7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the...

149
Novel insights in the adaptation of avian H9N2 influenza viruses to swine José Carlos Mancera Gracia 2017 J C Mancera Gracia 2017 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY DEPARTMENT OF VIROLOGY, PARASITOLOGY AND IMMUNOLOGY FACULTY OF VETERINARY MEDICINE GHENT UNIVERSITY

Transcript of 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the...

Page 1: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Novel insights

in theadaptation

of avianH

9N2 influenza

virusesto sw

ine

José Carlos Mancera Gracia2017

J C Mancera G

racia2017

Novel insights in the adaptation of avian H9N2 influenza viruses

to swine

LABORATORYOFVIROLOGYDEPARTMENT OFVIROLOGY,PARASITOLOGYANDIMMUNOLOGY

FACULTYOFVETERINARYMEDICINEGHENTUNIVERSITY

Page 2: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Novelinsightsintheadaptationofavian

H9N2influenzavirusestoswine

JoséCarlosManceraGracia

DoctorofPhilosophy(Ph.D.)inVeterinarySciences

2017

Promotor:Prof.Dr.KristienVanReeth

Co-Promotor:Prof.Dr.XavierSaelens

LaboratoryofVirology

DepartmentofVirology,ParasitologyandImmunology

FacultyofVeterinaryMedicine

GhentUniversity

Page 3: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

MembersoftheExaminationCommittee:Prof.Dr.HansNauwynck(Chairman)DepartmentofParasitology,VirologyandImmunology,FacultyofVeterinaryMedicine,GhentUniversity.Dr.SebastiaanTheuns(Secretary)DepartmentofParasitology,VirologyandImmunology,FacultyofVeterinaryMedicine,GhentUniversity.Prof.Dr.MikhailMatrosovichInstitutfürVirologie,PhilippsUniversität,Marburg.Prof.Dr.DominiekMaesDepartment of Reproduction, Obstetrics and Herd Health, Faculty of Veterinary Medicine,GhentUniversity.Dr.AnnebelDeVleeschauwerVeterinaryandAgrochemicalResearchCentre,Brussels.Dr.KarenvanderMeulenPerseusBVBA,BelgiumManceraGraciaJ.C. (2017).Novel insights intheadaptationofavianH9N2 influenzavirusestoswine.PhDthesis,GhentUniversity,Belgium.Theauthorandthepromotorgivetheauthorizationtoconsultandcopypartsofthisworkforpersonaluseonly.Everyotheruseissubjecttocopyrightlaws.Permissiontoreproduceanymaterialcontainedinthisworkshouldbeobtainedfromtheauthor.ThisstudywasfundedbytheresearchprojectFLUPIG“Pathogenesisandtransmissionofinfluenzainpigs”(FP7-EUprojectNo258084).

Page 4: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

“Iamfondofpigs.Dogslookuptous.Catslookdowntous.Pigstreatusasequals.”

WinstonChurchillUnitedKingdomPrimeMinister1940-1945

and1951-1955

Amispadres,InmaculadayJoséCarlos.

Page 5: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY
Page 6: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

TABLEOFCONTENTS

LISTOFABBREVIATIONS

1GENERALINTRODUCTION.................................................................................11.1 Introductiontoinfluenzaviruses...................................................................2

1.1.1 Taxonomyandvirionstructure...............................................................21.1.2 Replicationcycle......................................................................................51.1.3 Mechanismsofevolutionandemergenceofnovelinfluenzaviruses.....7

1.2 Ecologyandpathogenesisofavian,humanandswineinfluenzaviruses......8

1.2.1 Avianinfluenzaviruses............................................................................81.2.2 Humaninfluenzaviruses.........................................................................91.2.3 Swineinfluenzaviruses.........................................................................11

1.3 Interspeciestransmissionandthespeciesbarrier.......................................14

1.3.1 Transmissionfrombirdstomammals………………………………………………..141.3.2 Transmissionbetweenhumansandswine.………………………………………..151.3.3 Avianinfluenzaviruseswithpandemicpotential…………..…………………..16

1.4 Molecularmechanismsofhostrangerestriction........................................21

1.4.1 Theroleofthehemagglutinin...............................................................211.4.2 Theroleoftheneuraminidase..............................................................231.4.3 Theroleofthepolymeraseproteinsandtheinternalgenes................24

1.5 Adaptationofavianinfluenzavirusestoswine...........................................25

1.5.1 Naturalinfectionsofpigswithavianinfluenzaviruses.........................251.5.2 Experimentalinfectionsofpigswithavianinfluenzaviruses................271.5.3Theroleofthepigintheadaptationofavianinfluenzavirusesto

mammals................................................................................................291.6 References...................................................................................................30

2 AIMSOFTHETHESIS.......................................................................................43

3 EFFECTOFSERIALPIGPASSAGESONTHEADAPTATIONOFANAVIANH9N2INFLUENZAVIRUSTOSWINE..........................................................................47Abstract................................................................................................................483.1 Introduction.................................................................................................493.2 Materialsandmethods................................................................................513.3 Results..........................................................................................................573.4 Discussion.....................................................................................................663.5 Acknowledgements......................................................................................713.6 References...................................................................................................71

Page 7: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

 

4   A  REASSORTANT  H9N2  INFLUENZA  VIRUS  CONTAINING  2009  PANDEMIC  H1N1  INTERNAL-­‐PROTEIN  GENES  ACQUIRED  ENHANCED  PIG-­‐TO-­‐PIG  TRANSMISSION  AFTER  SERIAL  PASSAGES  IN  SWINE  .................................................................  77  Abstract  ................................................................................................................  78  4.1   Introduction  .................................................................................................  79  4.2   Materials  and  methods  ................................................................................  81  4.3   Results  .........................................................................................................  85  4.4   Discussion  ....................................................................................................  93  4.5   Acknowledgements  .....................................................................................  97  4.6   References  ...................................................................................................  97  Supplemental  materials……………………………………………………………………..…………..101  

5   GENERAL  DISCUSSION  ..................................................................................  107  

6   SUMMARY  -­‐  SAMENVATTING  .......................................................................  123  

7   CURRICULUM  VITAE  .....................................................................................  131  

8   AKNOWLEDGEMENTS  ..................................................................................  135  

Page 8: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

LISTOFABBREVIATIONSA aa aminoacid

AEC 3-amino-9-ethyl-carbazole

AIV avianinfluenzavirus

AUC areaunderthecurve

B bp basepairs

BSL biosafetylevel

C CDC CentersforDiseaseControlandPrevention

cDNA complementarydeoxyribonucleicacid

CI confidenceinterval

cRNA complementaryribonucleicacid

D dpc dayspost-contact

dpi dayspost-inoculation

E ELISA enzyme-linkedimmunosorbentassay

F FAO FoodandAgricultureOrganization

G GOF gain-of-function

H H1N2v H1N2variant

H3N2v H3N2variant

HA hemagglutinin

HEPA highefficiencyparticlearresting

HI hemagglutinationinhibition

HPAIV highlypathogenicavianinfluenzaviruses

L LPAIV lowpathogenicavianinfluenzaviruses

M M matrixprotein

M1 matrixprotein1

M2 matrixprotein2

Page 9: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

MDCK Madin-Darbycaninekidney

MOI multiplicityofinfection

mRNA messengerribonucleicacid

N NA neuraminidase

NEP nuclearexportprotein

Neu5Ac non-O-acetylatedN-acetylneuraminicacid

Neu5Gc N-glycolylneuraminicacid

ng nanogram

NGS nextgenerationsequencing

nM nanoMolar

NP nucleocapsidprotein

NS1 non-structuralprotein1

NS2 non-structuralprotein2

O OIE WorldOrganizationforAnimalHealth

OFFLU OIE-FAOglobalnetworkofexpertiseonanimalinfluenza

P PA polymeraseacidic

PB1 polymerasebasic1

PB2 polymerasebasic2

PBS phosphate-bufferedsaline

pH1N1 2009pandemicH1N1

PRDC porcinerespiratorydiseasecomplex

PRRS porcinereproductiveandrespiratorysyndrome

R R0 basicreproductionratio

RBS receptor-bindingsite

RNA ribonucleicacid

RNP ribonucleoprotein

RT-PCR reversetranscription-polymerasechainreaction

Page 10: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

S Sia sialicacid

Siaα2,3Gal α2,3Gal-linkedsialicacids

Siaα2,6Gal α2,6Gal-linkedsialicacids

SIV swineinfluenzavirus

T TCID50 tissuecultureinfectiousdosewitha50%endpoint

TRIG triple-reassortantinternalgenes

U URT upperrespiratorytract

US UnitedStates

V vRNA viralribonucleicacid

W WHO WorldHealthOrganization

Page 11: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY
Page 12: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter1

1

1

GENERALINTRODUCTION 21

Page 13: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Generalintroduction

2

1.1 Introductiontoinfluenzaviruses 3

1.1.1 Taxonomyandvirionstructure 4

Influenzavirusescauseahighlycontagiousrespiratorydiseaseknownasinfluenzaor 5

“flu”,whichhasposedasignificantthreatforanimalsandhumanssincetheancient 6

times. These viruses are the most important members of the family 7

Orthomyxoviridae.Theirgenomeiscomposedof7to8segmentsofnegative-sense 8

single-stranded ribonucleic acid (RNA). Influenza viruses are divided into 4 9

genera/types:A,B,CandD. This classification (into the4genera) isbasedon the 10

geneticandantigenicdifferencesbetweentheirnucleocapsid(NP)andtheirmatrix1 11

(M1)proteins(Wrightetal.,2013).InfluenzaBandCvirusesarelargelyrestrictedto 12

humansbuthavealsobeensporadicallyisolatedfromothermammals(Kimuraetal., 13

1997, Hause et al., 2013). Since 2011 influenza D viruses have been identified in 14

cattleandpigs(Ducatezetal.,2015,Chiapponietal.,2016,Fergusonetal.,2016). 15

InfluenzaB,CandDvirusesareconsidereda lowerthreattopublicandveterinary 16

health,andtheywillnotbefurtherdiscussedinthisthesis. Incontrast, influenzaA 17

virusesareofgreatimportancebecausetheycaninfectawidevarietyofavianand 18

mammalian species (Fouchier et al., 2003, Harder and Vahlenkamp, 2010). These 19

virusesarefurtherdividedintosubtypesbasedontheantigenicpropertiesoftheir 20

surface glycoproteins hemagglutinin (HA) and neuraminidase (NA). As of today 18 21

differentHAs (H1-H18)and11NAs (N1-N11)havebeen identified (Fouchieretal., 22

2005,Mehle, 2014).With the exception of subtypes H17N10 and H18N11, which 23

wereonly found inbats,allknownsubtypesof influenzavirusesareestablished in 24

birds.Yet justa limitednumberofsubtypeshavebecomeendemic inhumansand 25

pigs(Table1). 26

27

Page 14: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter1

3

Table 1.OverviewofHA andNA subtypes of influenzaA viruses that are or have 28beenendemicinbirds,humans,pigsandotheranimalspecies(adaptedfromtheUS 29CDC:http://www.cdc.gov/flu/about/viruses/transmission.htm). 30 31

HA NA

Subtype Hostspecies Subtype Hostspecies

H1 N1

H2 N2

H3 N3

H4 N4

H5 N5

H6 N6

H7 N7

H8 N8

H9 N9

H10 N10

H11 N11

H12

H13

H14

H15

H16

H17

H18

32

Page 15: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Generalintroduction

4

Thecurrentnomenclaturesystemfor influenzavirusesgives informationaboutthe 33

type,host,placeofisolation,strainnumber,yearofisolationandantigenicsubtype 34

of thevirus. For instance,anH9N2virus isolated fromquail inHongKong in1997 35

wasdesignatedasA/quail/HongKong/G1/1997(H9N2). 36

Influenza A virions are spherical or pleomorphicwith a diameter between 80 and 37

120 nanometers. They are enveloped viruses and encode 10 viral proteins on 8 38

separate segments of negative-sense RNA. A few additional proteins were only 39

recentlyidentified(Shietal.,2014).Theenvelopeisalipidbilayerderivedfromthe 40

hostcellmembraneandcontainstheHAandtheNAthatplayacrucialrole inthe 41

virusbindingand release, respectively (Figure1).Another transmembraneprotein, 42

thematrixprotein2(M2), isatypeIIIprotonselective ion-channelessential inthe 43

release of the uncoated ribonucleoproteins (RNPs) into the cytoplasm of the host 44

cell. Justunderneath thevirionenvelope, theM1 formsa layer that interactswith 45

boththeenvelopeandtheRNPs.ThisM1isresponsibleforthestructuralintegrityof 46

thevirionandencapsidatesthe8RNPs.TheRNPsconsistofaRNAsegment,NPsand 47

thepolymerasecomplex(PA,PB1andPB2)thatisresponsibleforviralRNA(vRNA) 48

replicationand transcription. Thenon-structural (NS) segmentencodes2proteins: 49

NS1, a host antiviral response antagonist and NS2 (also named nuclear export 50

proteinNEP),whichisassociatedwiththeM1andmediatestheexportoftheRNPs 51

fromthenucleustothecytoplasm. 52

53

Page 16: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter1

5

54

Figure 1. (A) The structure of influenza A virion. (B) Non-structural proteins 55

identified,thecolourofeachproteinmatchesthecolourofthegene-segmentthat 56

codesit.(C)RepresentationoftheinfluenzaAribonucleoprotein(adaptedfromShi 57

etal.2014). 58

59

1.1.2 Replicationcycle 60

The infection of a susceptible host cell is initiated by the interaction of the HA 61

receptor-bindingsite(RBS)withterminalsialicacids(Sia) linkedtoglycoproteinsor 62

glycolipidsonthehostcellmembrane(seeFigure2).ThecontactbetweenSiaand 63

the HA is established by low affinity bonds such as hydrogen bonds, hydrophobic 64

interactions and van der Waals contacts (Gamblin and Skehel, 2010). Therefore, 65

bindingofmultiple cell receptors tomultipleHAspikes isneeded toobtainahigh 66

binding avidity. Upon binding to the host cell Sia residues, a clathrin-mediated or 67

clathrin- and caveolin-independent endocytosis occurs and, as a result the virus 68

enters in the host cell in an endosome (Skehel and Wiley, 2000, Sieczkarski and 69

