76.080-012611

EVENTSMen’s Basketball Game The Cougars are facing o! against the Rice Owls today in a hotly-anticipated confer-ence game. The game starts at 8 p.m. at Tudor Fieldhouse.

And Freedom For All Cougar Voices is putting on a Martin Luther King, Jr., photo documentary on the third " oor of the M.D. Anderson Library. This event will take place until Jan. 31.

FOR MORE EVENTS, CHECK OUTthedailycougar.com/calendar

THE DAILY COUGARTHE DAILY COUGAR®®

t h e o f f i c i a l s t u d e n t n e w s p a p e r o f t h e u n i v e r s i t y o f h o u s t o n s i n c e 1 9 3 4t h e o f f i c i a l s t u d e n t n e w s p a p e r o f t h e u n i v e r s i t y o f h o u s t o n s i n c e 1 9 3 4Issue !", Volume #$

WednesdayJanuary !", !#$$

newslineLAW SCHOOLPre-law event to help students learn more about law school

A free pre-law event Thursday from noon to 4 p.m. in the UC Houston room will provide panels and speakers about law school admissions and # nancial aid.

Law school representatives from 20 schools around the country will be available all day to answer questions and provide information about their schools.

Additionally, three LSAT prep companies will help unravel the test and provide information about the various types of prep options.

Attendees can register at uhprelawday.eventbrite.com for a free gift, and a chance to win a $50 Visa card or LSAT prep books.

STUDENT GOVERNMENTUpcoming meeting for student elections information

UH’s Student Government Association is holding a special ses-sion today to address the upcoming SGA elections that will elect student representatives for the 2011-2012 school year.

The Senate is scheduled to elect a third election commissioner to oversee elections later this semester. Senators are also looking to pass revisions to the election code, along with a # nalized calendar of events for the elections.

“If there are any students interested in running, this would be a really great meeting for them to attend,” SGA Public Relations Director Mila Clark said.

The meeting is scheduled to begin at 7 p.m in the Cougar Den, located on the bottom " oor of the University Center, and run through 11 p.m. Clark does not anticipate it to run the full length of time allotted.

For more information, visit www.uh.edu/sga.

CORRECTIONSReport errors to [email protected]. Corrections will !!

appear in this space as needed.

thedailycougar.com @thedailycougar facebook.com/thedailycougar Read. Recycle. Repeat daily.

HIHI 6611 LO 32today

THU

62/38

FRI

65/43

SAT

68/53

SASASASATT SUN

63/47

SUSUSUSUNN

Got news? E-mail [email protected] or call 713-743-5314

Sweeney keeps it classysports

Not as nice as Tuesday, but not as bad as Monday!

Edgar VelizTHE DAILY COUGAR

The legacies of Dr. Martin Luther King, Jr. and Mahatma Gandhi were recalled and reflected upon at an event on Tues-day, which featured UH President Renu Khator.

The event, “From Gandhi to King: The Globalization of a Dream,” aimed to honor the two men, their lessons and their accom-plishments and impact on society, both globally and locally.

King’s “I have a Dream” speech played in the background as UH faculty, staff, students and alumni entered the Houston Room in the University Center. Attendees were also encouraged to view the “And Free-dom For All” photo documentary, which

chronicled the 1963 March on Washington for Jobs and Freedom.

Khator addressed the attendees on the legacies of King and Ghandi.

“Both men had great faith in their les-sons, ” Khator said. “It is a very special occasion when we all come together and reflect upon the lessons that we’ve learned and the messages that we’ve received, and how we can follow that advice and those lessons.”

Khator shared her story of meeting Gandhi’s grandson, and then addressed the impact she felt current students would have. Citing them as “the future,” Khator said that the world will be what the students make it.

The UH Forensic Team addressed the non-violent methods used by both King and Gandhi.

“Non-violence is a powerful and just weapon...which cuts without wounding and

Communication construcion began over a year ago and is ex-pected to ! nish by the summer. | Paris Jomadiao/The Daily Cougar

Before the ceremony honoring Martin Luther King and Ghandi began, students viewed a photo docu-mentary chronicling the 1963 march on Washington. | Nine Nguyen/The Daily Cougar

Lauren MathisTHE DAILY COUGAR

While safety and electrical con-cerns that have arisen from the construction in the communica-tions building have been solved,

one official said technology funds are being diverted towards the remodeling.

Money that should be going to upgrade the technology and software in the Communications

Building’s courtyard and breezeway went dark after some electrical problems caused by remodeling

Unexpired term given, reselection may follow

Khator opens the ceremony, debate team member follows

COMMUNITY

Khator chosen for open district

Darlene CamposTHE DAILY COUGAR

The Federal Reserve Board of Governors in Washington D.C. appointed Renu Khator, UH presi-dent and chancellor, to the Federal Reserve Bank of Dallas for a posi-tion with the board of directors.

“She will serve an unexpired portion of a three-year term end-ing Dec. 31, 2011,” Richard Bonnin, executive director of media rela-tions and Khator’s representative at UH, said.

The Federal Reserve Bank of Dallas is among 12 different reserve banks within the United States Fed-eral Reserve System.

“She is eligible for reappoint-ment to a full three-year term at the conclusion of the unexpired term,” Bonnin said.

The Federal Reserve Bank of Dallas currently serves the Eleventh Reserve District.

This district contains the entire state of Texas, the northern area of Louisiana, and the southern area of New Mexico, according to the Dallas Federal website.

The bank also has branches in El Paso, Houston and San Antonio.

STUDENTS

CONSTRUCTION

Legends recognized through art

Money pulled from updates

KHATOR continues on page 3 SPEECH continues on page 3

CUTS continues on page 3

www.mba.uh.edu C. T. Bauer College of Business is an AACSB accredited business school.

The University of Houston is an Equal Opportunity/Af!rmative Action institution.

Unmatched Faculty Excellence.Outstanding MBA Program.Expert in corporate !nance, investments and contract theory.

Widely published in leading !nance and economics scholarly journals.

Recognized, reputable thought leader for local, national and international media.

