhub.elsevier.com/S0956-7135(13)00535-5/sref17http://refhub.elsevier.com/S0956-7135(13)00535-5/sref17http://refhub.elsevier.com/S0956-7135(13)00535-5/sref17http://refhub.elsevier.com/S0956-7135(13)00535-5/sref17http://refhub.elsevier.com/S0956-7135(13)00535-5/sref17http://refhub.elsevier.com/S0956-7135(13)00535-5/sref18http://refhub.elsevier.com/S0956-7135(13)00535-5/sref18http://refhub.elsevier.com/S0956-7135(13)00535-5/sref18http://refhub.elsevier.com/S0956-7135(13)00535-5/sref18http://refhub.elsevier.com/S0956-7135(13)00535-5/sref19http://refhub.elsevier.com/S0956-7135(13)00535-5/sref19http://refhub.elsevier.com/S0956-7135(13)00535-5/sref19http://refhub.elsevier.com/S0956-7135(13)00535-5/sref20http://refhub.elsevier.com/S0956-7135(13)00535-5/sref20http://refhub.elsevier.com/S0956-7135(13)00535-5/sref20http://refhub.elsevier.com/S0956-7135(13)00535-5/sref20http://refhub.elsevier.com/S0956-7135(13)00535-5/sref21http://refhub.elsevier.com/S0956-7135(13)00535-5/sref21http://refhub.elsevier.com/S0956-7135(13)00535-5/sref21http://refhub.elsevier.com/S0956-7135(13)00535-5/sref21http://refhub.elsevier.com/S0956-7135(13)00535-5/sref22http://refhub.elsevier.com/S0956-7135(13)00535-5/sref22http://refhub.elsevier.com/S0956-7135(13)00535-5/sref22http://refhub.elsevier.com/S0956-7135(13)00535-5/sref22http://refhub.elsevier.com/S0956-7135(13)00535-5/sref23http://refhub.elsevier.com/S0956-7135(13)00535-5/sref23http://refhub.elsevier.com/S0956-7135(13)00535-5/sref23http://refhub.elsevier.com/S0956-7135(13)00535-5/sref23http://refhub.elsevier.com/S0956-7135(13)00535-5/sref24http://refhub.elsevier.com/S0956-7135(13)00535-5/sref24http://refhub.elsevier.com/S0956-7135(13)00535-5/sref25http://refhub.elsevier.com/S0956-7135(13)00535-5/sref25http://refhub.elsevier.com/S0956-7135(13)00535-5/sref25http://refhub.elsevier.com/S0956-7135(13)00535-5/sref25http://refhub.elsevier.com/S0956-7135(13)00535-5/sref26http://refhub.elsevier.com/S0956-7135(13)00535-5/sref26http://refhub.elsevier.com/S0956-7135(13)00535-5/sref26http://refhub.elsevier.com/S0956-7135(13)00535-5/sref27http://refhub.elsevier.com/S0956-7135(13)00535-5/sref27http://refhub.elsevier.com/S0956-7135(13)00535-5/sref27http://refhub.elsevier.com/S0956-7135(13)00535-5/sref27http://refhub.elsevier.com/S0956-7135(13)00535-5/sref28http://refhub.elsevier.com/S0956-7135(13)00535-5/sref28http://refhub.elsevier.com/S0956-7135(13)00535-5/sref28http://refhub.elsevier.com/S0956-7135(13)00535-5/sref29http://refhub.elsevier.com/S0956-7135(13)00535-5/sref29http://refhub.elsevier.com/S0956-7135(13)00535-5/sref29http://refhub.elsevier.com/S0956-7135(13)00535-5/sref29http://refhub.elsevier.com/S0956-7135(13)00535-5/sref30http://refhub.elsevier.com/S0956-7135(13)00535-5/sref30http://refhub.elsevier.com/S0956-7135(13)00535-5/sref30http://refhub.elsevier.com/S0956-7135(13)00535-5/sref31http://refhub.elsevier.com/S0956-7135(13)00535-5/sref31http://refhub.elsevier.com/S0956-7135(13)00535-5/sref31http://refhub.elsevier.com/S0956-7135(13)00535-5/sref31http://refhub.elsevier.com/S0956-7135(13)00535-5/sref31


Matos-Caraballo, D. (2000). Overview of Puerto Rico’s small-scale fisheries statis-tics: 1994e1997. Proceedings of the Gulf and Caribbean Fisheries Institute, 51,215e231.