Whittaker, 2002, Lakadamyali et al., 2004). During the migration from the cell 70

surface towards the nucleus, the viral and the endosomal membranes fuse. This 71

fusion is triggered by conformational changes produced in the HA by a low pH 72

environment (Cross et al., 2009).Moreover, the low pH present in the endosome 73

Lipid%envelope%derived%from%host%cell%

HA%

HA%NA%

M2%

M1%

NS2%

Ribonucleoprotein%

PB2%PA%%

PB1%

Ribonucleoprotein%

Polymerase%complex% NP% Viral%genomic%

RNA%

NS1%

PB1CF2%

N40%

PACX%

PACN155%

PACN182%

NonCstructural%and%newly%idenKfied%proteins%

M42%

A" B"

C

Page 17: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Generalintroduction

6

opens the M2 ion-channel creating an additional influx of protons into the virus 74

interior,which causes the disconnection of the RNPs from theM1proteins (Pinto 75

and Lamb, 2006). The RNPs are subsequently released into the cytoplasm, and 76

migratetothenucleus,wheretranscriptionandreplicationoccur.Soastoenterinto 77

thenucleus,theRNPsuseknownnuclearlocalizationsignalsthatbindtothecellular 78

nuclear import machinery (Boulo et al., 2007). As influenza A viruses possess 79

negative-strandedRNA,acomplementarycopyofitmustbemadetoobtaintheviral 80

messenger RNA (mRNA). Furthermore, vRNA does not contain 5´methylated caps 81

that are needed to complete the synthesis of mRNA (Das et al., 2010). Thus, to 82

overcomethatsituation,the5’capsofcellularhostderivedpre-mRNAareboundby 83

thePB2andcleaved-offbytheendonucleaseactivityofPAatapproximately10to13 84

nucleotides fromthecapstructure inaprocesscalled“cap-snatching” (Guilligayet 85

al.,2008,Diasetal.,2009).ThiscellularcappedRNAfragmentissubsequentlyused 86

for priming viral transcription by the viral polymerases (Reich et al., 2014). The 87

production of new vRNA requires the synthesis of an intermediate positive-sense 88

template, called complementary RNA (cRNA), which serves as template for the 89

productionofprogenyRNAsegmentsinthenucleus.AllproteinscomprisingtheRNP 90

migratefromthesiteofsynthesisinthecytoplasmtothenucleuswheretheymerge 91

with vRNA. The interaction of M1, NS2 and cellular nucleoporins prompts the 92

nuclearRNPexportintotheinnersurfaceoftheplasmamembrane(Neumannetal., 93

2000). There, the 8 gene segments are gathered together by packaging the RNP 94

segments,NS2andM1underneaththeapicalcellmembrane.Virusassemblyoccurs 95

whileHA,NAandM2arealreadyembedded in theapicalplasmamembrane. The 96

buddingofthevirusalsoinvolvesM1proteinsandseveralhostfactors(Nayaketal., 97

2009).The laststepconstitutesthereleaseofthenewlyformedvirion.Duringthis 98

process NA acts as a “razor” that enzymatically shaves the Sia residues from the 99

glycoproteinsandglycolipidspresenton thecell surfaceallowinganefficient virus 100

release(GamblinandSkehel,2010). 101

102

103

104

105

Page 18: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter1

7

106Figure2.SchematicoverviewoftheinfluenzaAvirusreplicationcycle(adaptedfrom 107Shietal.,2014). 108 109

1.1.3 Mechanismsofevolutionandemergenceofnovelinfluenzaviruses 110

Because of the nature of their viral genome, influenza A viruses carry their own 111

polymerase genes, which lack exonuclease-proofreading capability. Therefore, 112

influenza A viruses are evolutionarily dynamic and exist as populations of 113

quasispecies(Domingoetal.,1998)withmutationratesrangingfrom1x10-3to8x 114

10-3 substitutions per site per year (Chen and Holmes, 2006). The surface 115

glycoproteins,HAandNA,arethemost importantantigens for inducingprotective 116

immunity in the host, but also the most variable genes. Mutations that change 117

aminoacids in theantigenic sitesof thoseproteinsmayallow influenza viruses to 118

escape from pre-existing immunity. Such selective mutations produced in the HA 119

andNAantigenicdomains are knownas “antigenicdrift”. It canproduce selective 120

advantagesforviralstrains,anditisthereasonwhythevirusstrainspresentinthe 121

humaninfluenzavaccinesneedtobereviewedeveryyear. 122

Due to the presence of 8 independent RNA segments in the influenza A virus 123

genome,simultaneousco-infectionofahostcellwith2ormoredifferentvirusescan 124

result in progeny viruses containing a novel combination of gene segments from 125

mRNA

vRNA (-)

cRNA (+)

Proteinsynthesis

Binding

Endocytosis Assembly

Packaging

Sia-linkedreceptors

Nucleus

FusionandUncoating

Buddingandrelease

H+

Protontransport

Page 19: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Generalintroduction

8

bothparentalviruses.Thisphenomenonisknownasgenetic“reassortment”.When 126

the genetic reassortment results in the emergence of a virus containing novel HA 127

and/or NA proteins it is designated as “antigenic shift” (Taubenberger and Kash, 128

2010). The combination of antigenic drift and shift allows influenza viruses to 129

constantly reinvent themselves posing a continuous threat to animal and human 130

health(LiandChen,2014). 131

132

1.2 Ecologyandpathogenesisofavian,humanandswineinfluenzaviruses 133

1.2.1 Avianinfluenzaviruses 134

Wild aquatic birds (orders Anseriformes and Charadriiformes), especially ducks, 135

shorebirdsandgullsarenaturalhostsformostinfluenzaAvirussubtypes(Sorrellet 136

al.,2007).Asmuchas82differentHAandNAcombinationshavebeenisolatedfrom 137

aquaticbirds(Olsenetal.,2006).Avianinfluenzaviruses(AIVs)primarilyreplicatein 138

thecellsoftheintestinalepitheliumofbirds,andareexcretedinhighconcentrations 139

intheirfaeces.Asaconsequence,wildbirdstransmitAIVsviathefaecal-oralroute. 140

Thus migrating aquatic birds can carry viruses between their summer and winter 141

habitats, spreading the viruses during their feeding stops (Munster et al., 2006). 142

InfluenzaAvirus infections inwildaquaticbirdsaregenerallyasymptomatic(Olsen 143

etal.,2006). 144

Land-based poultry such as chickens, turkeys, quails and pheasants are also 145

susceptible to influenza A viruses (Alexander, 2000). In these species, influenza A 146

viruses are classified into the following 2 categories based on molecular 147

characteristicsandtheabilityofthevirustocausediseaseandmortalityinchickens 148

inalaboratorysetting: 149

Lowpathogenicavianinfluenzaviruses(LPAIV): 150

Most AIVs are LPAIV. Infection of poultry with this pathotype usually causes a 151

subclinicalormilddiseasewithsymptomssuchasruffledfeathersand/oradropin 152

eggproduction.However,inchickensandturkeysLPAIVinfectionmayalsoresultin 153

respiratorydisease,sinusitisanddepression,whichcanbeaggravatedbysecondary 154

bacterialinfections.Themostfrequentlyisolatedsubtypesfrompoultryare:H1,H3, 155

H5,H6,H7andH9(Alexander,2000,PerezanddeWit,2017andSimsetal.,2017). 156

Highlypathogenicavianinfluenzaviruses(HPAIV): 157

Page 20: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter1

9

AIVsofH5andH7subtypesmaybecomeHPAIVuponintroductionfromwildaquatic 158

birds intopoultry.AllHPAIVshave arisenby the insertionofmultiple basic amino 159

acid (aa) residues in theHAcleavagesiteof LPAIVs.Thiscleavagesite isknownto 160

process the HA precursor (HA0) to the functional components HA1 and HA2 161

(AlexanderandBrown,2009).AbasiccleavagesiteallowscleavageofHAbywidely 162

distributed cellular proteases that do not cleave LPAIV HAs. This facilitates 163

replication in a wider range of organs resulting in a more severe illness with 164

morbidityandmortality ratesup to100%.HPAIVshavebeenmainly isolated from 165

chickens and turkeys. The typical signs in those species include decreased egg 166

production, respiratory signs, lacrimation, sinusitis, cyanosisof combsandwattles, 167

oedemaof thehead, ruffled feathers,diarrhoeaandnervoussymptoms.However, 168

thesesignsarevariabledependingonthehostspeciesandage,thevirusstrain,and 169

the possible concurrence of secondary bacterial infections (Webster et al., 1992, 170

Simsetal.2017).ThemechanismsleadingtotheswitchfromLPAIVtoHPAIVviruses 171

inpoultryarenotcompletelyunderstood.Therefore,itisimpossibletopredictwhen 172

HPAIV will emerge. Nevertheless, it is assumed that the odds increase in direct 173

proportionwiththecirculationofH5andH7LPAIVswithinpoultryflocks. 174

1.2.2 Humaninfluenzaviruses 175

Influenza A viruses circulate in humans as an annually recurrent epidemic disease 176

thatcausesmillionsofhumaninfectionsworldwideandhassignificanteconomicand 177

health burdens (Medina andGarcia-Sastre, 2011).Only 3 specific subtypes (H1N1, 178

H2N2andH3N2)havereachedtheendemicstatusinhumanssince1918(Figure3) 179

(Taubenberger and Kash, 2010). The high population immunity forces human 180

influenzavirusestochangecontinuously.Changesoccurmainly intheviralHAand 181

NAandmayleadtoepidemicsandpandemics. 182

Theantigenicevolutionofcirculatingstrainscouldresultinan“antigenicdrift”that 183

causesanepidemicoutbreakaffectingmorethantheexpectednumberofpeoplein 184

acommunityorregionduringagivenperiodoftime.Whenanepidemicvirusspread 185

in human population across a whole continent or even the world it generates a 186

pandemic.Thegenerationofanovelpandemicvirusdependson2mainfactors:the 187

introductionofanantigenicallynovelHAsubtypeinthehumanpopulation,andthe 188

ability of the virus to spread efficiently between humans. Even though the exact 189

Page 21: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Generalintroduction

10

mechanisms bywhich pandemic influenza A viruses are generated are still poorly 190

understood,3differentmechanismshavebeensuggested.Afirstmechanismisthe 191

introduction in humans of a novel virus subtype from a different host. The 1918 192

pandemicH1N1virus,alsoknownas“Spanishflu”,isbelievedtoresultfromsuchan 193

event.ThisH1N1pandemicviruscaused≈50milliondeathsworldwide.Recentlyall 194

genesof thisviruswereshowntobeavian-like (TaubenbergerandMorens,2006). 195

ThesecondmechanismisthegenerationofaviruscontaininganovelHAand/orNA 196

subtypebygeneticreassortmentbetweenanimalandhumaninfluenzaviruses.The 197

1957 H2N2 pandemic, also known as “Asian flu”, was generated by reassortment 198

betweenanavianvirus thatdonated theHA,NAandPB1gene-segments,and the 199

thencirculatinghumanH1N1strain.Anotherexampleisthe1968H3N2“HongKong 200

flu”pandemic.Thisvirusacquiredavian-originHAandPB1gene-segmentsandthe 201

remaining 6 segments from the human H2N2 virus that was circulating in 1968 202

(TaubenbergerandKash,2010).Thethirdmechanismisthere-introductionofaHA 203

that disappeared from the human population but that has been kept in stasis in 204

anotherreservoirspecies.Throughthismechanismanearliercirculatingstrainmay 205

be re-introduced into humans from a non-human reservoir when the human 206

populationimmunityhasbecomeverylow.TheH1N1virusthatgeneratedthe1977 207

pandemic,namedthe“Russianflu”,wasmostlikelytheresultofare-introductionof 208

thehumanH1N1virusthathasbeencirculatingfrom1918upuntiltheemergence 209

ofH2N2pandemicin1957(TaubenbergerandKash,2010).Geneticanalysessupport 210

thebeliefthatthereintroductionwasduetotheaccidentalreleaseofa1950sfrozen 211

virus from a laboratory (Nakajima et al., 1978). A better example of the third 212

mechanism is the 2009 pandemic H1N1 virus (pH1N1). Interestingly, this virus 213

belongstoH1subtype,whichhasbeencirculatinginhumansfordecades.However, 214

pH1N1 HA protein is antigenically very distinct from the human-seasonal H1N1 215

virusesthatwerecirculatingin2008-09.Itcontainsa“classicalswine”H1HA,which 216

is derived from the 1918 pandemic H1N1 influenza viruses and that remained in 217

antigenicstasisinswine(seeFigure4).Consequently,peoplebornafter1950swere 218

immunologicallynaïvetopH1N1(Kashetal.,2010). 219

Page 22: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter1

11

Inhumans, seasonal influenza infectionsare restricted to the respiratory tractand 220

are characterized by a high morbidity and low mortality. Figure 3 depicts the 221

evolutionofthepandemicinfluenzavirusesreportedsince1918. 222

223

224

225

Figure3.Originofthe4knownpandemicinfluenzaAvirusesinhumanssince1918. 226 227

1.2.3 Swineinfluenzaviruses 228

Inpigs,influenzaAvirusesareoneofthemajorcausesofacuterespiratorydisease 229

outbreaks.Although“influenzaAvirusinswine”isthenomenclaturerecommended 230

by the OIE-FAO Global Network of Expertise on Animal Influenza (OFFLU) for 231

influenzaAvirusesthatareendemicinpigs,inthisthesiswewillusethetraditional 232

designation“swineinfluenzavirus(SIV)”(OIE,2017).SIVsmaycontributetotheso- 233

calledporcinerespiratorydiseasecomplex(PRDC)inconcertwithotheragentssuch 234

as porcine reproductive and respiratory syndrome (PRRS) virus andMycoplasma 235

hyopneumniae,generatingmultifactorialdiseaseproblems.Thoughonly3influenza 236

virussubtypes(H1N1,H3N2andH1N2)arecurrentlycirculatinginswineworldwide, 237

the origins and the antigenic characteristics of these SIV subtypes are different in 238

differentregionsoftheworld(Figure4).InEurope,thefirstsignificantSIVoutbreaks 239

1918 1957 1968

H3N2pandemic“HongKongflu”

H2N2pandemic“Asian flu”

?