Dr. Praveen KumarProfessor of Finance

For 40 years, The University of Texas School of Public Health hasbeen protecting and transforming the health of people in Texas, acrossthe nation and around the world. Visit www.sph.uth.tmc.edu to discover more reasons to choose The University of Texas School ofPublic Health and benefit from the best in public health.

MPH • MS • DrPH • PhD

• Best value among top 10 schools of public health• 13 dual degree and 4 graduate certificate programs• #1 ranked program in health promotion• World-class research in genetics and disease prevention

One School. Six Campuses. Endless Opportunities.

Houston Austin Brownsville Dallas El Paso San Antonio

THE UNIVERSITY OF TEXAS SCHOOL OF PUBLIC HEALTH

APPLICATION DEADLINES:

Fall 2010 _ April 1 Spring 2011 _ August 1

2 ! Wednesday, January !", !#$$ ONLINE The Daily Cougar

ISSUE STAFF

ABOUT THE COUGAR The Daily Cougar is published Monday through Friday during the fall and spring semesters, and Tuesday and Thursday during the summer, at the University of Houston Printing Plant and online at http://www.thedailycougar.com. The University seeks to provide equal educational opportunities without regard to race, color, religion, national origin, sex, age, disability or veteran status, or sexual orientation. The Daily Cougar is supported in part by Student Service Fees. The ! rst copy of the Cougar is free; each additional copy is 25 cents.

SUBSCRIPTIONS Rates are $70 per year or $40 per semester. Mail subscription requests to: Mail Subscriptions, The Daily Cougar, University of Houston, Houston, TX, 77204-4015.

NEWS TIPS Direct news tips and story ideas to the News Desk. Call (713) 743-5314, e-mail [email protected] or fax (713) 743-5384. A “Submit news item” form is also available online at thedailycougar.com.

COPYRIGHT No part of the newspaper in print or online may be reproduced without the written consent of the director of the Student Publications Department.

!"Copy editing Bethel Glumac, Natasha Faircloth!"Production Ben Muths!"Closing editor Jack Wehman

Newsroom(713) 743-5360!"Editor in ChiefJack Wehman(713) [email protected]!"Layout EditorChristopher [email protected]!"Multimedia EditorNewton Liu(713) [email protected]!"News EditorsJose AguilarCristi Guerra(713) [email protected]

!"Sports EditorsJohn BrannenJoshua Siegel(713) [email protected]!"Life & Arts EditorMary Baak(713) [email protected]!"Opinion EditorAndrew [email protected]!"Web EditorMatthew [email protected]

Advertising(713) [email protected]!"Classi! eds(713) 743-5356classi! [email protected]

Business Office!"Phone (713) 743-5350!"Fax (713) 743-5384!"Mailing addressRoom 7, UC SatelliteStudent PublicationsUniversity of HoustonHouston, TX 77204-4015

contact us:

online The best stu! from our website, comments and blogs. See what you’re missing: thedailycougar.com

TOP READSTaurus or Aries: Has your astrologi-1. cal sign actually changed?Carnegie report designates UH a 2. ! agship universityArab students face racism, prejudice3. Cut salaries, not student programs4. ‘No Strings Attached’ grabs No. 1 5. spot in weekend box o" ce

FEATURED COMMENTSRe: Wal-Mart not welcome, says Heights community

“I have been following this whole story and am stunned, ABSOLUTELY STUNNED, at the City’s complete disregard for it’s citizens. Are we not voters and tax payers? This is a disgrace. I voted for Ed and the Mayor but not again. No way, no how. I thought Mayor Parker would work for our neighborhoods and all she has done is let us down.”

— user “HeightsResident”

Re: Wal-Mart not welcome, says Heights community

“The developer’s Traffic Impact Analysis (TIA) states that the main intersection serving this gigantic Walmart will FAIL even before the store is built. What’s that mean in developer-speak? ‘It’s already broken so Walmart traffic won’t make a difference! And, BTW, we’re not paying to fix

it, either.’Oh and let’s not forget, their TIA totally forgot to mention that the historic Yale St. bridge between the IH-10 and the site isn’t capable of handling loaded 18-wheelers. Uh, woops? Sorry your bridge collapsed! Where is CM Gonzalez in all of this? Lunching with the Mayor, apparently, cause he ain’t helping his constituents.”

— user “VotingHimOut ”

Re: Abortion legislation not necessary or advised

“Forcing women to listen to anything or anyone and do anything with respect to their bodies is a violation of their civil rights. Why do we allow political extremists to pass state laws just to make each other look stupid ...knowing all along the law won’t survive a U.S. Constitutional challenge in federal court...especially the SCOTUS?! European government forcing their residents to do something they didn’t want to do without discussion and debate is why we created this country in the first place. Great editorial.”

— user “@GPackwood”

11991 Main St. 713-723-097310650 SW Plaza Ct 713-981-6814

Daily, Weekly & Monthly rentals available!

NO LEASE REQUIRED!

RENT ME!

Read. Then recycle.

The Daily Cougar NEWS Wednesday, January !", !#$$ ! 3

Technology Center is being redi-rected to the construction, Shawn McCombs, manager of the CTC, said.

“To my understanding they don’t have any money to buy new equip-ment for the new studios either,” McCombs said. “What I’ve been told is that whatever equipment we had before is the same equipment that’s going back downstairs (into the studios).”

Still, McCombs said that the remodel program is in progress.

“We are putting major con-struction and renovation here in the department,” McCombs said. “No matter how you look at it, it’s

progress and it’s going in a good direction — and I think in the long run it’s going to help better our school, for our students and the community.”

To reassure students and fac-ulty that the Valenti project will be completed and won’t interfere with funding for other projects, Beth Olson, associate professor for the Jack J. Valenti School of Com-munication, commented on the project.

“The construction will be com-pleted and it is scheduled for May 2011,” Olson said. “The budget for this project has been tight since the start; however, we are making significant cost-effective improve-ments to the building, which will have a huge impact.

“We continue to seek additional

funding for a few items, such as tile finishes. I’m optimistic those funds will be found.”

As for issues concerning tech-nology upgrades in the CTC, Olson said that the building’s construc-tion hasn’t stopped upgrades in the CTC lab.

“The equipment upgrades, namely in the computer classrooms and labs, are on a rolling replace-ment schedule,” Olson said. “The only upgrade we’ve chosen not to do this year is a software update, which I’m told won’t affect the majority of our students.”