Mendoza, J. J., & Larez, A. (1996). Abundance and distribution of snappers andgroupers targeted by the artisanal medium range fishery off northeasternVenezuela (1981e1992). ICLARM Conference Proceedings, 48, 266e276.

Menezes, N. A., & Figueiredo, J. L. (1980). Manual de Peixes marinhos do Sudeste doBrasil. IV. Teleostei (3) (pp. 96). São Paulo: Museu de Zoologia e Universidade deSão Paulo (USP).

Miller, T. L., & Cribb, T. H. (2007). Phylogenetic relationships of some common Indo-Pacific snappers (Perciformes: Lutjanidae) based on mitochondrial DNA se-quences, with comments on the taxonomic position of the Caesioninae. Mo-lecular Phylogenetics and Evolution, 44, 450e460.

Móran, P., Martínez, J. L., Garcia-Vásquez, E., & Pendás, A. M. (1996). Sex linkage of5S rDNA in rainbow trout (Oncorhynchus mykiss). Cytogenetics and Cell Genetics,75, 145e150.

Moura, R. L., & Lindeman, K. C. (2007). A new species of snapper (Perciformes:Lujanidae) from Brazil, with comments on the distribution of Lutjanus griseusand L. apodus. Zootaxa, 1422, 31e43.

Nelson, J. S. (2006). Fishes of the world (4th ed.). (pp. 539) New Jersey: John Wiley &Sons, Inc.

Palumbi, S., & Benzie, J. (1991). Large mitocondrial DNA differences betweenmorphologically similar Penaeid shrimp. Molecular Marine Biology andBiotechnology, 1, 27e34.

Pendás, A. M., Móran, P., Freije, J. P., & Garcia-Vásquez, E. (1994). Chromosomallocation and nucleotide sequence of two tandem repeats of the Atlantic salmon5S rDNA. Cytogenetics and Cell Genetics, 67, 31e36.

Pendás, A. M., Móran, P., Martínez, J. L., & Garcia-Vásquez, E. (1995). Applications of5S rDNA in Atlantic salmon, brow trout, and in Atlantic salmon x brown trouthybrid identification. Molecular Ecology, 4, 275e276.

Pinhal, D., Gadig, O. B. F., & Martins, C. (2009). Molecular organization of 5S rDNA insharks of the genus Rhizoprionodon: insights into the evolutionary dynamics of5S rDNA in vertebrate genomes. Genetics Research, 91, 61e72.

Pinhal, D., Gadig, O. B. F., Wasko, A. P., Oliveira, C., Ron, E., Foresti, F., et al. (2008).Discrimination of shark species by simple PCR of 5S rDNA repeats. Genetics andMolecular Biology, 31, 361e365.

Posada, D. (2008). JMODELTEST: phylogenetic model averaging. Molecular Biologyand Evolution, 25, 1253.

Prescod, S. D., Oxenford, H. A., & Taylor, C. (1996). The snapper fishery of Barbados:present status and a preliminary assessment of the potential for expansion.Proceedings of the Gulf and Caribbean Fisheries Institute, 44, 159e179.

Rasmussen, R. S., & Morrissey, M. T. (2008). Application of DNA-based methods toidentify fish and seafood substitution on the commercial market. Comprehen-sive Reviews in Food Science and Food Safety, 8, 118e154.

Rasmussen, R. S., Morrissey, M. T., & Hebert, P. D. N. (2009). DNA barcoding ofcommercially important Salmon and trout species (Oncorhynchus and Salmo)from North America. Journal of Agricultural and Food Chemistry, 57, 8379e8385.