1977 2009Re-emergedSeasonal H1N1“Russian flu”

2009pandemicH1N1

Page 23: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Generalintroduction

12

occurred in1979after the transmissionofanavianH1N1virus fromwildducks to 240

pigs in Belgium and Germany (Pensaert et al., 1981). This European “avian-like” 241

H1N1virusrapidlyspreadthroughoutEurope,andnowadaysitisstillthedominant 242

subtype in many European regions (Simon et al., 2014). Later, in the 1980s, 243

reassortant viruses containing human-seasonal H3N2 surface protein genes in the 244

Europeanavian-likeH1N1backboneemergedandbecameendemicinEuropeanpigs 245

(Simonetal.,2014).Sincethemid-1990s,thoseEuropeanH3N2SIVsreassortedwith 246

a human-seasonal H1N1 virus HA generating the H1N2 virus lineage that became 247

established throughout Europe (Brown et al., 1998, Van Reeth et al., 2000). For 248

many years, those 3 SIV lineages have been co-circulating in the European swine 249

populationkeeping theepidemiological situation rather stable (Simonet al., 2014, 250

Watsonetal.,2015).However,thissituationchangedwithemergenceofthepH1N1 251

virus (Watson et al., 2015). This virus has become endemic in European pigs 252

complicating the swine influenza epidemiology in many cases due to its 253

reassortment with pre-existing H1N1, H3N2 and H1N2 SIVs (Harder et al., 2013, 254

Langeetal.,2013,Morenoetal.,2013,Roseetal.,2013,Simonetal.,2014,Lewiset 255

al.,2016). 256

InNorthAmerica theepidemiological situationwasstable fornearly80years.The 257

“classicalswine”H1N1wasthedominantsubtypeintheUSsinceitsfirstobservation 258

in 1918. However, this situation dramatically changed in 1998, when “triple- 259

reassortant” H3N2 viruses containing gene segments from the “classical swine” 260

H1N1viruses(NP,M,NS),human-seasonalH3N2viruses(PB1,HAandNA)andAIVs 261

(PB2 and PA) became successfully established in the pig populations (Zhou et al., 262

1999, Webby et al., 2000). These “triple-reassortant” H3N2 viruses co-circulated 263

with “classical swine” H1N1 viruses and subsequent reassortments led to the 264

generationandspreadof“triple-reassortant”H1N1orH1N2viruses(Karasinetal., 265

2002, Webby et al., 2004, Vincent et al., 2008). In addition, these H1 “triple- 266

reassortant” viruses also reassorted with human-seasonal H1 viruses generating 267

H1N1andH1N2reassortantscontaininghuman-originH1HA(Lewisetal.,2016).As 268

seen in Europe, the introduction of the pH1N1 virus and its reassortment with 269

endemicNorthAmericanSIVshasalsodeeplychangedswineinfluenzaepidemiology 270

(Kitikoonetal.,2013,Rajaoetal.,2016).ThepH1N1isareassortantvirusoriginated 271

Page 24: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter1

13

inMexican swine by the combination of 2 different swine influenza viruses (SIVs) 272

circulatingintheNorthAmericaandEurope,seefigure4(Smithetal.,2009,Menaet 273

al., 2016). Indeed,novelH3N2,H1N1andH1N2viruses containingpH1N1 internal 274

geneshave spread in theUS swinepopulation andhavebeen recurrently isolated 275

from humans since 2011, raising public health concerns. These viruses with the 276

abilitytoinfecthumansweredenominatedas“variant”viruses(Kitikoonetal.,2013, 277

CentersforDiseaseControlandPrevention,2016). 278

279

280

Figure 4.Origin of the 2009 pandemic H1N1 virus. The NA andM protein-genes 281derivedfromtheEuropean“avian-like”H1N1virusandtheremainingprotein-genes 282derivedfromthoseoftheNorthAmerican“Triplereassortant”H1N2virus(adapted 283fromNeumannetal.,2009). 284 285

InSouthAmericaandAsiatheepidemiologyofSIVs isdifferentwhencomparedto 286

Europe and North America (Pereda et al., 2010, Cappuccio et al., 2011, ). For 287

instance,inAsiavirusesfromEuropeandNorthAmericahavebeenintroducedand 288

co-circulatewith local strains (Yuet al., 2009,Vijaykrishnaet al., 2010,Ngoet al., 289

2012).Inconsequence,theco-circulationofsomanygeneticallydiverseSIVshasled 290

toaverycomplexcollectionofreassortantviruses. 291

292

293

1918 1968 1977 2009European “avian-like”H1N1

2009pandemic H1N1

1984

1994 1998

“Classical”swine H1N1

NorthAmericanavian

Humanseasonal H3N2

PB1PB2

PAHANPNA

NSM

PB1PB2

PAHANPNA

NSM

PB1PB2

PAHANPNA

NSM

PB1PB2

PAHANPNA

NSM

PB1PB2

PAHANPNA

NSM

NorthAmerican“Triplereassortant”H1N2

PB1PB2

PAHANPNA

NSM

Page 25: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Generalintroduction

14

1.3 Interspeciestransmissionandthespeciesbarrier 294

1.3.1 Transmissionfrombirdstomammals 295

InfluenzaAvirusesinfectionsaregenerallyspecies-specific.Thereisastrongspecies 296

barrierthatrestrictsthetransmissiontonovelhosts.Actually,wildaquaticbirdsare 297

considereda reservoir for influenzaA viruses inmammals.However,AIVshave to 298

overcome that strong species barrier to become efficiently adapted tomammals. 299

The likelihoodof theseviruses tosuccessfullyovercomethatbarrierdependson2 300

maintypesofinteractions. 301

Host-hostinteractions: 302

Infections of mammals with AIVs are in most of the cases dead-end events. 303

However, if the interactions between the donor and the recipient hosts become 304

commonitwillincreasethelikelihoodofthevirusestoovercomethespeciesbarrier. 305

Forexample, the live-poultrymarkets (wet-markets)wherechickens,ducks,geese, 306

quails and other species of birds are sold for human consumption have been 307

suggestedasariskfortheintroductionofAIVsintomammals(Offedduetal.,2016). 308

Then, assuming that the virus can be transmitted between individuals of the new 309

hostspecies,infectionswilldependoninteractionsbetweenrecipienthosts. 310

Virus-hostinteractions: 311

Virus-host interactions are the steps that influenza viruses have to accomplish to 312

efficientlyinfectanewhost.First,theseviruseshavetodealwiththemucinspresent 313

in the respiratory tract secretions. Those mucins can specifically bind them 314

interfering their binding to the airway epithelial cells (Yang et al., 2014). The 315

following interaction is the successful attachment to the receptors present on the 316

host cell surface.Once theyhaveentered thecell thevirusesmust takeoverhost 317

cell processes to replicate there. Finally, theyneed to be efficiently released from 318

thecellinordertobeabletoinfectnewcellsandtospread(Kuikenetal.,2014). 319

Themechanisms for adaptation of AIVs tomammals are still largely unknown. To 320

increase the insight in influenza virus transmission 2 contrary experimental 321

approaches are mainly used. The “loss-of-function” approach consists of 322

modifications toviruseswhichhavealreadybeenadapted toanovelhost species. 323

When they do not longer transmit between different subjects, the proteins or aa 324

motifs that are essential for transmission can be identified. In contrast, “gain-of- 325

Page 26: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter1

15

function”(GOF)experimentsaimtoachievetransmissionwithanon-adaptedvirus 326

tobetterunderstandthemechanismsforadaptation(Imaietal.,2013).Whereasthe 327

firstapproachmayincuralowerbiosafetyrisk,thesecondgivesmoreinsightsinthe 328

exactmechanismsthatruletheadaptation. 329

1.3.2 Transmissionbetweenhumansandswine 330

ZoonoticinfectionswithSIVshavebeenreportedworldwidesince1958.In1976,the 331

first large-scale case of transmission of SIV among humans occurred on amilitary 332

base in Fort Dix, New Jersey. Up to 230 soldiers were diagnosed with “classical” 333

H1N1 SIV infection using serological investigation (Gaydos et al., 2006). Later on, 334

swine-to-humantransmissioneventsweresporadic.Until2009,withtheexception 335

oftheSIVoutbreakwhichhadoccurredatFortDix,therewas limitedevidencefor 336

person-to-personspreadofswine-originviruses(KruegerandGray,2013).Thenthe 337

2009 pH1N1 virus appeared and spread worldwide, being the first pandemic 338

influenzavirusofprovenswineorigin(Menaetal.,2016).Furthermore,thepH1N1 339

reassorted with other endemic SIVs generating viruses with the ability to infect 340

humanssuchastheH3N2vthathasbeenisolatedfrom402humansintheUSsince 341

2011 (World Health Organization, 2017a). The emergence of the pH1N1 virus 342

dramatically changed the understanding of SIV ecology and cross-species 343

transmissionbecauseitwasefficientlytransmittedfromswine-to-humans,butalso 344

fromhumans-to-swine. 345

A recent studydemonstrated that transmission fromhumans-to-swine is farmore 346

frequent than the other way around (Nelson and Vincent, 2015). Actually, 347

reassortant viruses containing human-origin gene segments have become 348

widespread in swine worldwide (Watson et al., 2015, Lewis et al., 2016). For 349

instance, the European H3N2 SIVs were generated upon the spread and 350

reassortment of a human-seasonal H3N2 “Port Chalmers/75-like” virus (Brown, 351

2000).However,thelackofsurveillancemakesitdifficulttoaccuratelyestimatethe 352

extentoftransmissionofhuman-seasonalvirusestoswineinthefield.Experimental 353

studies also confirm the susceptibility of pigs to human viruses. In fact, the 354

inoculationofpigswithahumanH3N2orareconstituted1918pandemicH1N1virus 355

resultedintransientfever,mildrespiratorysignsandnasalvirusexcretion.However, 356

thoseviruseswerenotable toachieveefficientpig-to-pig transmission (Landoltet 357

Page 27: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Generalintroduction

16

al., 2006, Weingartl et al., 2009). Although it has been demonstrated that 358

transmissionofinfluenzaAvirusesbetweenpigsandhumansoccurs,untilnowonly 359

thepH1N1hasbeendemonstratedtobeabletoefficiently transmitandspread in 360

bothspecies. 361

1.3.3 Avianinfluenzaviruseswithpandemicpotential 362

Between1959and1996only3casesofAIVsinfectinghumanshavebeenreported. 363

Consequently,AIVswereconsideredasalowriskforhumanhealth.However,since 364

thefirst isolationofanH5N1HPAIVinHongKongin1997,AIVsbecameacauseof 365

concern. Furthermore, the number of zoonotic AIV infections has dramatically 366

increased during the last decade. This section will highlight the avian influenza 367

subtypes with the highest pandemic potential according to the World Health 368

Organization(WHO)(WorldHealthOrganization,2017a). 369

H5Subtype 370

Sofar,onlyinfluenzaAH5N6andH5N1virussubtypeshavebeenreportedtoinfect 371

humans (Yang et al. 2015, World Health Organization, 2017a). Since 2014, H5N6 372

HPAIVs havebeen sporadically isolated fromhumans in China, but the number of 373

cases and their geographical spread remain very limited. In contrast, the H5N1 374

HPAIVsareontopofthelistofavianinfluenzasubtypeswiththepandemicpotential 375

(World Health Organization, 2017a). As mentioned, the first human outbreak 376

producedbyH5N1HPAIVsoccurred inHongKong in1997, causing severedisease 377

withhighfatalityrates(around60%)(Claasetal.,1998,Subbaraoetal.,1998).This 378

H5N1viruswas indeeda reassortantviruscontainingaH5HAderived fromgoose 379

H5N1virusandtheremaininggenesfromH9N2andH6N1virusesprevalentinquail, 380

as shown in Figure 5 (Guan et al., 1999, Hoffmann et al., 2000). Wet markets 381

appearedtobethesourceofthehumaninfection(Shortridge,1999).Althoughthe 382

outbreakwasabortedwiththecullingof1.5millionpoultryinfarmsandmarketsof 383

HongKong,H5N1HPAIVwasagainreportedinhumansinHongKongin2003(Peiris 384

etal.,2004). 385

386

Page 28: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter1

17

387

Figure5.OriginandsourcesfortheH5N1HPAIV. 388

389

Later, human cases have also been reported in Vietnam, Thailand, Cambodia, 390

Indonesia,Turkey, Iraq,Azerbaijan,Egypt,DjiboutiandNigeria (Peirisetal.,2007). 391

As ofMay 2017 a total of 859 human cases have been reported worldwide, 453 392

(52.8%) of whom died (World Health Organization, 2017b).Most of those human 393

cases were associated with direct contact with infected poultry and efficient 394

transmissionwithin humanswas never reported.However, the evolution ofH5N1 395

viruses is quick and its direction is still unclear. Significant genetic and antigenic 396

evolution has occurred (Guan et al., 2004), involving antigenic drift in the HA, 397

mutations inothergenes,andreassortmentwithotherAIVs (Chenetal.,2006,de 398

Vriesetal.,2015).Eventhoughmammalianadaptationmarkershavebeendetected 399

insomehumanandavianHPAIVH5N1isolates,andhuman-to-humantransmission 400

betweenfamilymembershasbeenreported,thereisnosustainedhuman-to-human 401

transmission(Ungchusaketal.,2005,Wangetal.,2008). 402

In order tounveil the requirements for transmissionofH5N1HPAIV in humans, 2 403

differentGOF approacheswere tested in ferrets, as they are considered themost 404

important animal model for influenza transmission studies (Belser and Tumpey, 405

2017). In the first approach, Herfst et al. demonstrated efficient airborne 406

transmission between ferrets of an avian H5N1 HPAIV containing only 5 aa 407

substitutions.ThosemutationswerepresentintheHAandthePB2gene-proteins,3 408

outof5wereartificiallyintroducedinthevirusandtheremaining2emergedafter 409

Quail& H9N2&virus&

Quail& H6N1&virus&

H5N1&virus&Goose&

Domes6c&chicken& H5N1&HPAIV&virus&

Se@ng:&Habitats'shared'by'wild'and'domes2c'birds'and/or'live'bird/poultry'markets'