Advisors and classes have been moved to other locations, causing some frustration among students.

“I can’t wait for it to be over,” Christine Pegg, a communications graduate student, said. “I began my

program last semester and I just can’t wait to see the building back to normal.”

Last week, after her late after-noon and evening classes, Pegg noticed an electrical problem that made her return to school this semester less exciting.

“During the first week of school, the lights were out the first two nights in the construction area (communication breezeway and courtyard),” Pegg said. “I was scared because it was very dark and I felt it was very dangerous for students who take classes at night. But they did fix the lights by the time we got out of class on the second night, so that was good.”

UHPD was quickly alerted to the electrical problems and safey issues that the construction area

was facing.“I spoke with the Facilities

Planning and Construction proj-ect manager and he advised that while there was a short period that walkway lights by the construction area were not functioning prop-erly, they should be now,” UHPD Lt. Brett Collier said. “Our police and security officers are cognizant of construction areas around cam-pus and are instructed to increase patrols in areas where lighting is diminished.

“I’ve asked our patrol operations lieutenant to take a look at the area after dark and see if we need to rec-ommend lighting enhancements to the area while the project is under-way,” Collier said.

[email protected]

CUTScontinued from page 1

The main function of the bank is to work to keep a stable economy in this part of the country.

There are 12 Federal Reserve Banks in the United States; each one is composed of nine members on the board of directors.

Of these nine members, three serve to represent the commercial banks, three more serve to rep-resent the public’s interests and the last three members must be appointed by the Boards of Gover-nors in Washington, D.C., in order to serve.

Khator’s Jan. 13 appointment is among the last of the board of directors for the Federal Reserve Bank of Dallas.

“I am honored to receive this appointment, and I am proud to serve in this position that offers a major role in the supervision and regulation of the US banking system,” Khator said in a UH press release by Richard Bonnin.

For more information on the Federal Reserve Bank of Dallas, please visit www.dallasfed.org.

[email protected]

KHATORcontinued from page 1

ennobles the man who wields it.” Team member Lee Arnold read

aloud this quote from King before defining what the quote meant then, and essentially now.

“What Dr. King was expressing during his life — during the 1950s and 1960s, dealing with the riots, boycotts, the hatred and racism — was that we as Americans, not just

white, black or otherwise, can come together and sit at the table of love and brotherhood.”

Arnold also addressed the issue of education, in regards to achiev-ing more than just an education in the classroom.

“Dr. King emphasized that edu-cation was essential in our daily lives,” Arnold said. “Education is essential at every level, young and old. We should entice ourselves to become more educated, not just from what we are taught in the

classroom, but the lessons that life will provide us.”

Gandhi’s religious tolerance and King’s religious values concluded the presentation with a message about looking at not only the mes-senger, but also the message itself.

“We have come here to recognize the importance of a man (King),” Arnold said. “But the importance is not just the man. It’s the message that he spoke to us.”

[email protected]

SPEECHcontinued from page 1

4 ! Wednesday, January !", !#$$ The Daily Cougar

STAFF EDITORIAL

In an economy and job market that have seen better days, we find it inspiring that President Barack Obama chose to focus not on the next elections or partisanship, but on the future of the country, turning the State of the Union into the state of our futures.

“At stake right now is not who wins the next election … At stake is whether new jobs and industries take root in this country, or somewhere else. It’s whether the hard work and industry of our people is rewarded,” Obama said.

We hope that his message will reach those in Austin who wish to not only stunt, but squash the level of progress that has been made by the University and six fellow universities that are hoping to increase the number of flagship insti-tutions Texas has to offer.

For years, the faculty, students, administra-tion and staff at UH have worked together to build the various programs here, and the recent Tier One designation by the Carnegie Foundation shows that our community has been working hard. That hard work should be rewarded not punished.

Obama pointed out that, “because it’s not always profitable for companies to invest in basic research, throughout history our government has provided cutting-edge scientists and inventors with the support that they need.”

Our government has also provided support to the institutions that produce the next generation of scientists and inventors.

The president asked Congress and the Ameri-can people to invest in making the US and its students the world leaders in innovation — to believe in American ingenuity and the youth of America once again. We ask that the Texas Legis-lature also believe.

We ask those in Austin intent on cutting dis-proportionately the levels of funding afforded to the state’s public institutions believe in the inno-vation that is happening here at UH and other universities; in community colleges, as small as they may be; and in the mind of the student who receives that financial aid check.

That belief will not only benefit the state, but the entire nation.

Obama: support US scientists and researchers

STAFF EDITORIAL The Sta! Editorial re" ects the opinions of The Daily Cougar Editorial Board (the members of which are listed above the editorial). All other opinions, commentaries and cartoons re" ect only the opinion of the author. Opinions expressed in The Daily Cougar do not necessarily re" ect those of the University of Houston or the students as a whole.

LETTERS TO THE EDITOR The Daily Cougar welcomes letters to the editor from any member of the UH community. Letters should be no more than 250 words and signed, including the author’s full name, phone number or e-mail address and a# liation with the University, including classi$ cation and major. Anonymous letters will not be published. Deliver letters to Room 7, University Center Satellite; e-mail them to [email protected]; send them via campus mail to STP 4015; or fax them to (713) 743-5384. Letters are subject to editing.

ADVERTISEMENTS Advertisements published in The Daily Cougar do not necessarily re" ect the views and opinions of the University or the students as a whole.

GUEST COMMENTARY Submissions are accepted from any member of the UH community and must be signed with the author’s name, phone number or e-mail address and a# liation with the University, including classi$ cation and major. Commentary should be kept to less than 500 words. Guest commentaries should not be written as replies to material already printed in the Cougar, but rather should present independent points of view. Rebuttals should be sent as letters. Deliver submissions to Room 7, University Center Satellite; e-mail them to [email protected]; or fax them to (713) 743-5384. All submissions are subject to editing.