Rock, J., Costa, F. O., Walker, D. I., North, A. W., Hutchinson, W. F., & Carvalho, G. R.(2008). DNA barcodes of fish of the Scotia Sea, Antarctica indicate prioritygroups for taxonomic and systematics focus. Antarctic Science, 20, 253e262.

Rodrigues-Filho, L. F. S., Cunha, D. B., Vallinoto, M., Schneider, H., Sampaio, I., &Fraga, E. (2010). Polymerase chain reaction banding patterns of the 5S rDNA

gene as a diagnostic tool for the discrimination of South American mullets ofthe genus Mugil. Aquaculture Research, 1e6.

Sajdak, S. L., Reed, K. M., & Phillips, R. B. (1998). Intraindividual and interspeciesvariation in the 5S rDNA of coregonid fish. Journal of Molecular Evolution, 46,680e688.

Sales, J. B. L., Rodrigues-Filho, L. F. S., Haimovici, M., Sampaio, I., & Schneider, H.(2011). Food Control, 22, 96e98.

Sambrook, j., & Russell, D. (2001). Molecular cloning: A laboratory manual. ColdSpring Harbor, New York: Cold 303 Spring Harbor Laboratory Press.

Sanger, F., Nichlen, S., & Coulson, A. R. (1977). DNA sequencing with chain-termination inhibitors. Proceeding of the National Academy of Science of theUSA, 74, 5463e5468.

Silva-Oliveira, G. C., Ready, J. S., Iketani, G., Bastos, S., Gomes, G., Sampaio, I., et al.(2011). The invasive status of Macrobrachium rosenbergii (De Man, 1879) inNorthern Brazil, with an estimation of areas at risk globally. Aquatic Invasions,6(3), 419e428.

Smith, M. A., Woodley, N. E., Janzen, D. H., Hallwachs, W., & Hebert, P. D. N. (2006).DNA barcodes reveal cryptic host-specificity within the presumed polyphagousmembers of a genus of parasitoid flies (Diptera: Tachinidae). Proceedings of theNational Academy of Sciences, 103, 3657e3662.

Sotelo, C., Piñeiro, C., Gallardo, J. M., & Pérez-Martín, R. I. (1993). Fish species identi-fication in seafood products. Trends in Food Science and Technology, 4, 395e440.

Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., & Kumar, S. (2011). MEGA5: molecular evolutionary genetics analysis using maximum likelihood,evolutionary distance, and maximum Parsimony methods. Molecular Biologyand Evolution, 28(10), 2731e2739.

Van Leeuwen, S. P., van Velzen, M. J., Swart, C. P., van der Veen, I., Traag, W. A., & deBoer, J. (2009). Halogenated contaminants in farmed salmon, trout, tilapia,pangasius, and shrimp. Environmental Science and Technology, 43, 4009e4015.

Victor, B. C., Hanner, R., Shivji, M., Hyde, J., & Caldow, C. (2009). Identification of thelarval and juvenile stages of the Cubera Snapper, Lutjanus cyanopterus, usingDNA barcoding. Zootaxa, 2215, 24e36.

Ward, R. D. (2000). Genetics in fisheries management. Hydrobiologia, 420, 191e201.Ward, R. D., Hanner, R., & Hebert, P. D. N. (2009). The campaign to DNA barcode all

fishes, FISH-BOL. Journal of Fish Biology, 74, 329e356.Ward, R. D., Zemlak, T. S., Innes, B. H., Last, P. R., & Hebert, P. D. N. (2005). DNA

barcoding Australia’s fish species. Philosophical Transactions of the Royal Societyof London. Series B, 360, 1847e1857.

Wasko, A. P., Martins, C., Wright, J. M., & Galetti, P. M., Jr. (2001). Molecular orga-nization of 5S rDNA in fishes of the genus Brycon. Genome, 44, 893e902.

Wen, J., Hu, C., Zhang, L., & Fan, S. (2011). Genetic identification of global com-mercial sea cucumber species on the basis of mitochondrial DNA sequences.Food Control, 22, 72e77.