Page 29: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Generalintroduction

18

10passagesand3 transmissionexperiments (all aamutationsmentioned in those 410

adaptationexperimentswill bedescribed inChapter1.4) (Herfst et al., 2012). The 411

secondapproachevaluatedifH5N1virusescouldbecomeairbornetransmissiblein 412

ferrets upon reassortment with contemporary human influenza viruses, with or 413

without mammalian adaptation substitutions. On one hand, Imai et al. achieved 414

efficientairbornetransmissionto4outof6contactferretsaftertheintroductionof 415

4 aa mutations in the HA of a reassortant virus containing H5 HA in the pH1N1 416

backbone(Imaietal.,2012).Ontheotherhand,Chenetal.reachedpartialairborne 417

transmission in ferretsby introducingkeypointmutations in theH5HARBSanda 418

human-seasonal H3N2 NA gene (Chen et al. 2012). In summary, these studies 419

demonstrate that H5N1 viruses can become adapted to ferrets in the laboratory 420

eitheruponreassortmentwithhuman-adaptedviruses(withtheneedforadditional 421

substitutions)oronlybytheintroductionofcertainkeyaamutations. 422

H7subtype 423

Morethan100humaninfectionswithH7N1,H7N2,H7N3andH7N7subtypeshave 424

been reported in Australia, Canada, Italy, Mexico, the Netherlands, the United 425

Kingdom and the US. Most of these infections were associated with poultry 426

outbreaksandresulted inconjunctivitisandmildupperrespiratorysymptomswith 427

the exception of 1 death that occurred in the Netherlands (Fouchier et al., 2004, 428

Stegemanetal.,2004,Nguyen-Van-Tametal.,2006,Ostrowskyetal.,2012). 429

On March 2013, a novel influenza H7N9 LPAIV crossed the species barrier and 430

caused for the first time human infections in China (Gao et al., 2013). Until May 431

2017, 1486 laboratory-confirmed human infections, including at least 571 deaths 432

(40.1%),havebeenreportedinChina(WorldHealthOrganization,2017a).Thisvirus 433

waslikelytransferredfromdomesticduckstochickensbefore“jumping”tohumans 434

anditwastheresultofthereassortmentofatleast4originviruses.Thisresultedin 435

anH7N9viruswithaduckoriginH7HA,aduckorigin(probablyalsowildbird)N9NA 436

and2differentchickenoriginH9N2virusesinternalgenes,seeFigure6(Lametal., 437

2013,Liuetal.,2013). 438

439

Page 30: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter1

19

440

Figure 6. Origin and sources for the H7N9 influenza virus. (Adapted from Dan 441Higgins/PHILCDC). 442

443

Epidemiologicalevidencehaslinkedhumancaseswithexposuretolive-birdmarkets 444

(Shi et al., 2013). The closure of these markets, with the likely assistance of 445

environmental factors, helped to control the first wave of the outbreak from 446

FebruarytoMay2013(Yuetal.,2014).Nevertheless,publichealtheffortsfailedto 447

completely stop the spread of humanH7N9 infections and up to now 5 epidemic 448

waves have been recorded. Although sporadic H7N9 virus transmission among 449

family members has been reported, the likelihood of sustained human-to-human 450

transmissionislow(Qietal.,2013,WorldHealthOrganization,2017a). 451

Soonafteritsemergenceinhumans,severalstudiesevaluatedairbornetransmission 452

ofavian-originH7N9virusesamongferrets(Richardetal.,2013,Belseretal.,2013, 453

Zhuetal.,2013,Kuetal.,2014,Siegersetal.,2014). Interestingly,despitethefact 454

thatmutations associatedwith increasedhumanadaptationwerepresent inmost 455

humanH7N9virusisolates,efficienttransmissioninferretswasneverachieved(Luk 456

etal.,2015,NeumannandKawaoka,2015).Hence, it isstillunclearwhetheravian 457

H7N9virusescouldbecomeadaptedtomammals.However,aslongasthoseviruses 458

continuecirculatinginpoultry,humancasescanbeexpected. 459

H9N2subtype 460

H9N2 AIVs are endemic in wild waterfowl worldwide. This subtype has become 461

endemic in different land-basedpoultry species acrossmultiple Eurasian countries 462

Se#ng:'Habitats'shared'by'wild'and'domes2c'birds'and/or'live'bird/poultry'markets'

Page 31: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Generalintroduction

20

(Guanet al., 1999, Sun et al., 2010, Sun and Liu, 2015,VanBormet al., 2016). In 463

1999, H9N2 viruses were first isolated from humans in Hong Kong (Peiris et al., 464

1999).Since then,only29humancaseshavebeenreportedandhuman-to-human 465

transmission has never been described (WorldHealthOrganization, 2017a). These 466

infectionswereassociatedwithpoultryoutbreaksandmainlyresultedinmildupper 467

respiratory symptoms. Strikingly, a seroprevalence for H9N2 antibodies between 468

2.1%and13.7%hasrecentlybeenidentifiedamongpoultryslaughterhouseworkers 469

inChina(Huangetal.,2013).This findingsuggeststhatH9N2infections inhumans 470

gofrequentlyunreported.Asamatteroffact,mostoftheH9N2AIVscirculatingin 471

poultrypossessanaasubstitutionintheHARBSthatwasdescribedasamolecular 472

markerforhumanadaptation,therebyincreasingthepossibilityofthesevirusesto 473

infecthumans(Matrosovichetal.,2001,WanandPerez,2007).Interestingly,these 474

viruseswerealsorecurrentlyisolatedfrompigsinChinasince1998. 475

As in H5 and H7 experimental studies, different approaches were also tested to 476

evaluatepotentialofH9N2virusestobecomeadaptedtomammals.In2008,Wanet 477

al.evaluatedvirusreplicationandtransmissioninferretsofdifferentH9N2wild-type 478

virusestogetherwithareassortantcontainingH9N2HAandNAinahuman-seasonal 479

H3N2backbone.Althoughthereassortantvirusreplicatedbetterthanthewild-type 480

viruses,efficient transmissionwasnot reached (Wanetal., 2008). Later,upon ten 481

passagesof this reassortant in ferrets thevirusacquired2aamutations in theHA 482

and1intheNAthatwererelatedwithefficientairbornetransmission(Sorrelletal., 483

2009).Inalaterexperimentthesamegroupdemonstratedtestedthecompatibility 484

ofthepreviouslyusedwild-typeH9N2withpH1N1internalgenes.Interestingly,this 485

reassortantvirusshowedefficientairbornetransmission in ferretswithnoneedof 486

adaptive mutations. Moreover, this experiment also suggested that an optimal 487

balancebetweenHAandNAactivity is required forefficientairborne transmission 488

(Kimble et al., 2011). In addition, in 2013 different H9N2 strains were tested for 489

replicationandtransmission inducks,pigs,miceandferrets inordertoestablisha 490

rankingofH9N2virusesthathavethehighestpandemicpotential.Attheendofthe 491

experiment, thehumanH9N2 virus isolateswereon topof the list, but still those 492

isolateswerenotasfitasthemammalian-adaptedstrains(TheSJCEIRSH9working 493

group,2013).Insummary,efficientH9N2adaptationtoferretshasbeenachievedby 494

Page 32: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter1

21

reassortment with human-adapted viruses (with or without adaptive mutations). 495

However, unlike in the H5N1 subtype, aa mutations that could confer efficient 496

adaptationtothosevirusesarestillunknown. 497

498

1.4 Molecularmechanismsofhostrangerestriction 499

1.4.1 Theroleofthehemagglutinin 500

ThemainSiasrecognizedbytheHAaretheN-acetylneuraminicacid(Neu5Ac)andN- 501

glycolylneuraminicacid(Neu5Gc)(Matrosovichetal.,2015).InfluenzaAvirusescan 502

recognize the Sias bound to galactose in either anα2,3- orα2,6-glycosidic linkage 503

(Connoretal.,1994,Matrosovichetal.,2009).Theselinkagesareveryimportantfor 504

thespecificityof theHAmolecules in thebinding tocell surfacesialicacids.While 505

AIVs demonstrated highest preference for the α2,3Gal-linked Sias (Siaα2,3Gal), 506

humanandswinevirusespreferentiallybindα2,6Gal-linkedSias(Siaα2,6Gal)(Skehel 507

and Wiley, 2000). The RBS is a shallow pocket placed in the HA1 that mediates 508

bindingtoSiaspresentonhostcellglycoproteinsandglycolipids(Matrosovichetal., 509

2015).TheaaresiduesmakingupthisRBSshowedtobeveryconservedandsimilar 510

regardlessofthevirussubtypestudied(Figure7). 511

512Figure7.Surface representationof theRBS in theHA1monomerofA/quail/Hong 513Kong/G1/1997 (H9N2) bearing an α2,6-linked sialic acid. The major structural 514components of the RBS are represented with the following colours: the central 515bottominblue(aminoacids(aa)98,153,183and195),therearinyellow(aa155, 516190and194),therightsideinpurple(aa134until138)andtheleftsideinred(aa 517224until228)(SkehelandWiley,2000). 518

Α2,6Gal(linked.Sialic.acid..

Page 33: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Generalintroduction

22

Therefore, aa changes in and around the RBS can dramatically alter the receptor 519

binding preference of influenza viruses. Thus, a change in the receptor-binding 520

preference of an influenza virus owing tomutations in the RBS is inmost cases a 521

prerequisiteforovercomingthespeciesbarrier.ForH2andH3HAs,thesubstitutions 522

HA-Q226LandHA-G228S(allaapositionsarereferredtoH3numbering)havebeen 523

describedtoconferacompleteswitchfromSiaα2,3GaltoSiaα2,6Galbinding(Vines 524

et al., 1998). Furthermore, in H9 and H7 subtypes HA-Q226L substitution also 525

increasedSiaα2,6Galbinding invitro(WanandPerez,2007,Liuetal.,2014).Inthe 526

caseofH1HAs, theHA-E190Dand theHA-D225G substitutionsare critical for the 527

shift fromavian tohuman receptor recognition (Glaseretal.,2005,Stevensetal., 528

2006).However,themechanismsthatrulethespecificaathatdeterminereceptor- 529

binding specificity within the RBS are not completely understood as described 530

mutations vary among the different HA subtypes or even virus strains. Table 2 531

summarizes the main RBS aa mutations described as important for mammalian 532

adaptationofdifferentHAsubtypes. 533

TheHAproteinalsomediates the fusionof theviralenvelopewith theendosomal 534

membrane derived from the host cell. This fusion is influenced by the HA heat 535

stabilityandthepHatwhichHAexperimenttheconformationalchangeswithinthe 536

endosome.Different influenzaviruseshavedifferentactivationpHvalueranges, in 537

avianvirusesitrangesfrom5.5to6.0whileinhumanvirusespHvaluesrangesvary 538

from5.0to5.5(Russieretal.,2016).RecentstudiesdemonstratedthatHAstability 539

played a role in H5N1 virus adaptation in ferrets (Imai et al., 2012, Herfst et al., 540

2012). Inparticulartheauthorsfoundthatmutations intheHARBSthat improved 541

human-type receptor binding had an unfavourable effect in HA stability that 542

required compensatory mutations to offset the virus fitness. Those results were 543

further supported by the description of 8 aa substitutions that emerged after 544

adaptationofEuropeanavianlikeH1N1virusintoswineandthatinducedchangesin 545

HA stability (Baumann et al., 2015). Collectively, these findings suggest that the 546

optimumpHforfusionandHAstabilitymaybecriticaltoensurevirustransmission 547

inanewhost. 548

549

550 551

Page 34: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter1

23

Table2.VirusmutationsintheHARBSthathavebeendescribedaskeymarkersfor 552theadaptationofavianinfluenzaAvirusestomammals. 553

554

1.4.2 Theroleoftheneuraminidase 555

TheNAenzymaticactivityisessentialfortheoptimalreleaseofthevirusesfromhost 556

cells, aswell as for the escape fromextracellular inhibitors and the prevention of 557

self-aggregation(Colman,1994,Yangetal.,2014).Manystudiessuggestedthatan 558

optimalbalancebetweentheHAandtheNAactivitiesisrequiredforefficientvirus 559

replicationandtransmission(Wagneretal.,2002).Thisbalancecanbedisturbedby 560

reassortment or transmission to a new hostwith a different set of receptors. For 561

instance, theNAproteins ofmost influenza viruses havehigher enzymatic activity 562

MutationVirus

subtype

Modelused

inthestudy

Effectoftheaasubstitutiononthevirusreceptor

preferenceReferences

A138S H1N1H5N1

MutationpresentinearliestH1N1humanisolatesandinH5N1subtypeaftertenpassagesinferrets.IncreasedaffinityforSiaα2,6Gallinkages.

Matrosovichetal.,1997Herfstetal.,2014

E190D/N/V H1/H9N2

CrucialforadaptationofH1subtypetomammals(togetherwithG225D).Importantmarkerfor

mammalianadaptationofH9N2(togetherwithQ226L).

Matrosovichetal.,2000Cauldwelletal.,2014Lakdawalaetal.,2015

N224K H5N1

IncreasedtheaffinityofH5N1forSiaα2,6Gal(togetherwithQ226L). Imaietal.,2012

D225G H1/H9N2

CrucialforadaptationofH1subtypetomammals(togetherwithE190D).Relatedwithhighervirulencein

humanpatientsandwithenhancedaffinityforSiaα2,3Gal.

Matrosovichetal.,2001Liuetal.,2010Lakdawalaetal.,2015Iovineetal.,2015

Q226L

H3N2H2/H9N2H7N9H5N1

CrucialforadaptationofH3N2subtypetomammals(togetherwithG228S).IncreasedtheaffinityofH5N1,

H7N9andH9N2forSiaα2,6Gal.

Connoretal.,1994Matrosovichetal.,2000WanandPerez,2007Herfstetal.,2012Imaietal.,2012Chenetal.,2012Lametal.,2013Liuetal.,2014

S227N H5N1

IncreasedSiaα2,6Galaffinity. Yamadaetal.,2006

G228SH3N2H2/H5N1

EnhancedSiaα2,6Galaffinity(togetherwithQ226L).