THE DAILY COUGARE D I T O R I A L B O A R DEDITOR IN CHIEF Jack WehmanMANAGING EDITORS Newton Liu, Christopher LoseeNEWS EDITORS Jose Aguilar, Cristi GuerraSPORTS EDITORS John Brannen, Joshua SiegelLIFE & ARTS EDITOR Mary BaakOPINION EDITOR Andrew Taylor

E D I TO R I A L P O L I C I E S

opinion EDITOR Andrew TaylorE-MAIL [email protected] www.thedailycougar.com/opinion

T exas is struggling to keep things in order. The budget shortfall for the state of Texas in the next two-year

period is projected to be as high as $27 billion. The Republican-dominated gov-ernment has stood fi rm on their pledge

to refrain from any new taxes, and cutting programs or services doesn’t seem to be an option.

If the government does in fact begin to cut across the board, what

will they cut from? Education accounts for 41 percent of the current budget, with health and human services following close behind at 32.

That’s almost three quarters of the 2010-2011 budget tied up in two extremely important services. According to Moak, Casey & Associates, a school fi nance-consulting fi rm, the draft budget assumes no new taxes and over the next two years will take 9.8 billion dollars from schools — and could potentially cost the

jobs of 100,000 school district employees. In addition to these atrocious cuts to

the public schools, Medicaid is likely to take a large hit due to the budget crisis. According to Chris Tomlinson of the Associated Press, “Hospitals and doctors will likely absorb the 2.8 billion the state plans to cut from Medicaid programs. The state is also considering reducing what it pays doctors and hospitals to treat Med-icaid patients by 10 percent.” These cuts are taking place in some of the most vital areas of state services, and there has to be a more reasonable way to start hacking away at the defi cit.

Although one solution to this problem may seem like an outrageous idea, it is a common act. It’s called an income tax. Texas is one of seven states that does not have an income tax. While going as far as the 11 percent income tax in Hawaii is unnecessary and steep, a progressive income tax, where the rates grow as income grows, is a very reasonable option.

Granted, there should be a limit on how much someone pays. For example,

if you make more than $100,000 per year, your rate would only increase as high as that fi rst $100,000. While the income tax seems like a plausible solution, there is one drawback.

The Texas Constitution does not allow an income tax. In order for a state income tax to become a reality, a variety of votes must occur. Additionally, according to the constitution, “The legislature may provide for the taxation of income in a manner which is consistent with federal law.”

And if such taxes were to be put in place, after a certain length of time, according to Section 24 G. of the Texas constitution, “The remaining money after the dedication of money from the tax shall be used to support education.” Now, even though Texas doesn’t have an income tax, it is possible under the constitution. What’s more important? Saving your home state, or saving a small percent of money?

Travis Gumphrey is a journalism sophomore and may be reached at [email protected].

O ur campus is known for having a diverse student body. If you look around campus or walk

through the PGH Breezeway, it would be difficult not to notice the different student organizations that are holding fundraisers; of those organizations, there are several that pertain to religion.

A significant per-centage of students would agree that religion is a very important part of their life; it is what gets them through the day and makes up the foundation of who they are.

However, in the United Kingdom, Baroness Warsi, co-chairman of the Conservative Party, recently gave a speech discussing how prejudice against

Muslims is “seen as normal.” She warned that it is now seen as socially acceptable to openly talk about Muslims in a negative way. She mentioned that citizens and politicians alike are catego-rizing Muslims in the UK as extremists. Warsi intends to call this problem out and to inform them that this behavior is not acceptable.

The UK faces a difficult and sensi-tive problem: they have a far larger population of South Asians and Middle Easterners living in their country, but have yet to realize how their open preju-dice is offensive and hurtful.

The UK’s behavior, if not dealt with properly, could influence other countries to also accept social behavior against religions.

The British could possibly be catego-rizing Muslims as extremists because

they do not really understand Islam or the politics of Middle Eastern countries well enough. The culprit of ignorance may be fear.

In order to reduce open prejudice and to prevent it from happening any-where else, especially here on campus, it’s important to learn more about other religions.

UH offers many courses on religious studies. It wouldn’t hurt to go up to the religious organizations and ask for information or start a conversation; they are dedicated to educating their peers.

Not everyone has to live in fear of persecution, nor should they remain uneducated. Prejudice is preventable.

Margarita Campos is a creative writing sophomore and may be reached at [email protected].

The solution to our deficit is taxing

Knowledge is the cure to racial prejudice

TravisGumphrey

MargaritaCampos

AND YOU THOUGHT THEY WOULDN’T ADDRESS THE ISSUES courtesy of USBICEF

Recycle this paper.

MEN’S BASKETBALL

PLAYER PROFILE

UH looks to put clamp down on lowly Rice

Dual-sport athlete has character to boast

Joachim ClarkeTHE DAILY COUGAR

The Cougars begin a two-game road trip today but do not have to leave the city for tonight’s game against Rice.

Since the two teams began playing each other in 1971, the Cougars (11-7, 3-2 Conference USA) have dominated the Owls with a 57-14 record in the all-time series. UH has not lost to Rice since a 76-71 defeat on Jan. 17, 2007.

Senior guard Adam Brown — who averages 14.9 points a game — will lead the Cougars’ offensive attack.

“Playing Rice isn’t like playing another opponent,” Brown

said. “We’re playing against history itself because of the rivalry. We have to make everyone proud. Not just ourselves, but our coaches, fans and past players from the University.”

The Owls (9-10, 1-4) rank last in C-USA, and are the only team in the conference with fewer than 10 wins.

Despite a poor winning percentage, the Owls have an impressive arsenal of weapons at their disposal. Guard Tamir Jackson averages 12.7 points while shooting .353 from behind the arc. But more importantly, UH will have to contain sopho-more forward Arsalan Kazemi who averages 16.3 points per game.

Senior guard Zamal Nixon knows that shutting down Kazemi will key their success.

“Kazemi has come into his own this year,” Nixon said. “Jackson is also a really good guard. So we’re going to have to do a good job on those two, and hopefully we’ll come out victorious.”

Head coach James Dickey said that the players will need to keep their focus on the prize in order to secure the victory.

“It’s obviously a rivalry game, but it’s also a road conference game,” Dickey said. “That’s the way we have to approach it.”

The game tips off at 8 p.m. tonight at Tudor Fieldhouse. The game will be televised on Comcast Sports Southwest (Ch. 129) and will be broadcast on 790 AM KMBE.