Wong, L. L., Peatman, E., Lu, J., Kucuktas, H., He, S., Zhou, C., et al. (2011). DNAbarcoding of catfish: species authentication and phylogenetic assessment. PLoSOne, 6, e17812.

Yang, Y. C., Huang, Y. W., Hsieh, C. H., Huang, Y. R., & Chen, C. H. (2012). A uniquespecification method for processed unicorn filefish products using a DNA bar-code marker. Food Control, 25, 292e302.

Zhang, J., & Liu, X. (2006). The phylogenetic relationship of the family Lutjanidaebased on analyses of AFLP and mitochondrial 12S rRNA sequences. ChineseScience Bulletin, 51, 143e148.

http://refhub.elsevier.com/S0956-7135(13)00535-5/sref32http://refhub.elsevier.com/S0956-7135(13)00535-5/sref32http://refhub.elsevier.com/S0956-7135(13)00535-5/sref32http://refhub.elsevier.com/S0956-7135(13)00535-5/sref32http://refhub.elsevier.com/S0956-7135(13)00535-5/sref32http://refhub.elsevier.com/S0956-7135(13)00535-5/sref33http://refhub.elsevier.com/S0956-7135(13)00535-5/sref33http://refhub.elsevier.com/S0956-7135(13)00535-5/sref33http://refhub.elsevier.com/S0956-7135(13)00535-5/sref33http://refhub.elsevier.com/S0956-7135(13)00535-5/sref33http://refhub.elsevier.com/S0956-7135(13)00535-5/sref34http://refhub.elsevier.com/S0956-7135(13)00535-5/sref34http://refhub.elsevier.com/S0956-7135(13)00535-5/sref34http://refhub.elsevier.com/S0956-7135(13)00535-5/sref34http://refhub.elsevier.com/S0956-7135(13)00535-5/sref35http://refhub.elsevier.com/S0956-7135(13)00535-5/sref35http://refhub.elsevier.com/S0956-7135(13)00535-5/sref35http://refhub.elsevier.com/S0956-7135(13)00535-5/sref35http://refhub.elsevier.com/S0956-7135(13)00535-5/sref35http://refhub.elsevier.com/S0956-7135(13)00535-5/sref36http://refhub.elsevier.com/S0956-7135(13)00535-5/sref36http://refhub.elsevier.com/S0956-7135(13)00535-5/sref36http://refhub.elsevier.com/S0956-7135(13)00535-5/sref36http://refhub.elsevier.com/S0956-7135(13)00535-5/sref37http://refhub.elsevier.com/S0956-7135(13)00535-5/sref37http://refhub.elsevier.com/S0956-7135(13)00535-5/sref37http://refhub.elsevier.com/S0956-7135(13)00535-5/sref37http://refhub.elsevier.com/S0956-7135(13)00535-5/sref38http://refhub.elsevier.com/S0956-7135(13)00535-5/sref38http://refhub.elsevier.com/S0956-7135(13)00535-5/sref39http://refhub.elsevier.com/S0956-7135(13)00535-5/sref39http://refhub.elsevier.com/S0956-7135(13)00535-5/sref39http://refhub.elsevier.com/S0956-7135(13)00535-5/sref39http://refhub.elsevier.com/S0956-7135(13)00535-5/sref40http://refhub.elsevier.com/S0956-7135(13)00535-5/sref40http://refhub.elsevier.com/S0956-7135(13)00535-5/sref40http://refhub.elsevier.com/S0956-7135(13)00535-5/sref40http://refhub.elsevier.com/S0956-7135(13)00535-5/sref41http://refhub.elsevier.com/S0956-7135(13)00535-5/sref41http://refhub.elsevier.com/S0956-7135(13)00535-5/sref41http://refhub.elsevier.com/S0956-7135(13)00535-5/sref41http://refhub.elsevier.com/S0956-7135(13)00535-5/sref42http://refhub.elsevier.com/S0956-7135(13)00535-5/sref42http://