Connoretal.,1994Suzukietal.,2000Herfstetal.,2012Chenetal.,2012

*Nonpolarhydrophobicaa:glycine(G),alanine(A),valine(V),leucine(L),phenylalanine(P),tyrosine(Y)andisoleucine(I).Polarhydrophilicaa:serine(S),threonine(T),asparagine(N),glutamine(Q).Negativelychargedaa:asparticacid(D),glutamicacid(E).Positivelychargedaa:lysine(K),arginine(R),histidine(H).

Page 35: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Generalintroduction

24

againstSiaα2,3Gal,whichmaybeexplainedbytheneedtoovercometheSiaα2,3Gal 563

richmucinsintheupperrespiratorytract(URT)(Richardetal.,2014).However,the 564

human derived N2 and the pH1N1 N1 NAs showed enhanced activity against 565

Siaα2,6Gal that balances the marked Siaα2,6Gal HA activity (Kobasa et al., 1999, 566

Garciaetal.,2014).Additionally,bypassagingreassortantviruseswithavianHAand 567

humanNAitwasshownthatreplicationwasreconstitutedwhenmutationsoccurred 568

in HA and/orNA,which led to a functional balance (Shtyrya et al., 2009). On the 569

otherhand,Herfstetal.andKimbleetal.describedefficienttransmissioninferrets 570

ofH5N1andH9N2virusescontainingpurelyavianNAs(Herfstetal.,2012,Kimbleet 571

al.,2013).ThesefindingssuggestthatadaptationofNAisnotmandatorytoachieve 572

mammalianadaptationofAIVs.However,theexactnatureofthechangesintheNA 573

that are needed to achieve efficient adaptation of AIVs to humans is not fully 574

understood. 575

1.4.3 Theroleofthepolymeraseproteinsandtheinternalgenes 576

The PB2 gene, in particular the aa residue 627, has been appointed as the main 577

polymerase determinant for influenza adaptation to a new host (Subbarao et al., 578

1993, Cauldwell et al., 2014). Mammalian viruses typically contain PB2-627K 579

whereas avian viruses possess PB2-627E. The presence of PB2-627E restricts 580

replication at 33o C, the temperature of the humanURT. (Cauldwell et al., 2014). 581

Sculletal.(2010)foundthatthePB2-K627Eresultedinrestrictedreplicationofthe 582

virusinhumanrespiratoryepithelialcells,regardlessofthetemperatureconditions 583

(32oCversus37oC).Interestingly,thepH1N1didnotcontainthismutation.However, 584

tocompensateforthelackofPB2-627K,pH1N1containsthePB2-Q591Ksubstitution 585

(Moncorge et al., 2013). In addition to those mutations, PB2-D701N was 586

demonstratedtoenhancethebindingofPB2toimportinα(Moncorgeetal.,2010). 587

The importinα is responsibleprotein for themigrationof thePB2 to thenucleus, 588

thusthePB2-D701Nsubstitutionimprovesnuclearlocalizationofthepolymerasein 589

mammaliancells. 590

Thecompleteinternalgenecassettehasbeenalsodemonstratedtoberelevantfor 591

the adaptation of avian viruses to mammals. In 2009, Sorrell et al. obtained an 592

efficient ferret-to-ferret droplet transmission of the reassortant H9N2 virus 593

containinghuman-seasonalH3N2 internalgenesaftertenserialpassages in ferrets 594

Page 36: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter1

25

(Sorrelletal.,2009).Additionally,since2011,H3N2vandH1N2vvirusescontaininga 595

pH1N1-origin M gene have been recurrently isolated from humans (Centers for 596

Disease Control and Prevention, 2016). This finding put the attention on those 597

viruses and their “quadruple-reassortant” internal genes. Moreover, while pH1N1 598

viruses efficiently transmit among ferrets, a reassortant possessing the North 599

American“triple-reassortant”originNAandMgenesvirusisolatedfromhumansdid 600

nottransmittoallexposedferrets(Lakdawalaetal.,2011).Italsosuggestedthatthe 601

European“avian-like”swineNAandMgenescontributedtotheimprovementofthe 602

transmissionof theseviruses,at least intheferretmodel.This isconsistentwitha 603

study that demonstrated the importance of the pH1N1 NA and M genes for 604

replicationandtransmissionofH9N2reassortantvirusesinpigs(Maetal.,2012).In 605

more recent studies performed in pigs and ferrets reassortant viruses containing 606

avianH9N2orH5N1HA andNA in the pH1N1backbone, an improved replication 607

andtransmissionwasdemonstratedwhencomparedtotheparentalviruses(Qiaoet 608

al.,2012,Abenteetal.,2016,Imaietal.,2012).Tosumup,thepeculiarcombination 609

ofinternalgenesthatispresentinthepH1N1maybeanadvantagefornovelHAand 610

NAgenestoovercomethespeciesbarrier. 611

612

1.5 Adaptationofavianinfluenzavirusestoswine 613

1.5.1 Naturalinfectionofpigswithavianinfluenzaviruses 614

Infections of pigswith AIVs in nature have been recurrently documented. In fact, 615

“avian-like”H1N1virusesemergedfrombirdsandbecameendemicinpigsinEurope 616

and Asia (Lewis et al., 2016). Since 1998, H9N2 influenza viruses have been 617

recurrentlyisolatedfrompigsinHongKongandChina.Thissubtypeis,togetherwith 618

“avian-like” H1N1, the AIV subtypemost frequently reported in pigs (Peiris et al., 619

2001,Yuetal.,2008b,Yuetal.,2011).Inaddition,recentserologicalstudiesinpigs 620

revealedaprevalencefrom4.9%upto15.6%forantibodiesagainstH9N2virusesin 621

slaughterhousesinChina(Lietal.,2015,Wangetal.,2016).H1N1,H3N3andH4N6 622

waterfowl-origin influenzaviruseswere recovered inpig farms inCanadabetween 623

1999 and 2002 (Karasin et al., 2000a, Karasin et al., 2000b, Karasin et al., 2004). 624

Although serological data suggested transmission of H4N6 between pigs, the 625

infection was not sustained (Karasin et al., 2000b). In China, an H10N5, probably 626

Page 37: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Generalintroduction

26

originatingfromduckswasisolatedin1pigattheslaughterhousein2010(Wanget 627

al.,2012).HPAIVhavebeenalsoreportedtoinfectpigsinnature.In2003,whilean 628

H7N7 caused outbreaks in poultry in the Netherlands, anti-H7N7 antibodies were 629

detected inpigshoused close to infectedpoultry farms (Loeffenet al., 2004). The 630

source appeared to be the feeding of the pigs with broken eggs from infected 631

poultry. Furthermore, during the H5N1 outbreaks in South-Eastern Asia, these 632

viruseswere isolated frompigs in IndonesiaandChina (Zhuetal.,2008,Shietal., 633

2008, Takano et al., 2009). In addition, serological investigations in Vietnamese 634

slaughterhouses located in the neighbourhood of H5N1 HPAIV reported areas, 635

confirmedalimitednumberofanimals(8outof3175)tobeseropositive(Choietal., 636

2005). 637

Reassortantvirusescontainingavian-origingeneshavebeenalsoisolatedfrompigs 638

worldwide. Actually, European H3N2 and H1N2 subtypes, North American “triple- 639

reassortant” and pH1N1 viruses contain avian-origin genes (Watson et al., 2015, 640

Lewis et al., 2016). In addition, other reassortant viruses containing avian-origin 641

genes have been isolated from swineworldwide but only as dead-end infections. 642

H3N1 viruses containing human-originH1N1 (NA), turkey-originH3N2 (HA andM) 643

and the remaining genes of swine-origin were isolated in North America, 2003 644

(Lekcharoensuk et al., 2006). Later, in 2006,H2N3 reassortantswere also isolated 645

(Maetal.,2007).In2008,2H5N2influenzaviruseswereisolatedfrompigsinSouth 646

Korea.Thegenomeof1 isolatewasentirelyofavianorigin,while theotherwasa 647

reassortant virus containing swine-origin H3N1 PB2, PA, NP andM genes and the 648

remaininggenesfromanavianH5N2virus(Leeetal.,2009).Thesourceofinfection 649

ofpigswiththeAIVsremainedunclearinmostcases.Onlyin2casessurfacewater 650

usedforwateringoftheanimalswasthesuspectedroutefortheintroductionofthe 651

avianvirusesintothepigs(Karasinetal.,2000a,Maetal.,2007). 652

InmostcasestheinfectionofpigswithAIVsresultedsubclinicalorverymilddisease 653

(Karasinetal.,2000a,Karasinetal.,2004,Xuetal.,2004,Maetal.,2007,Congetal., 654

2008,Leeetal.,2009).However,aspointedbytheserologicalstudiessomenatural 655

infectionswithAIVmaybeclinicallyunnoticedinpigs(Peirisetal.,2001,Choietal., 656

2005,Wangetal.,2016).So far,mostof thewhollyAIVs isolated inpigswerenot 657

abletoestablishthemselvesinswinepopulations(Guanetal.,2009,Yuetal.,2009), 658

Page 38: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter1

27

buttherecurrenttransmissionofthosevirusestopigsmayincreasetheriskforthe 659

adaptation. 660

1.5.2 Experimentalinfectionsofpigswithavianinfluenzaviruses 661

ExperimentalstudiesalsodemonstratedthesusceptibilityofpigstoAIVS.Infact,the 662

first experimental evidence of the susceptibility of pigs to LPAIV was provided in 663

1981. After intranasal inoculationwith several H1N1,H2N3,H3N2 andH7N7AIVs 664

pigsdidnotshowclinicaldiseasesymptoms,butnasalvirussheddingwasreported 665

for up to 7 days post-inoculation (dpi) (Hinshaw et al., 1981). Those results were 666

confirmedlater,in1994byKidaandcolleagues.Twentynine(includingatleast1of 667

eachHA subtype, fromH1 toH13)outof 38 LPAIV fromvariouswildbird species 668

were shed up to 7 dpi and induced a serological response in pigs after intranasal 669

inoculation. Again, the infectionwas subclinical. These results suggested that pigs 670

could be susceptible to AIVswith non-mammalianHA subtypes.Moreover, itwas 671

evidencedthatcombinedinfectionofpigswithH1N1SIVandH3N8AIVresultedin 672

thegenerationofanH3N1reassortantwithefficientreplicationinswine(Kidaetal., 673

1994). 674

Later, since the isolation of H5 andH7HPAIVs from humans, the susceptibility of 675

swinetothoseviruseswasexaminedbyevaluatingwhetherthosevirusesmaypose 676

ariskforthepigpopulation.For instance,rightaftertheH7N7HPAIVwas isolated 677

from poultry in Belgium and the Netherlands in 2003, Loeffen and colleagues 678

inoculatedpigsintranasallywiththevirusleadingtovirusreplicationandshedding. 679

However,pigsdidnotget sickand thevirusdidnot transmitatall (Loeffenetal., 680

2004). Similar resultswere obtained in experimental infections of pigswith H5N1 681

HPAIVs isolated fromVietnamandThailand (Choietal.,2005).Finally,Lipatovand 682

colleagues infected pigswith 4H5N1HPAIV isolates fromhumans and birds from 683

Asia in 2003-2005 (Lipatov et al., 2005). The intranasal inoculation provokedmild 684

weightlossandnasalsheddingwith3outof4viruses.Ontheotherhand,intranasal 685

inoculation of pigs with the wholly avian-origin and the avian-swine reassortant 686

H5N2viruses isolated frompigs inKorea in2008 resulted inmild symptoms.Both 687

viruseswereshedforatleast5days,butonlythereassortantviruswastransmitted 688

to contact pigs. This suggests that swine-origin internal genes may give LPAIVs a 689

selectiveadvantagethatfacilitatespig-to-pigtransmission(Leeetal.,2009). 690

Page 39: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Generalintroduction

28

In2009,theemergenceofpH1N1virusboostedresearchontheadaptationofAIVs 691

to swine. That year, De Vleeschauwer et al. demonstrated pig susceptibility to 692

differentAIVsubtypes.However,thosevirusesdidnotinducediseaseandwerenot 693

transmitted (De Vleeschauwer et al., 2009). In addition, due to their recurrent 694

isolationsfromhumansandpigs,avianH9N2viruseswerealsoproposedtohavethe 695

potentialtobecomeadaptedtopigs.Forinstance,severalinvivoandinvitrostudies 696

demonstratedthatthosevirusespossessinternalandsurface-geneproteinsthatare 697

compatible with other subtypes genes. This increases the possibility of the 698

generationofa transmissibleviruswithanovelHAandNA, towhichhumansand 699

swine are immunologically naïve. In experimental conditions pigs were also 700

susceptibletoH9N2viruses.UnlikeinferretstheHA-Q226Lmutationdidnotseem 701

tobe restrictive (TheSJCEIRSH9WorkingGroup,2013,Wangetal.,2016). Like in 702

other hosts the wild-type H9N2 influenza viruses showed very limited pig-to-pig 703

transmission. Though other reassortment experiments demonstrated that pH1N1 704

internalgenesincreasedtransmission, itwasmuchlessefficientthanthatofswine 705

adaptedH1N1viruses.Interestingly,reassortantvirusescontainingH9N2HAandNA 706

in the backbone of pH1N1 demonstrated higher transmission efficiency when 707

comparedtotheoriginalH9N2(Qiaoetal.,2012,Obadanetal.,2015).Thisfinding 708

suggeststhatpH1N1internalgenesmayposeanadvantageintheadaptationofAIVs 709

to pigs. This hypothesis was also tested in pigs infected with reassortant viruses 710

containing H5N1 HA and NA and pH1N1 internal genes. This reassortant also 711

presentedenhancedreplicationwhencomparedtotheparentalH5N1.However,the 712

transmission efficiency was still lower when compared to that of endemic SIVs 713