[email protected]

John BrannenTHE DAILY COUGAR

At the 2008 UIL state track meet, spectators already knew that Isaiah Sweeney was fast. What they discovered was that he is just as gritty as he is athletic.

In 2007 Sweeney was a member of the Hightower 4x200-meter relay team that shattered the national record with a 1 minute, 23 second split. Fans were expecting a similar perfor-mance in 2008.

Sweeney had just fi nished completing the 100-meter dash when he had to hop back on the track as the fi rst leg of the relay.

“Right after you fi nish the 100, they hand you the baton to run the 4x2,” Sweeney said. “It was a little bit too quick in between.”

Soon after the races started, Sweeney’s leg tightened up and started cramping.

“It happened at the top of the curb, right as I was getting to the straightaway,” he said.

Most athletes would not have fi nished the race. But Sweeney felt indebted to the fans that made the trip to Austin.

“I hopped on one leg all the way until I passed the baton,” he said. “The fans always came to support me and watch me run. They came all the way to Austin, so the least I could do was fi nish the race for them and not give up.”

Sweeney is currently one of the busier student-athletes on campus as a member of both the football and track teams. He is also successful in the classroom, having made the Dean’s List last semester with a minimum GPA of 3.5.

He received the most playing time of his career in 2010, play-ing in three contests and catching six passes for 95 yards and two touchdowns. With the departures of senior receivers James Cleveland and Kierrie Johnson, Sweeney could be featured more in the offense next season.

“I’m just looking to get in where I fi t in,” Sweeney said. “I’ll fi nd any time on the fi eld I can possibly get. From special teams, to catching balls, returning or blocking punts — any way to get on the fi eld.”

With little training, Sweeney was the High Point Scorer at the 2010 Outdoor Conference USA Championship, earning wins in the long jump and 200-meter dash. He was the runner-up in the 100-meter dash, and helped UH place second in the 4x100-meter relay.

“It was kind of rough starting off with track, then going to spring football,” he said. “I fell behind on my endurance and speed. Coming back to track, I ran one meet before the C-USA meet. Being the high-point scorer, I just saw the goal.

“I had my eyes on the prize, I cleared my mind and said ‘no

excuses.’ Football can’t be an excuse.”Through two meets in the indoor season, Sweeney has run

a 6.80-second split and a 6.87. With only a brief training period, Sweeney feels he is on the right path.

“It’s been a good start considering I’ve only had a few weeks of track practice. It was a good start, but nowhere near where I want to be, but it was a good start. I’m looking to drop a tenth of a second off. I’ll try to get faster these next few weeks and catch up to where everyone else has been.”

Sweeney and the Cougars will resume competition this week at the Houston Indoor Invitational Friday and Saturday at Yeo-man Field House.

[email protected]

Isaiah Sweeney is a double threat in track and ! eld as one of the team’s best sprinters and long jumpers. Sweeney is also a wide receiver and special teams returner for the football team. | Courtesy of UH Athletics

The Daily Cougar SPORTS Wednesday, January !", !#$$ ! 5

WAITSTAFFFollow Us on Twitter: FlyingSaucerHou

classifiedsEgg Donors Needed. Ages 21-32.

Earn $5,000+, High demand for Asians. Surrogate Mothers Needed.

Earn $25,000+, Ages 21-39.(713) 771-9771

www.cooperinstitutearm.comemail : [email protected]

Looking for a NEW Apartment?Free Apt Locating Service!$500 REBATE! FREE MOVE!

Classifieds for Roommates & Sublets!Call now to start your search today!

1-866-933-4878ApartmentGURUS.Com

Unit Marketing Director position open part-time, full time apply in person at Chick-fil-A at

Northwest Crossing FSU13240 Northwest Freeway

Houston, TX 77040Telephone 713-462-7698

8.00Spectrum of Hope employment

opportunity available for intelligent, dedicated, mature,

committed, purposeful individuals who have the desire to change the lives of children & their families living with autism. Great experience for individuals

with Psychology, Social Work, Education and Speech

communication majors. Contact KJ Whitman at 281-894-1423

or spectrumofhope.com

Spanish and Mandarin Teachers

needed between the hours of 3-6pm. Areas include:

River Oaks, Medical Center, Sugarland, Missouri City, Spring Branch/Memorial, The Heights

and Spring. Strongly prefer at least 1 year of teaching

experience. EXCELLENT English and native speaker of Spanish or Mandarin. Eligible to work in the US. No J1 or F1’s. $25 an hour for degreed teachers, and $20 an hour for those working

towards a degree. Submit a resume AND a cover letter to

[email protected]

Egg Donors Needed! Compensation $5,000-$7,000. Must be: non-smoker, healthy, BMI within normal ranges, and between 19-30 years old. Visit

www.fertilityresourceshouston.com or call 713 783 7044 for more

information and to fill out a preliminary application.

Fertility Resources of Houston

WestburyChurch of Christ

1024 Hillcroft

713-729-7880www.westburycocc.com

Sunday Worship9:00 a.m., 5:00 p.m.

Bible Class10:30 a.m.Wednesday7:00 p.m.

CATHOLIC MASS ON CAMPUS

CATHOLIC NEWMAN CENTER

Ofce # (713) 748-2529

Now Hiring College Sales Agents for goWiFi to sell wifi to local businesses. Earn up to $115 per sale in as little as 15 minutes and make your own hours. Seeking motivated students looking to build business skills, improve resume, and make money. No experience neces-sary. Contact [email protected] or visit www.gowifi.com for more information.

HELP WANTEDHELP WANTED HELP WANTED

HELP WANTED

HELP WANTED

BULLETIN BOARD

worship directory

RENTALS

RENTALS

MINUTES FROM UHPROF/STAFF/STUDENT PREFERREDNice & Quiet. Studio $290; 1-1 $360; 2-1 1/2 $650; Plus Utilities, New Appl,

Center A/H, W/D, Ceiling Fan, A/C, Fenced, No pets. Furnish Optl.

Available Immediately!713-834-4209.