refhub.elsevier.com/S0956-7135(13)00535-5/sref42http://refhub.elsevier.com/S0956-7135(13)00535-5/sref42http://refhub.elsevier.com/S0956-7135(13)00535-5/sref43http://refhub.elsevier.com/S0956-7135(13)00535-5/sref43http://refhub.elsevier.com/S0956-7135(13)00535-5/sref43http://refhub.elsevier.com/S0956-7135(13)00535-5/sref43http://refhub.elsevier.com/S0956-7135(13)00535-5/sref44http://refhub.elsevier.com/S0956-7135(13)00535-5/sref44http://refhub.elsevier.com/S0956-7135(13)00535-5/sref45http://refhub.elsevier.com/S0956-7135(13)00535-5/sref45http://refhub.elsevier.com/S0956-7135(13)00535-5/sref45http://refhub.elsevier.com/S0956-7135(13)00535-5/sref45http://refhub.elsevier.com/S0956-7135(13)00535-5/sref46http://refhub.elsevier.com/S0956-7135(13)00535-5/sref46http://refhub.elsevier.com/S0956-7135(13)00535-5/sref46http://refhub.elsevier.com/S0956-7135(13)00535-5/sref46http://refhub.elsevier.com/S0956-7135(13)00535-5/sref47http://refhub.elsevier.com/S0956-7135(13)00535-5/sref47http://refhub.elsevier.com/S0956-7135(13)00535-5/sref47http://refhub.elsevier.com/S0956-7135(13)00535-5/sref47http://refhub.elsevier.com/S0956-7135(13)00535-5/sref48http://refhub.elsevier.com/S0956-7135(13)00535-5/sref48http://refhub.elsevier.com/S0956-7135(13)00535-5/sref48http://refhub.elsevier.com/S0956-7135(13)00535-5/sref48http://refhub.elsevier.com/S0956-7135(13)00535-5/sref49http://refhub.elsevier.com/S0956-7135(13)00535-5/sref49http://refhub.elsevier.com/S0956-7135(13)00535-5/sref49http://refhub.elsevier.com/S0956-7135(13)00535-5/sref49http://refhub.elsevier.com/S0956-7135(13)00535-5/sref49http://refhub.elsevier.com/S0956-7135(13)00535-5/sref50http://refhub.elsevier.com/S0956-7135(13)00535-5/sref50http://refhub.elsevier.com/S0956-7135(13)00535-5/sref50http://refhub.elsevier.com/S0956-7135(13)00535-5/sref50http://refhub.elsevier.com/S0956-7135(13)00535-5/sref51http://refhub.elsevier.com/S0956-7135(13)00535-5/sref51http://refhub.elsevier.com/S0956-7135(13)00535-5/sref51http://refhub.elsevier.com/S0956-7135(13)00535-5/sref52http://refhub.elsevier.com/S0956-7135(13)00535-5/sref52http://refhub.elsevier.com/S0956-7135(13)00535-5/sref53http://refhub.elsevier.com/S0956-7135(13)00535-5/sref53http://refhub.elsevier.com/S0956-7135(13)00535-5/sref53http://refhub.elsevier.com/S0956-7135(13)00535-5/sref53http://refhub.elsevier.com/S0956-7135(13)00535-5/sref54http://refhub.elsevier.com/S0956-7135(13)00535-5/sref54http://refhub.elsevier.com/S0956-7135(13)00535-5/sref54http://refhub.elsevier.com/S0956-7135(13)00535-5/sref54http://refhub.elsevier.com/S0956-7135(13)00535-5/sref54http://refhub.elsevier.com/S0956-7135(13)00535-5/sref55http://refhub.elsevier.com/S0956-7135(13)00535-5/sref55http://refhub.elsevier.com/S0956-7135(13)00535-5/sref55http://refhub.elsevier.com/S0956-7135(13)00535-5/sref55http://refhub.elsevier.com/S0956-7135(13)00535-5/sref55http://refhub.elsevier.com/S0956-7135(13)00535-5/sref56http://refhub.elsevier.com/S0