(Abenteetal.,2016). 714

WhileH7N9viruseshadneverbeenisolatedfrompigsinnature,thoseviruseswere 715

able to replicate in the swine URT after experimental inoculations. After their 716

introduction in pigs those viruses readily changed, but efficient transmission was 717

neverachieved(Zhuetal.,2013,Liuetal.,2014,Siegersetal.,2014,Xuetal.,2014). 718

Insummary,asseeninfield,pigsaresusceptibletoabroadrangeofAIVsalsounder 719

experimentalconditions.Nevertheless,thechangesthatarerequiredtomakethose 720

virusestransmitefficientlybetweenpigsarenotknown. 721

722 723

Page 40: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter1

29

1.5.3 Theroleofthepigintheadaptationofavianinfluenzavirusestomammals 724

Fora longtime,swinehavebeenconsideredtoplayaroleasa“mixingvessel”for 725

avianandhuman influenzavirusesoras intermediatehost for the transmissionof 726

AIVstohumans.ThishypothesiswasfirstenunciatedbyScholtissekandcolleagues. 727

ItwasbasedontherescueofatemperaturesensitiveNPmutantofanavianH7N1 728

virus by co-infections of chicken embryo fibroblasts with either avian, human or 729

swineH3N2isolates.TheyfoundthattheviruscouldberescuedbyallAIVs,bynone 730

of thehumanvirusesandby2outof10SIVs.Thus, theyproposed that theNPof 731

SIVshadabroaderhostrangeregardingitscompatibilityinreassortantvirusesand 732

thatpigswereapotential “mixingvessel” for thegenerationof thosereassortants 733

(Scholtisseketal.,1985).This“mixingvessel”hypothesiswasfurthersupportedby 734

thesubtypesimilaritiesbetweenswineandhumaninfluenzaviruses,thefindingthat 735

pigscouldbesimultaneouslyinfectedwithSIV,AIVand/orhumaninfluenzaviruses 736

and the frequent isolation of reassortant viruses from pigs (Kida et al., 1994). In 737

1998, Ito et al. gave molecular support to this hypothesis demonstrating the 738

presence of both Siaα2,3Gal and Siaα2,6Gal receptors in the pig trachea. 739

Furthermore, they demonstrated that some “avian-like” SIV acquired molecular 740

traitsofhumanadaptationbycontinuousreplicationinpigtrachealexplants(Itoet 741

al., 1998). Therefore, the pigmay also act as an intermediate host in which AIVs 742

mightgainmammalianadaptationtraits.However, laterstudiesdemonstratedthat 743

thepresenceofbothSiareceptorswasrestrictedtothebronchiolesandalveoliand 744

that the distribution of Sia receptors in swine resembles the one of human and 745

ferrets(vanRieletal.,2007,VanPouckeetal.,2010,Nellietal.,2010,Trebbienet 746

al.,2011). 747

The emergenceof the 2009pH1N1 virus in swine increased the concern again on 748

pigs as source for pandemic viruses (Smith et al., 2009, Mena et al., 2016). 749

Nowadays,thishypothesishasstillnotbeenprovenandtheexactroleofthepigin 750

the generation of pandemic viruses remains unknown.Nevertheless, the pig is an 751

importantnaturalhostforinfluenzaAvirusesandduetoitssimilaritieswithhumans 752

in terms of anatomy, physiology and immunology they may be an incomparable 753

animalmodeltobetterunderstandtheadaptationofAIVstomammals. 754

755

Page 41: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Generalintroduction

30

1.6 References 756

Abente,E.J.,Kitikoon,P.,Lager,K.M.,Gauger,P.C.,Anderson,T.K.etal.(2016).Ahighly 757pathogenic avian influenza virus H5N1 with 2009 pandemic H1N1 internal genes 758demonstratesincreasedreplicationandtransmissioninpigs.JGenVirol,98(1),b18-30. 759 760

Alexander,D. J. (2000).Areviewofavian influenza indifferentbirdspecies.VetMicrobiol, 76174,3-13. 762

763Alexander,D.J.andBrown,I.H.(2009).Historyofhighlypathogenicavianinfluenza.RevSci 764

Tech,28,19-38. 765 766Baumann, J., Kouassi,N.M., Foni, E., Klenk,H.D.&Matrosovich,M. (2015).H1N1 Swine 767

Influenza Viruses Differ fromAvian Precursors by a Higher pHOptimumofMembrane 768Fusion.JVirol,90,1569-77. 769

770Belser,J.A.,Gustin,K.M.,Pearce,M.B.,Maines,T.R.,Zeng,H.etal.(2013).Pathogenesis 771

andtransmissionofavianinfluenzaA(H7N9)virusinferretsandmice.Nature,501,556- 7729. 773

774Belser, J.A.andTumpey,T. (2016).Mammalianexperimentalmodelsand implications for 775

understandingzoonoticpotential.In:Swayne,D.E.(Ed.)Animalinfluenza.Firsted.John 776WileyandSons,Ames,Iowa,594-619. 777

778Boulo,S.,Akarsu,H.,Ruigrok,R.W.andBaudin,F.(2007).Nucleartrafficofinfluenzavirus 779

proteinsandribonucleoproteincomplexes.VirusRes,124,12-21. 780 781Brown, I. H., Harris, P. A., McCauley, J. W. and Alexander, D. J. (1998). Multiple genetic 782

reassortmentofavianandhuman influenzaAviruses inEuropeanpigs, resulting in the 783emergenceofanH1N2virusofnovelgenotype.JGenVirol,79(Pt12),2947-55. 784

785Brown, I. H. (2000). The epidemiology and evolution of influenza viruses in pigs. Vet 786

Microbiol,74,29-46. 787 788Cappuccio,J.A.,Pena,L.,Dibarbora,M.,Rimondi,A.,Pineyro,P.etal. (2011).Outbreakof 789

swine influenza in Argentina reveals a non-contemporary human H3N2 virus highly 790transmissibleamongpigs.JGenVirol,92,2871-8. 791

792Cauldwell,A.V., Long, J. S.,Moncorge,O.andBarclay,W.S. (2014).Viraldeterminantsof 793

influenzaAvirushostrange.JGenVirol,95,1193-210. 794 795Centers for Disease Control and Prevention. (2016). Situation Summary on Influenza A 796

(H3N2) Variant Viruses ("H3N2"). Available: http://www.cdc.gov/flu/swineflu/h3n2v- 797situation.htm 798

799Chen,H.,Li,Y.,Li,Z.,Shi, J.,Shinya,K.etal. (2006).PropertiesanddisseminationofH5N1 800

virusesisolatedduringaninfluenzaoutbreakinmigratorywaterfowlinwesternChina.J 801Virol,80,5976-83. 802

803Chen,L.M.,Blixt,O.,Stevens,J.,Lipatov,A.S.,Davis,C.T.etal.(2012).Invitroevolutionof 804

H5N1avian influenza virus towardhuman-type receptor specificity.Virology, 422, 105- 80513. 806

807

Page 42: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter1

31

Chen, R. and Holmes, E. C. (2006). Avian influenza virus exhibits rapid evolutionary 808dynamics.MolBiolEvol,23,2336-41. 809

810Chen,W.,Calvo,P.A.,Malide,D.,Gibbs, J., Schubert,U.etal. (2001).Anovel influenzaA 811

virusmitochondrialproteinthatinducescelldeath.NatMed,7,1306-12. 812 813Chiapponi, C., Faccini, S., De Mattia, A., Baioni, L., Barbieri, I. et al. (2016). Detection of 814

InfluenzaDVirusamongSwineandCattle,Italy.EmergInfectDis,22,352-4. 815 816Choi,Y.K.,Nguyen,T.D.,Ozaki,H.,Webby,R.J.,Puthavathana,P.etal. (2005).Studiesof 817

H5N1influenzavirusinfectionofpigsbyusingvirusesisolatedinVietnamandThailandin 8182004.JVirol,79,10821-5. 819

820Claas,E.C.,Osterhaus,A.D.,vanBeek,R.,DeJong,J.C.,Rimmelzwaan,G.F.etal.(1998). 821

Human influenza A H5N1 virus related to a highly pathogenic avian influenza virus. 822Lancet,351,472-7. 823

824Colman, P.M. (1994). Influenza virus neuraminidase: structure, antibodies, and inhibitors. 825

ProteinSci,3,1687-96. 826 827Cong,Y.L.,Wang,C.F.,Yan,C.M.,Peng,J.S.,Jiang,Z.L.etal.(2008).Swineinfectionwith 828

H9N2influenzavirusesinChinain2004.VirusGenes,36,461-9. 829 830Connor,R. J.,Kawaoka,Y.,Webster,R.G.andPaulson, J.C. (1994).Receptorspecificity in 831

human,avian,andequineH2andH3influenzavirusisolates.Virology,205,17-23. 832 833Cross, K. J., Langley, W. A., Russell, R. J., Skehel, J. J. and Steinhauer, D. A. (2009). 834

Compositionandfunctionsoftheinfluenzafusionpeptide.ProteinPeptLett,16,766-78. 835 836Das,K.,Aramini,J.M.,Ma,L.C.,Krug,R.M.andArnold,E.(2010).StructuresofinfluenzaA 837

proteinsandinsightsintoantiviraldrugtargets.NatStructMolBiol,17,530-8. 838 839DeVleeschauwer,A.,VanPoucke,S.,Braeckmans,D.,VanDoorsselaere,J.andVanReeth,K. 840

(2009). Efficient transmission of swine-adapted but not wholly avian influenza viruses 841amongpigsandfrompigstoferrets.JInfectDis,200,1884-92. 842

843de Vries, E., Guo, H., Dai, M., Rottier, P. J., van Kuppeveld, F. J. et al. (2015). Rapid 844

emergence of highly pathogenic avian influenza subtypes from a subtype H5N1 845hemagglutininvariant.EmergInfectDis,21,842-6. 846

847Dias,A.,Bouvier,D.,Crepin,T.,McCarthy,A.A.,Hart,D.J.etal. (2009).Thecap-snatching 848

endonuclease of influenza virus polymerase resides in the PA subunit. Nature, 458 849(7240),914-8. 850

851Domingo, E., Baranowski, E., Ruiz-Jarabo, C.M.,Martin-Hernandez, A.M., Saiz, J. C. et al. 852

(1998).QuasispeciesstructureandpersistenceofRNAviruses.EmergInfectDis,4,521-7. 853 854Ducatez,M.F.,Pelletier,C.andMeyer,G.(2015). InfluenzaDvirus incattle,France,2011- 855

2014.EmergInfectDis,21,368-71. 856 857Ferguson, L., Olivier, A. K., Genova, S., Epperson, W. B., Smith, D. R. et al. (2016). 858

PathogenesisofInfluenzaDVirusinCattle.JVirol,90,5636-42. 859 860

Page 43: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Generalintroduction

32

Fouchier, R., Osterhaus, A. D. M. E. and Brown, I. H. (2003). Animal influenza virus 861surveillance.Vaccine,21,1754-7. 862

863Fouchier,R.A.,Schneeberger,P.M.,Rozendaal,F.W.,Broekman,J.M.,Kemink,S.A.etal. 864

(2004).Avian influenzaAvirus (H7N7)associatedwithhumanconjunctivitis anda fatal 865caseofacuterespiratorydistresssyndrome.ProcNatlAcadSciUSA,101,1356-61. 866

867Fouchier, R. A., Munster, V., Wallensten, A., Bestebroer, T. M., Herfst, S. et al. (2005). 868

CharacterizationofanovelinfluenzaAvirushemagglutininsubtype(H16)obtainedfrom 869black-headedgulls.JVirol,79,2814-22. 870

871Gamblin, S. J. and Skehel, J. J. (2010). Influenza hemagglutinin and neuraminidase 872

membraneglycoproteins.JBiolChem,285,28403-9. 873 874Gao,R.,Cao,B.,Hu,Y.,Feng,Z.,Wang,D.etal.(2013).Humaninfectionwithanovelavian- 875

origininfluenzaA(H7N9)virus.NEnglJMed,368,1888-97. 876 877Garcia,J.M.,Lai,J.C.,Haselhorst,T.,Choy,K.T.,Yen,H.L.etal.(2014).Investigationofthe 878

binding and cleavage characteristics of N1 neuraminidases from avian, seasonal, and 879pandemic influenza viruses using saturation transfer difference nuclear magnetic 880resonance.InfluenzaOtherRespirViruses,8,235-42. 881

882Gaydos, J. C., Top, F. H., Jr., Hodder, R. A. and Russell, P. K. (2006). Swine influenza a 883

outbreak,FortDix,NewJersey,1976.EmergInfectDis,12,23-8. 884 885Glaser,L.,Stevens,J.,Zamarin,D.,Wilson,I.A.,Garcia-Sastre,A.etal.(2005).Asingleamino 886

acid substitution in 1918 influenza virus hemagglutinin changes receptor binding 887specificity.JVirol,79,11533-6. 888

889Guan,Y.,Shortridge,K.F.,Krauss,S.andWebster,R.G.(1999).Molecularcharacterization 890

ofH9N2influenzaviruses:weretheythedonorsofthe"internal"genesofH5N1viruses 891inHongKong?ProcNatlAcadSciUSA,96,9363-7. 892

893Guan, Y., Poon, L. L., Cheung, C. Y., Ellis, T. M., Lim,W. et al. (2004). H5N1 influenza: a 894

proteanpandemicthreat.ProcNatlAcadSciUSA,101,8156-61. 895 896Guilligay, D., Tarendeau, F., Resa-Infante, P., Coloma, R., Crepin, T. et al. (2008). The 897

structuralbasisforcapbindingbyinfluenzaviruspolymerasesubunitPB2.NatStructMol 898Biol,15(5),500-06. 899

900Harder,T.C.andVahlenkamp,T.W.(2010).Influenzavirusinfectionsindogsandcats.Vet 901

ImmunolImmunopathol,134,54-60. 902 903Harder,T.C.,GrosseBeilage,E.,Lange,E.,Meiners,C.,Dohring,S.etal. (2013).Expanded 904

cocirculation of stable subtypes, emerging lineages, and new sporadic reassortants of 905porcineinfluenzavirusesinswinepopulationsinNorthwestGermany.JVirol,87,10460- 90676. 907

908Hause,B.M.,Ducatez,M.,Collin,E.A.,Ran,Z.,Liu,R.etal.(2013).Isolationofanovelswine 909

influenza virus fromOklahoma in2011which is distantly related tohuman influenzaC 910viruses.PLoSPathog,9,e1003176. 911

912

Page 44: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter1

33

Herfst, S., Chutinimitkul, S., Ye, J., deWit, E.,Munster, V. J. et al. (2010). Introduction of 913virulence markers in PB2 of pandemic swine-origin influenza virus does not result in 914enhancedvirulenceortransmission.JVirol,84,3752-8. 915