Wheeler Avenue Baptist Church3826 Wheeler Avenue

Houston, Texas 77004-2604713.748.5240

Worship Services7:15a.m., 9:00a.m., 11:00a.m. & 1:00p.m.

Wednesday, Bible Study: 12 noon & 7:00p.m.Rev. Dr. Marcus D. Cosby, Pastor

Rev. William A. Lawson, Pastor EmeritusSunday Services via webcast:

www.wheeleravebc.org

!BARTENDING! up to $300 a day, no exp necessary, training provided. 18+ ok. 800-965-6520 ext.145

2 BDRM,1 Bath, $950/mo,1 BDRM,1Bath, $500/mo, located 5 min from UH. 713-928-8900.

v2B,21/2 bath,2 story, 2 carport,free water,free basic cable,free waste pick-up 713 966 9793

1 bdrm, off street parking, washer/dryer, remodel bathroom, ceiling fans, hardwood floors and central heat/ac $500 deposit. [email protected]

Furnished Private Rooms in a Small, Private Dorm. Wi-fi, laundry, kitchen privileges, game room, 4 blocks to bus, off street parking. $400 mo. Call Phu.....832-875-8890

CASHIERS AND COOKS NEEDED. 5510 Morningside Drive in Rice Village. Flex hours. Hourly+tips. Exp a must. 713-526-5551 Apply in person

NANNY NEEDED. $10/hr. Children 10 & 6 yrs. Must have reliable transpor-tation. Light housework. Flexible hours. references & experience required. Call for interview. 832-563-5783

MONTESSORI SCHOOL in Museum dis-trict. Looking for Subs/Assts. Flex hrs. Excellent for child dev, Education or Psy majors! Call 713-520-0738

PART TIME HOUSEKEEPER needed. Small apt. 2 days/wk, 2 hrs/day. Galle-ria Area. $50/week. Flexible hrs. Brian Peskin 713-298-8783

*STUDENTPAYOUTS.COM* PAID survey takers needed in Houston. 100 percent FREE to join! Click on Surveys.

6 ! Wednesday, January !", !#$$ LIFE&ARTS The Daily Cougar

playlistplaylist » » Sta! picks: Multimedia Editor

O ur multimedia editor, Newton Liu, is kind of like the man behind the curtain. He makes sure that every article and photo is placed

correctly on the page and is aesthetically pleasing to the reader. He is also in charge of assigning photographers to cover events around campus and does a great deal of taking photographs himself. In his ears are tunes that are just as great as he is. He might even be a bit of a closet hipster, but that’s for you to decide. — Mary Baak

Second LivesVitalic

Fur-LinedHow to De-stroy Angels

Put ‘em in the GraveJedi Mind Tricks

Julie and CandyBoards of Canada

Problem MeModwheel-mood

I Can TalkTwo Door Cinema Club

Still D. R. E.Dr. Dre

CirclingFour Tet

Three SeedSilversun Pickups

I Love You, I’m Going to Blow Up Your SchoolMogwai

!"#$%&'($"))'*&+"$&,-$.(/&0122

3'4#$(&5"6-)'4'*&+"$6&7.48&-9:6'(4&4"&48'&;<&=96'%&3""6&>)"7'$&)'?')&;(.?'$%.4:&<'(4'$@A&B8"('&C2DECFDGHD02<"-.'%&"+&'?'(4&$#)'%E+"$694&9?9.)9I)'&94&48'&;<&9(*&;<&,94')).4'&=96'%&3""6&,'$?.5'&<"#(4'$%A

>J&%'-9$94'&'(4$:&+"$6&6#%4&I'&5"6-)'4'*&+"$&'958&'?'(4&'(4'$'*AK(4$:&+''&6#%4&955"6-9(:&48.%&+"$6&"$&48'&'(4$:&7.))&("4&I'&955'-4'*ALM&3KN;LO,&PQRR&SK&Q,,;KOA@

L96' B8"('

K69.)

K?'(4

<96-#%&PQLLK3,&9(*&3;LLK3G;B,&7.))&I'&979$*'*&T3MB!QK,U&TG,!Q3T,&9(*&48'&MBBM3T;LQTV&4"&$'-$'%'(4&48'&;(.?'$%.4:&"+&!"#%4"(&94&48'&J<;Q&3'/."(&20&3'5$'94."(&!"#$%&'(%)*+,&$)*"-*).(*/012*3(45"%*6789*!"#$%&'(%)*P''W'(*&.(5)#*.(/&=96'%&T"#$(96'(4%&9(*&B"'4$:&,)96@A

!.59*:(&$98*/012*3(45"%*67*!"#$%&'(%)*;((<(%=*>5??*I'&8"%4'*&I:&T8'&;(.?'$%.4:&"+&!"#%4"(U&48'&7''W'(*&"+&N'I$#9$:&FGHU&0122A&,"6'&$'/."(9)&5896-."(%&>I.)).9$*%&X&49I)'&4'((.%@&69:&9*?9(5'&4"&.(4'$(94."(9)&5"6-'4.4."(&4"&I'&8')*&94&9&%.4'&9(*&*94'&4"&I'&9(("#(5'*&)94'$&.(&48'&%'6'%4'$A

N"$&9**.4."(9)&.(+"$694."(&9(*&$'/.%4$94."(U&*$"-&I:&48'&;<&"$&48'&;<&,94')).4'&=96'%&3""6%&"$&-8"('&48'&;<&=96'%&3""6&"++.5'&94&>C2D@&CFDGHD02A&&M-'(&4"&JRR&;!&,T;OKLT,&5#$$'(4):&'($"))'*&.(&9&6.(.6#6&"+&48$''&%'6'%4'$&8"#$%&9(*&89?'&9&5#6#)94.?'&=BJ&"+&94&)'9%4&0A1A

2011

@(%89*A*;"'(%89*BCD&??Y9(#9$:&0Z&>P'*('%*9:@U&Z[D1&B\;<&=96'%&3""6K(4$:&N''[&]DA11

BILLIARDS

@(%89*A*;"'(%89*E5%4?(9Y9(#9$:&D2U&>\"(*9:@U&Z[D1&B\;<&!"#%4"(&3""6K(4$:&N''[&]DA11

TABLE TENNIS

Q(*.?.*#9)%EM-'(&O.?.%."(&M():Y9(#9$:&0F&>\"(*9:@U&Z[D1&B\;<&=96'%&3""6&T9I)'&T'((.%&J$'9K(4$:&N''[&N3KK

XBOX MADDENFOOTBALL

‘11

:

F&9)*0.&%G(*BCH&??*!"#$%&'(%)N'I$#9$:&0&>P'*('%*9:@U&Z[D1&B\;<&=96'%&3""6K(4$:&N''[&]DA11

BILLIARDS

schedule 89?'&9&5#6#)94.?'&=BJ&"+&94&)'9%4&0A1A

0.&',5"%89*@(()5%4N'I$#9$:&D&>T8#$%*9:@D[11&B\;<&J'/'9(&>3""6&^0@

<96-#%&7.(('$%&9(*&$#(('$G#-%&9$'&$'_#'%4'*&4"&944'(*&9&6''4.(/&78'$'&3'/."(9)&T"#$(96'(4&.(+"$694."(&7.))&I'&%89$'*&9(*&596-#%&979$*%&*.%4$.I#4'*A

#1

Cougars represent!

Partially funded by SFAC and your UC Fee.

B'"-)',"+4&L#6I'$

J%%"5.94."(&"+&<"))'/'&;(."(%&Q(4'$(94."(9)&<J\B;,&`;JRQNVQL=&TM;3LJ\KLT,

XBOX MADDEN

FOOTBALL

A CU I

TTTTTHHHHHEEEEE DDDDDAAAAAIIIIILLLLLYYYYY CCCCCOOOOOUUUUUGGGGGAAAAARRRRR®®

t h e o f f i c i a l s t u d e n t n e w s p a p e r o f t h e u n i v e r s i t y o f h o u s t o n s i n c e 1 9 3 4

years

Men’s basketball rolls on with

dominant win over ECU SPORTS !Google has plans to revolutionize phone industry LIFE & ARTS !

HI 72 LO 61

Issue !", Volume !#

Tuesday, January !", #$!$thedailycougar.com

WEATHER !

Forecast, Page 2

THEDAILYCOUGAR.COM

Speaking up

ZUHAIR SIDDIQUI THE DAILY COUGAR

Alumna leaves legacy in artsBy Amenah Khalil

THE DAILY COUGAR

Prominent alumna and

philanthropist Cynthia Woods

Mitchell, died Dec. 27 at age 87,

after almost a decade of living with

Alzheimer’s disease.

Mitchell was a valued donor to

various projects and causes, most of

which involved her love for the arts.

“She was a visionary

philanthropist whose dedication

to the arts was apparent in the

founding of the Cynthia Woods

Mitchell Center,” Karen Farber,

director of UH’s Cynthia Woods

Mitchell Center for the Arts, said in

an e-mail.

Mitchell was an enthusiastic

supporter of the arts and believed

that everyone, not just the wealthy,

should be able to enjoy musical

performances. This desire became

a reality when the Cynthia Woods

Mitchell Pavilion was created in The

Woodlands.

Mitchell’s philanthropy extends

throughout Houston, Galveston

and College Station.

For UH, the Cynthia Woods

Mitchell Center for the Arts remains

her greatest legacy.

With a $20 million donation from

Mitchell, the center has been able

to cultivate collaborations between

performing, visual and literary arts.

“Just as she lived a productive

and creative life with extraordinary

commitment to our community,

she has left a legacy that will fuel

creativity for future generations in

our community and far beyond,”

UH President Renu Khator said in a

release. The Cynthia Woods Mitchell

Center for the Arts went through

renovations in 2005 and 2006 and

was renamed in October 2006 to

honor Mitchell’s long-standing

support for the arts.

“Mrs. Mitchell’s and the

Mitchell family’s commitment to

create the Cynthia Woods Mitchell

Center for the Arts — a center that

celebrates the arts and encourages

collaboration — has helped to

position UH arts as one of the

University’s key priorities,” Khator

said.Mitchell was also a generous

donor to UH’s Texas Music Festival

and the Gerald D. Hines College of

Architecture. She also created UH’s

Distinguished Authors Program.

“Mrs. Mitchell and her family’s

generosity has made dozens of

significant new artworks possible

and left a lasting legacy that will

continue to infuse the entire

University and City of Houston with

creativity and innovation. On behalf

of the Mitchell Center board and

staff, I extend the deepest sympathy

and gratitude to the Mitchell

family,” Faber said in an e-mail.

d tFraternity to help

id i Haiti reliefsee MITCHELL, page 3

A group of local and national pro-

life advocates gathered to protest

the opening of a new Planned

Parenthood facility. The 78,000-sq. ft. facility

will be the largest Planned Parenthood

building in the nation and will be located at

4600 Gulf Freeway. Keith Fry, right, traveled

from Abilene to be among the thousands of

participants in the demonstrations, which

occurred Sunday and Monday.

TTTTTHHHHHEEEEE DDDDDAAAAAIIIIILLLLLYYYYY CCCCCOOOOOUUUUUGGGGGAAAAARRRRR®®t h e o f f i c i a l s t u d e n t n e w s p a p e r o f t h e u n i v e r s i t y o f h o u s t o n s i n c e 1 9 3 4

years

Men’s basketball rolls on with

dominant win over ECU SPORTS !Google has plans to

revolutionize phone

industry LIFE & ARTS !

HI 72 LO 61

Issue !", Volume !#

Tuesday, January !", #$!$

thedailycougar.com

WEATHER !

Forecast, Page 2

UH rewards football coach Kevin Sumlin with new six-year contract

THEDAILYCOUGAR.COM

Speaking up

ZUHAIR SIDDIQUI THE DAILY COUGAR

Alumna leaves

legacy in artsBy Amenah Khalil

THE DAILY COUGAR

Prominent alumna and

philanthropist Cynthia Woods

Mitchell, died Dec. 27 at age 87,

after almost a decade of living with

Alzheimer’s disease.

Mitchell was a valued donor to

various projects and causes, most of

which involved her love for the arts.

“She was a visionary

philanthropist whose dedication

to the arts was apparent in the

founding of the Cynthia Woods

Mitchell Center,” Karen Farber,

director of UH’s Cynthia Woods

Mitchell Center for the Arts, said in

an e-mail.