956-7135(13)00535-5/sref56http://refhub.elsevier.com/S0956-7135(13)00535-5/sref56http://refhub.elsevier.com/S0956-7135(13)00535-5/sref57http://refhub.elsevier.com/S0956-7135(13)00535-5/sref57http://refhub.elsevier.com/S0956-7135(13)00535-5/sref57http://refhub.elsevier.com/S0956-7135(13)00535-5/sref57http://refhub.elsevier.com/S0956-7135(13)00535-5/sref57http://refhub.elsevier.com/S0956-7135(13)00535-5/sref58http://refhub.elsevier.com/S0956-7135(13)00535-5/sref58http://refhub.elsevier.com/S0956-7135(13)00535-5/sref58http://refhub.elsevier.com/S0956-7135(13)00535-5/sref58http://refhub.elsevier.com/S0956-7135(13)00535-5/sref59http://refhub.elsevier.com/S0956-7135(13)00535-5/sref59http://refhub.elsevier.com/S0956-7135(13)00535-5/sref59http://refhub.elsevier.com/S0956-7135(13)00535-5/sref59http://refhub.elsevier.com/S0956-7135(13)00535-5/sref60http://refhub.elsevier.com/S0956-7135(13)00535-5/sref60http://refhub.elsevier.com/S0956-7135(13)00535-5/sref61http://refhub.elsevier.com/S0956-7135(13)00535-5/sref61http://refhub.elsevier.com/S0956-7135(13)00535-5/sref61http://refhub.elsevier.com/S0956-7135(13)00535-5/sref62http://refhub.elsevier.com/S0956-7135(13)00535-5/sref62http://refhub.elsevier.com/S0956-7135(13)00535-5/sref62http://refhub.elsevier.com/S0956-7135(13)00535-5/sref62http://refhub.elsevier.com/S0956-7135(13)00535-5/sref63http://refhub.elsevier.com/S0956-7135(13)00535-5/sref63http://refhub.elsevier.com/S0956-7135(13)00535-5/sref63http://refhub.elsevier.com/S0956-7135(13)00535-5/sref64http://refhub.elsevier.com/S0956-7135(13)00535-5/sref64http://refhub.elsevier.com/S0956-7135(13)00535-5/sref64http://refhub.elsevier.com/S0956-7135(13)00535-5/sref64http://refhub.elsevier.com/S0956-7135(13)00535-5/sref65http://refhub.elsevier.com/S0956-7135(13)00535-5/sref65http://refhub.elsevier.com/S0956-7135(13)00535-5/sref65http://refhub.elsevier.com/S0956-7135(13)00535-5/sref66http://refhub.elsevier.com/S0956-7135(13)00535-5/sref66http://refhub.elsevier.com/S0956-7135(13)00535-5/sref66http://refhub.elsevier.com/S0956-7135(13)00535-5/sref66http://refhub.elsevier.com/S0956-7135(13)00535-5/sref67http://refhub.elsevier.com/S0956-7135(13)00535-5/sref67http://refhub.elsevier.com/S0956-7135(13)00535-5/sref67http://refhub.elsevier.com/S0956-7135(13)00535-5/sref67

A barcode for the authentication of the snappers (Lutjanidae) of the western Atlantic: rDNA 5S or mitochondrial COI?1 Introduction2 Material and methods2.1 Samples2.2 Isolation, amplification, and sequencing of the genetic material2.3 Analyses2.3.1 Banding pattern – rDNA 5S/NTS2.3.2 The mitochondrial COI gene

3 Results3.1 rDNA 5S/NTS gene3.2 Mitochondrial COI gene

4 Discussion4.1 rDNA 5S bands or COI sequences?4.2 Using COI sequences to authenticate lutjanids

AcknowledgementsReferences

A barcode for the authentication of the snappers (Lutjanidae) of...

Documents

Transcript of A barcode for the authentication of the snappers (Lutjanidae) of...