916Herfst, S., Schrauwen,E. J., Linster,M.,Chutinimitkul, S.,deWit,E.etal. (2012).Airborne 917

transmissionofinfluenzaA/H5N1virusbetweenferrets.Science,336,1534-41. 918 919Hinshaw, V. S.,Webster, R. G., Easterday, B. C. and Bean,W. J., Jr. (1981). Replication of 920

avianinfluenzaAvirusesinmammals.InfectImmun,34,354-61. 921 922Hoffmann,E.,Stech,J.,Leneva,I.,Krauss,S.,Scholtissek,C.etal.(2000).Characterizationof 923

theinfluenzaAvirusgenepoolinavianspeciesinsouthernChina:wasH6N1aderivative 924oraprecursorofH5N1?JVirol,74,6309-15. 925

926Huang,R.,Wang,A.R.,Liu,Z.H.,Liang,W.,Li,X.X.etal.(2013).Seroprevalenceofavian 927

influenzaH9N2amongpoultryworkersinShandongProvince,China.EurJClinMicrobiol 928InfectDis,32,1347-51. 929

930Imai, M., Watanabe, T., Hatta, M., Das, S. C., Ozawa, M. et al. (2012). Experimental 931

adaptation of an influenza H5 HA confers respiratory droplet transmission to a 932reassortantH5HA/H1N1virusinferrets.Nature,486,420-8. 933

934Imai,M.,Herfst,S.,Sorrell,E.M.,Schrauwen,E.J.,Linster,M.etal.(2013).Transmissionof 935

influenzaA/H5N1virusesinmammals.VirusRes,178,15-20. 936 937Ito,T.,Couceiro,J.N.,Kelm,S.,Baum,L.G.,Krauss,S.etal.(1998).Molecularbasisforthe 938

generationinpigsofinfluenzaAviruseswithpandemicpotential.JVirol,72,7367-73. 939 940Jagger,B.W.,Wise,H.M.,Kash,J.C.,Walters,K.A.,Wills,N.M.etal.(2012).Anoverlapping 941

protein-coding region in influenza A virus segment 3 modulates the host response. 942Science,337,199-204. 943

944Karasin, A. I., Brown, I. H., Carman, S. and Olsen, C. W. (2000a). Isolation and 945

characterizationofH4N6avianinfluenzavirusesfrompigswithpneumoniainCanada. J 946Virol,74,9322-7. 947

948Karasin,A.I.,Olsen,C.W.,Brown,I.H.,Carman,S.,Stalker,M.etal.(2000b).H4N6influenza 949

virusisolatedfrompigsinOntario.CanVetJ,41,938-9. 950 951Karasin, A. I., Landgraf, J., Swenson, S., Erickson, G., Goyal, S. et al. (2002). Genetic 952

characterization of H1N2 influenza A viruses isolated from pigs throughout the United 953States.JClinMicrobiol,40,1073-9. 954

955Karasin,A. I.,West,K.,Carman,S.andOlsen,C.W.(2004).CharacterizationofavianH3N3 956

andH1N1influenzaAvirusesisolatedfrompigsinCanada.JClinMicrobiol,42,4349-54. 957 958Kash,J.C.,Qi,L.,Dugan,V.G.,Jagger,B.W.,Hrabal,R.J.etal.(2010).Priorinfectionwith 959

classicalswineH1N1influenzavirusesisassociatedwithprotectiveimmunitytothe2009 960pandemicH1N1virus.InfluenzaOtherRespirViruses,4,121-27. 961

962Kida,H.,Ito,T.,Yasuda,J.,Shimizu,Y.,Itakura,C.etal.(1994).Potentialfortransmissionof 963

avianinfluenzavirusestopigs.JGenVirol,75(Pt9),2183-88. 964 965

Page 45: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Generalintroduction

34

Kimble,J.B.,Sorrell,E.,Shao,H.,Martin,P.L.andPerez,D.R.(2011).CompatibilityofH9N2 966avian influenzasurfacegenesand2009pandemicH1N1 internalgenesfortransmission 967intheferretmodel.ProcNatlAcadSciUSA,108,12084-8. 968

969Kimura, H., Abiko, C., Peng, G., Muraki, Y., Sugawara, K. et al. (1997). Interspecies 970

transmissionofinfluenzaCvirusbetweenhumansandpigs.VirusRes,48,71-79. 971 972Kitikoon,P.,Nelson,M. I.,Killian,M. L.,Anderson,T.K.,Koster, L.etal. (2013).Genotype 973

patternsofcontemporaryreassortedH3N2virusinUSswine.JGenVirol,94,1236-41. 974 975Kobasa, D., Kodihalli, S., Luo, M., Castrucci, M. R., Donatelli, I. et al. (1999). Amino acid 976

residuescontributingtothesubstratespecificityoftheinfluenzaAvirusneuraminidase.J 977Virol,73,6743-51. 978

979Krueger, W. S. and Gray, G. C. (2013). Swine influenza virus infections in man. Curr Top 980

MicrobiolImmunol,370,201-25. 981 982Ku,K.B.,Park,E.H.,Yum,J.,Kim,H.M.,Kang,Y.M.etal.(2014).Transmissibilityofnovel 983

H7N9andH9N2avianinfluenzavirusesbetweenchickensandferrets.Virology,450-451, 984316-23. 985

986Kuiken,T.,Holmes,E.C.,McCauley,J.,Rimmelzwaan,G.F.,Williams,C.S.etal.(2006).Host 987

speciesbarrierstoinfluenzavirusinfections.Science,312,394-7. 988 989Kundin,W.D.(1970).HongKongA-2influenzavirusinfectionamongswineduringahuman 990

epidemicinTaiwan.Nature,228,857. 991 992Lakadamyali, M., Rust, M. J. and Zhuang, X. (2004). Endocytosis of influenza viruses. 993

MicrobesInfect,6,929-36. 994 995Lakdawala,S.S.,Lamirande,E.W.,Suguitan,A.L.,Jr.,Wang,W.,Santos,C.P.etal.(2011). 996

Eurasian-origin gene segments contribute to the transmissibility, aerosol release, and 997morphologyofthe2009pandemicH1N1influenzavirus.PLoSPathog,7,e1002443. 998

999Lakdawala,S.S.,Jayaraman,A.,Halpin,R.A.,Lamirande,E.W.,Shih,A.R.etal.(2015).The 1000

softpalateisanimportantsiteofadaptationfortransmissibleinfluenzaviruses.Nature, 1001526,122-25. 1002

1003Lam,T.T.,Wang,J.,Shen,Y.,Zhou,B.,Duan,L.etal.(2013).Thegenesisandsourceofthe 1004

H7N9influenzavirusescausinghumaninfectionsinChina.Nature,502,241-44. 1005 1006Landolt,G.A.,Karasin,A.I.,Schutten,M.M.andOlsen,C.W.(2006).Restrictedinfectivityof 1007

ahuman-LineageH3N2influenzaAvirusinpigsishemagglutininandneuraminidasegene 1008dependent.JClinMicrobiol,44,297-301. 1009

1010Lange,J.,Groth,M.,Schlegel,M.,Krumbholz,A.,Wieczorek,K.etal.(2013).Reassortantsof 1011

the pandemic (H1N1) 2009 virus and establishment of a novel porcineH1N2 influenza 1012virus,lineageinGermany.VetMicrobiol,167,345-56. 1013

1014Lee,J.H.,Pascua,P.N.,Song,M.S.,Baek,Y.H.,Kim,C.J.etal.(2009).Isolationandgenetic 1015

characterizationofH5N2influenzavirusesfrompigsinKorea.JVirol,83,4205-15. 1016 1017

Page 46: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter1

35

Lekcharoensuk,P., Lager,K.M.,Vemulapalli,R.,Woodruff,M.,Vincent,A. L.etal. (2006). 1018NovelswineinfluenzavirussubtypeH3N1,UnitedStates.EmergInfectDis,12,787-94. 1019

1020Lewis, N. S., Russell, C. A., Langat, P., Anderson, T. K., Berger, K. et al. (2016). The global 1021

antigenicdiversityofswineinfluenzaAviruses.Elife,2016;5:e122175. 1022 1023Li, C. and Chen, H. (2014). Enhancement of influenza virus transmission by gene 1024

reassortment.CurrTopMicrobiolImmunol,385,185-204. 1025 1026Li,K.S.,Guan,Y.,Wang,J.,Smith,G.J.,Xu,K.M.etal.(2004).Genesisofahighlypathogenic 1027

andpotentiallypandemicH5N1influenzavirusineasternAsia.Nature,430,209-13. 1028 1029Li,S.,Zhou,Y.,Zhao,Y.,Li,W.,Song,W.etal(2015).AvianinfluenzaH9N2seroprevalence 1030

amongpigpopulationandpigfarmstaffinShandong,China.VirolJ,12,34. 1031 1032Lipatov,A.S.,Andreansky,S.,Webby,R.J.,Hulse,D.J.,Rehg,J.E.etal.(2005).Pathogenesis 1033

ofHongKongH5N1 influenzavirusNSgene reassortants inmice: the roleof cytokines 1034andB-andT-cellresponses.JGenVirol,86,1121-30. 1035

1036Liu,D.,Shi,W.,Shi,Y.,Wang,D.,Xiao,H.etal. (2013).Originanddiversityofnovelavian 1037

influenza A H7N9 viruses causing human infection: phylogenetic, structural, and 1038coalescentanalyses.Lancet,381,1926-32. 1039

1040Liu,Q.,Zhou,B.,Ma,W.,Bawa,B.,Ma,J.etal.(2014).AnalysisofrecombinantH7N9wild- 1041

typeandmutant viruses inpigs shows that theQ226Lmutation inHA is important for 1042transmission.JVirol,88,8153-65. 1043

1044Liu,Y.,Childs,R.A.,Matrosovich,T.,Wharton,S.,Palma,A.S.etal.(2010).Alteredreceptor 1045

specificityandcelltropismofD222Ghemagglutininmutantsisolatedfromfatalcasesof 1046pandemicA(H1N1)2009influenzavirus.JVirol,84,12069-74. 1047

1048Loeffen, W., de Boer, E. and Koch, G. (2004). Transmission of a highly pathogenic avian 1049

influenzavirus to swine in thenetherlands. In:Proceedingsof the International Society 1050forAnimalHygiene,SaintMalo-France,pp329-30. 1051

1052Luk,G. S., Leung, C. Y., Sia, S. F., Choy, K. T., Zhou, J. et al. (2015). TransmissionofH7N9 1053

Influenza Viruses with a Polymorphism at PB2 Residue 627 in Chickens and Ferrets. J 1054Virol,89,9939-51. 1055

1056Ma, W., Vincent, A. L., Gramer, M. R., Brockwell, C. B., Lager, K. M. et al. (2007). 1057

IdentificationofH2N3influenzaAvirusesfromswineintheUnitedStates.ProcNatlAcad 1058SciUSA,104,20949-54. 1059

1060Ma,W.,Liu,Q.,Bawa,B.,Qiao,C.,Qi,W.etal.(2012).Theneuraminidaseandmatrixgenes 1061

of the2009pandemic influenzaH1N1viruscooperate functionally to facilitateefficient 1062replicationandtransmissibilityinpigs.JGenVirol,93,1261-68. 1063

1064Matrosovich,M. N., Krauss, S. andWebster, R. G. (2001). H9N2 influenza A viruses from 1065

poultryinAsiahavehumanvirus-likereceptorspecificity.Virology,281,156-62. 1066 1067Matrosovich,M.,Stech,J.andKlenk,H.D.(2009).Influenzareceptors,polymeraseandhost 1068

range.RevSciTech,28,203-17. 1069 1070

Page 47: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Generalintroduction

36

Matrosovich,M.,Herrler,G. and Klenk,H.D. (2015). Sialic Acid Receptors of Viruses.Top 1071CurrChem,367,1-28. 1072

1073Medina,R.A.andGarcia-Sastre,A.(2011).InfluenzaAviruses:newresearchdevelopments. 1074

NatRevMicrobiol,9,590-603. 1075 1076Mehle,A(2014).UnusualinfluenzaAvirusesinbats.Viruses,6(9),3438-49. 1077 1078Mena, I., Nelson,M. I., Quezada-Monroy, F., Dutta, J., Cortes-Fernandez, R. et al (2016). 1079

Originsofthe2009H1N1influenzapandemicinswineinMexico.Elife,5,e16777. 1080 1081Moncorge,O.,Mura,M.andBarclay,W.S.(2010).Evidenceforavianandhumanhostcell 1082

factorsthataffecttheactivityofinfluenzaviruspolymerase.JVirol,84,9978-86. 1083 1084Moncorge,O.,Long,J.S.,Cauldwell,A.V.,Zhou,H.,Lycett,S.J.etal(2013).Investigationof 1085

influenzaviruspolymeraseactivityinpigcells.JVirol,87,384-94. 1086 1087Moreno,A.,Gabanelli,E.,Sozzi,E.,Lelli,D.,Chiapponi,C.etal.(2013).Differentevolutionary 1088

trendsof swineH1N2 influenzaviruses in Italycompared toEuropeanviruses.VetRes, 108944,112. 1090

1091Munster,V.J.,Veen,J.,Olsen,B.,Vogel,R.,Osterhaus,A.D.etal.(2006).Towardsimproved 1092

influenzaAvirussurveillanceinmigratingbirds.Vaccine,24,6729-33. 1093 1094Muramoto,Y.,Noda,T.,Kawakami,E.,Akkina,R.andKawaoka,Y. (2013). Identificationof 1095

novelinfluenzaAvirusproteinstranslatedfromPAmRNA.JVirol,87,2455-62. 1096 1097Nakajima, K., Desselberger, U. and Palese, P. (1978). Recent human influenza A (H1N1) 1098

virusesarecloselyrelatedgeneticallytostrainsisolatedin1950.Nature,274,334-9. 1099 1100Nayak,D.P.,Balogun,R.A.,Yamada,H.,Zhou,Z.H.andBarman,S. (2009). Influenzavirus 1101

morphogenesisandbudding.VirusRes,143,147-61. 1102 1103Nelli, R. K., Kuchipudi, S. V., White, G. A., Perez, B. B., Dunham, S. P. et al. (2010). 1104