Mitchell was an enthusiastic

supporter of the arts and believed

that everyone, not just the wealthy,

should be able to enjoy musical

performances. This desire became

a reality when the Cynthia Woods

Mitchell Pavilion was created in The

Woodlands.

Mitchell’s philanthropy extends

throughout Houston, Galveston

and College Station.

For UH, the Cynthia Woods

Mitchell Center for the Arts remains

her greatest legacy.

With a $20 million donation from

Mitchell, the center has been able

to cultivate collaborations between

performing, visual and literary arts.

“Just as she lived a productive

and creative life with extraordinary

commitment to our community,

she has left a legacy that will fuel

creativity for future generations in

our community and far beyond,”

UH President Renu Khator said in a

release. The Cynthia Woods Mitchell

Center for the Arts went through

renovations in 2005 and 2006 and

was renamed in October 2006 to

honor Mitchell’s long-standing

support for the arts.

“Mrs. Mitchell’s and the

Mitchell family’s commitment to

create the Cynthia Woods Mitchell

Center for the Arts — a center that

celebrates the arts and encourages

collaboration — has helped to

position UH arts as one of the

University’s key priorities,” Khator

said.Mitchell was also a generous

donor to UH’s Texas Music Festival

and the Gerald D. Hines College of

Architecture. She also created UH’s

Distinguished Authors Program.

“Mrs. Mitchell and her family’s

generosity has made dozens of

significant new artworks possible

and left a lasting legacy that will

continue to infuse the entire

University and City of Houston with

creativity and innovation. On behalf

of the Mitchell Center board and

staff, I extend the deepest sympathy

and gratitude to the Mitchell

family,” Faber said in an e-mail.

d ntsFraternity to help

aid in Haiti reliefsee MITCHELL, page 3

A group of local and national pro-

life advocates gathered to protest

the opening of a new Planned

Parenthood facility. The 78,000-sq. ft. facility

will be the largest Planned Parenthood

building in the nation and will be located at

4600 Gulf Freeway. Keith Fry, right, traveled

from Abilene to be among the thousands of

participants in the demonstrations, which

occurred Sunday and Monday.

OOOOOUUUUUOOOOOUUUOUo fo f

witPOR

AAAAARRRRAARRe ee

OOOUUUUUUUUUUGGGGGAAAAAOOOUUUUUUUUUUGGGUUUGGGGGAAAGAAAAAf h o u s t o n o uo uh o uf h o u s h o uoh o uh o uh o uoh

s i n c ef hhhhhh oooooooo uuuuuuuu ss t o n s i n c en c e

ith RTS !

Missed a print edition?You can now browse recent publications in our virtual newsstand @thedailycougar.com/print-edition

The Daily Cougar COMICS & MORE Wednesday, January !", !#$$ ! 7

crosswordcomics

sudokuHow to play Each row must contain the numbers 1 to 9; each column must contain the numbers 1 to 9; and each set of 3-by-3 boxes must also contain the numbers 1 to 9.

That Monkey Tune by Michael A. Kandalaft

Dim Sum by Ho Yi Lau

ACROSS 1 Sci-! menace 5 Give away 9 Nourishes 14 Pasta-sauce

brand 15 Town east of Wichita 16 Treed (2 wds.) 17 Cake decorator 18 Ring out 19 No longer woolly 20 Kind of pencil 22 Afternoon show 24 Mosquito genus 26 Delt neighbor 27 Perfumes 30 Seedless raisins 35 Cold weather

wear 36 — Annan of the U.N. 37 Folk teachings 38 Pre! x for center 39 Trail treat 42 Informer 43 General vicinity 45 Orbit segments 46 Kind of ray 48 Very alluring 50 Chocolate

dessert 51 Open container 52 Chic 54 Letter opener (2 wds.) 58 Sentences 62 Pay by mail 63 Tarzan’s title 65 Shopping plaza 66 Wash out 67 Latin hymn word 68 El — (ocean current) 69 Roused up 70 Usual food 71 Lots and lots

DOWN 1 Crusty cheese 2 Delicate 3 Ess molding 4 Shasta daisy

developer 5 Ri" e supports 6 “Gigi” composer 7 Crimson Tide st. 8 Liniment

9 Speed demon’s cry

10 Aboveboard 11 Bard’s black 12 Press one’s luck 13 “Auld Lang —” 21 Change prices 23 Spring time 25 Candle holders 27 Say a few words 28 Blue Grotto site 29 Iroquois

speakers 31 Alien tour buses? 32 Standards 33 Ore trucks 34 Bristles 36 Socialist — Marx 40 Temple ! gure 41 Greek forum 44 On horseback 47 Falls 49 “Northanger

Abbey” novelist 50 Hammer kin

53 Jazz singer Carmen —

54 Took a card 55 A Saarinen 56 In a frenzy 57 Lone Ranger’s

name 59 Ship’s canvas 60 Ocean-going

bird 61 Put away gear 64 “Exodus” name

© 2010 UNITED FEATURE SYNDICATE INC.

Previous puzzle solved

Previous puzzle solved

1 2 3 4 5 6 7 8 9 10 11 12 13

14 15 16

17 18 19

20 21 22 23

24 25 26

27 28 29 30 31 32 33 34

35 36 37

38 39 40 41 42

43 44 45 46 47

48 49 50

51 52 53

54 55 56 57 58 59 60 61

62 63 64 65

66 67 68

69 70 71

B I N D R A S H J A M B SO B O E O B I E O V A L SO S T R A C I Z E C O N A NN E C N O D E S K I E SE N H A N C E C O E D

B I O B A B Y S A TE N S U E N I N E S L E OG O A T P E T E R S P A NO E R M E E T S W H O L EL I M E A D E B R O

U R L S P R O O F E DB O S C S L O A N O L E

H A I K U H O L Y G R A I LI D L E R A L E E C L O TT E S T Y L A D D A S T A

Spring 2011

For more information & useful resources, please check the websites above.

W O R K S H O P S

8 ! Wednesday, January !", !#$$ ADVERTISING The Daily Cougar

76.080-012611

Documents

Transcript of 76.080-012611