Comparativedistributionofhumanandavian typesialicacid influenza receptors in the 1105pig.BMCVetRes,6,4. 1106

1107Nelson, M. I. and Vincent, A. L. (2015). Reverse zoonosis of influenza to swine: new 1108

perspectivesonthehuman-animalinterface.TrendsMicrobiol,23,142-53. 1109 1110Neumann,G.,Hughes,M.T.andKawaoka,Y.(2000).InfluenzaAvirusNS2proteinmediates 1111

vRNP nuclear export through NES-independent interaction with hCRM1. EMBO J, 19, 11126751-8. 1113

1114Neumann, G., Noda, T. and Kawaoka, Y. (2009). Emergence and pandemic potential of 1115

swine-originH1N1influenzavirus.Nature,459,931-39. 1116 1117Neumann,G.andKawaoka,Y.(2015).TransmissionofinfluenzaAviruses.Virology,479-480, 1118

234-46. 1119 1120 1121 1122

Page 48: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter1

37

Ngo,L.T.,Hiromoto,Y.,Pham,V.P.,Le,H.T.,Nguyen,H.T.etal.(2012).Isolationofnovel 1123triple-reassortant swine H3N2 influenza viruses possessing the hemagglutinin and 1124neuraminidase genes of a seasonal influenza virus in Vietnam in 2010. InfluenzaOther 1125RespirViruses,6,6-10. 1126

1127Nguyen-Van-Tam,J.S.,Nair,P.,Acheson,P.,Baker,A.,Barker,M.etal.(2006).Outbreakof 1128

low pathogenicity H7N3 avian influenza in UK, including associated case of human 1129conjunctivitis.EuroSurveill,11,E0605042. 1130

1131Obadan,A.O.,Kimble,B. J.,Rajao,D., Lager,K., Santos, J. J.etal. (2015).Replicationand 1132

transmissionofmammalian-adaptedH9subtype influenzavirus inpigsandquail. JGen 1133Virol,96,2511-21. 1134

1135Offeddu,V.,Cowling,B.J.andMalikPeiris,J.S.(2016).Interventionsinlivepoultrymarkets 1136

forthecontrolofavianinfluenza:asystematicreview.OneHealth,2,55-64. 1137 1138OIE (2017). InfluenzaA virusof swine. In:OIEManualof diagnostic testsand vaccines for 1139

terrestrialanimals.Paris,France.Chapter2.8.7. 1140 1141Olsen, B., Munster, V. J.,Wallensten, A.,Waldenstrom, J., Osterhaus, A. D. et al. (2006). 1142

Globalpatternsofinfluenzaavirusinwildbirds.Science,312,384-88. 1143 1144Ostrowsky, B., Huang, A., Terry,W., Anton, D., Brunagel, B. et al. (2012). Low pathogenic 1145

avian influenzaA (H7N2)virus infection in immunocompromisedadult,NewYork,USA, 11462003.EmergInfectDis,18,1128-31. 1147

1148Peiris,M.,Yuen,K.Y.,Leung,C.W.,Chan,K.H.,Ip,P.L.etal.(1999).Humaninfectionwith 1149

influenzaH9N2.Lancet,354,916-7. 1150 1151Peiris, J.S.,Guan,Y.,Markwell,D.,Ghose,P.,Webster,R.G.etal. (2001).Cocirculationof 1152

avianH9N2andcontemporary"human"H3N2influenzaAvirusesinpigsinsoutheastern 1153China:potentialforgeneticreassortment?JVirol,75,9679-86. 1154

1155Peiris,J.S.,Yu,W.C.,Leung,C.W.,Cheung,C.Y.,Ng,W.F.etal.(2004).Re-emergenceof 1156

fatalhumaninfluenzaAsubtypeH5N1disease.Lancet,363,617-19. 1157 1158Peiris, J. S., de Jong,M. D. andGuan, Y. (2007). Avian influenza virus (H5N1): a threat to 1159

humanhealth.ClinMicrobiolRev,20,243-67. 1160 1161Pensaert,M.,Ottis,K.,Vandeputte,J.,Kaplan,M.M.andBachmann,P.A.(1981).Evidence 1162

for the natural transmission of influenza A virus from wild ducks to swine and its 1163potentialimportanceforman.BulletinoftheWorldHealthOrganization,59,75-78. 1164

1165Pereda, A., Cappuccio, J., Quiroga, M. A., Baumeister, E., Insarralde, L. et al. (2010). 1166

Pandemic(H1N1)2009outbreakonpigfarm,Argentina.EmergInfectDis,16,304-07. 1167 1168Perez, D. R., Lim, W., Seiler, J. P., Yi, G., Peiris, M. et al. (2003). Role of Quail in the 1169

Interspecies Transmission of H9 Influenza A Viruses: Molecular Changes on HA That 1170CorrespondtoAdaptationfromDuckstoChickens.JVirol,77,3148-3156. 1171

1172Perez,D.R.,deWit,J. J. (2017).Low-pathogenicityavian influenza. In:Swayne,D.E. (Eds.) 1173

Animalinfluenza.2thed.JohnWileyandSons,Inc.,Ames,Iowa,pp271-301. 1174 1175

Page 49: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Generalintroduction

38

Pinto,L.H.andLamb,R.A.(2006).TheM2protonchannelsof influenzaAandBviruses.J 1176BiolChem,281,8997-9000. 1177

1178Qi,X.,Qian,Y.H.,Bao,C. J.,Guo,X. L.,Cui, L.B.etal. (2013).Probableperson toperson 1179

transmission of novel avian influenza A (H7N9) virus in Eastern China, 2013: 1180epidemiologicalinvestigation.BMJ,347,f4752. 1181

1182Qiao,C.,Liu,Q.,Bawa,B.,Shen,H.,Qi,W.etal.(2012).Pathogenicityandtransmissibilityof 1183

reassortantH9 influenzaviruseswithgenes frompandemicH1N1virus.JGenVirol,93, 11842337-45. 1185

1186Rajao, D., Walia, R., Gauger, P., Janas-Martindale, A., Killian, M. L. et al. (2016). 1187

ReassortmentbetweenswineH3N2and2009pandemicH1N1generateddiversegenetic 1188constellationsininfluenzavirusescirculatinginUnitedStatespigs.In:24thInternational 1189PigVeterinarySocietyCongress.p157,Dublin. 1190

1191Reich,S.,Guilligay,D.,Pflug,A.,Malet,H.,Berger,I.etal.(2014).Structuralinsightintocap- 1192

snatchingandRNAsynthesisbyinfluenzapolymerase.Nature,516,361-66. 1193 1194Richard,M.,Schrauwen,E.J.,deGraaf,M.,Bestebroer,T.M.,Spronken,M.I.etal.(2013). 1195

Limited airborne transmission of H7N9 influenza A virus between ferrets.Nature, 501, 1196560-63. 1197

1198Richard,M.,deGraaf,M.andHerfst,S.(2014).AvianinfluenzaAviruses:fromzoonosisto 1199

pandemic.FutureVirol,9,513-24. 1200 1201Rose,N.,Herve,S.,Eveno,E.,Barbier,N.,Eono,F.etal.(2013).DynamicsofinfluenzaAvirus 1202

infectionsinpermanentlyinfectedpigfarms:evidenceofrecurrentinfections,circulation 1203ofseveralswineinfluenzavirusesandreassortmentevents.VetRes,44,72. 1204

1205Rovida,F.,Piralla,A.,Marzani,F.C.,Moreno,A.,Campanini,G.etal.(2017).Swineinfluenza 1206

A (H1N1) virus (SIV) infection requiring extracorporeal life support in an 1207immunocompetentadultpatientwithindirectexposuretopigs,Italy,October2016.Euro 1208Surveill,22. 1209

1210Scholtissek, C., Burger,H., Kistner,O. and Shortridge, K. F. (1985). Thenucleoprotein as a 1211

possiblemajorfactorindetermininghostspecificityofinfluenzaH3N2viruses.Virology, 1212147,287-94. 1213

1214Shi, J., Xie, J., He, Z., Hu, Y., He, Y. et al. (2013). A detailed epidemiological and clinical 1215

description of 6 human cases of avian-origin influenza A (H7N9) virus infection in 1216Shanghai.PLoSOne,8,e77651. 1217

1218Shi,W.F.,Gibbs,M.J.,Zhang,Y.Z.,Zhang,Z.,Zhao,X.M.etal.(2008).Geneticanalysisof 1219

fourporcineavianinfluenzavirusesisolatedfromShandong,China.ArchVirol,153,211- 122017. 1221

1222Shi,Y.,Wu,Y.,Zhang,W.,Qi, J.andGao,G.F. (2014).Enabling the 'host jump': structural 1223

determinantsofreceptor-bindingspecificityininfluenzaAviruses.NatRevMicrobiol,12, 1224822-31. 1225

1226

Page 50: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter1

39

Shortridge,K.F.andWebster,R.G.(1979).Geographicaldistributionofswine(Hsw1N1)and 1227HongKong(H3N2)influenzavirusvariantsinpigsinSoutheastAsia. Intervirology,11,9- 122815. 1229

1230Shortridge, K. F. (1999). Poultry and the influenza H5N1 outbreak in Hong Kong, 1997: 1231

abridgedchronologyandvirusisolation.Vaccine,17Suppl1,S26-9. 1232 1233Shtyrya,Y.,Mochalova, L.,Voznova,G.,Rudneva, I., Shilov,A.etal. (2009).Adjustmentof 1234

receptor-binding and neuraminidase substrate specificities in avian-human reassortant 1235influenzaviruses.GlycoconjJ,26,99-109. 1236

1237Shu,L.L.,Lin,Y.P.,Wright,S.M.,Shortridge,K.F.andWebster,R.G.(1994).Evidencefor 1238

interspecies transmission and reassortment of influenza A viruses in pigs in southern 1239China.Virology,202,825-33. 1240

1241Sieczkarski,S.B.andWhittaker,G.R.(2002).Influenzaviruscanenterandinfectcellsinthe 1242

absenceofclathrin-mediatedendocytosis.JVirol,76,10455-64. 1243 1244Siegers, J. Y., Short, K.R., Leijten, L.M.,deGraaf,M., Spronken,M. I. et al. (2014).Novel 1245

avian-origin influenzaA (H7N9) virus attachment to the respiratory tractof five animal 1246models.JVirol,88,4595-9. 1247

1248Simon,G.,Larsen,L.E.,Durrwald,R.,Foni,E.,Harder,T.etal.(2014).Europeansurveillance 1249

networkforinfluenzainpigs:surveillanceprograms,diagnostictoolsandswineinfluenza 1250virus subtypes identified in 14 European countries from 2010 to 2013. PLoS One, 9, 1251e115815. 1252

1253Sims, L. D., Weaver, J. and Swayne, D. E. (2017). Epidemiology of avian influenza in 1254

agriculturalandotherman-madesystems. In:Swayne,D.E.(Eds.)Animal influenza.2th 1255ed.JohnWileyandSons,Inc.,Ames,Iowa,pp271-301. 1256

1257Skehel, J. J.andWiley,D.C. (2000).Receptorbindingandmembranefusion invirusentry: 1258

theinfluenzahemagglutinin.AnnuRevBiochem,69,531-69. 1259 1260Sorrell,E.M.,Ramirez-Nieto,G.C.,Gomez-Osorio, I.G.andPerez,D.R. (2007).Genesisof 1261

pandemicinfluenza.CytogenetGenomeRes,117,394-402. 1262 1263Sorrell, E. M., Wan, H., Araya, Y., Song, H. and Perez, D. R. (2009). Minimal molecular 1264

constraints for respiratory droplet transmission of an avian-human H9N2 influenza A 1265virus.ProcNatlAcadSciUSA,106,7565-70. 1266

1267Stegeman, A., Bouma, A., Elbers, A. R., de Jong, M. C., Nodelijk, G. et al. (2004). Avian 1268

influenzaA virus (H7N7) epidemic in TheNetherlands in 2003: course of the epidemic 1269andeffectivenessofcontrolmeasures.JInfectDis,190,2088-95. 1270

1271Subbarao,E.K.,London,W.andMurphy,B.R.(1993).AsingleaminoacidinthePB2geneof 1272

influenzaAvirusisadeterminantofhostrange.JVirol,67,1761-4. 1273 1274Subbarao,K.,Klimov,A.,Katz, J.,Regnery,H., Lim,W.etal. (1998).Characterizationofan 1275

avian influenza A (H5N1) virus isolated from a child with a fatal respiratory illness. 1276Science,279,393-6. 1277

1278

Page 51: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Generalintroduction

40

Sun,Y.,Pu,J.,Jiang,Z.,Guan,T.,Xia,Y.etal.(2010).Genotypicevolutionandantigenicdrift 1279ofH9N2influenzavirusesinChinafrom1994to2008.VetMicrobiol,146,215-25. 1280

1281Sun,Y.andLiu,J.(2015).H9N2influenzavirusinChina:acauseofconcern.ProteinCell,6, 1282

18-25. 1283 1284Takano,R.,Nidom,C.A.,Kiso,M.,Muramoto,Y.,Yamada,S.etal.(2009).Acomparisonof 1285

thepathogenicityofavianandswineH5N1influenzavirusesinIndonesia.ArchVirol,154, 1286677-81. 1287

1288Taubenberger,J.K.andMorens,D.M.(2006).1918Influenza:themotherofallpandemics. 1289

EmergInfectDis,12,15-22. 1290 1291Taubenberger, J. K. and Kash, J. C. (2010). Influenza virus evolution, host adaptation, and 1292

pandemicformation.CellHostMicrobe,7,440-51. 1293 1294TheSJCEIRSH9WorkingGroup(2013).AssessingthefitnessofdistinctcladesofinfluenzaA 1295

(H9N2)viruses.EmergMicrobesInfect,2,e75. 1296 1297Trebbien, R., Larsen, L. E. andViuff, B.M. (2011).Distributionof sialic acid receptors and 1298

influenzaAvirusofavianandswineorigininexperimentallyinfectedpigs.VirolJ,8,434. 1299 1300Ungchusak,K.,Auewarakul,P.,Dowell,S.F.,Kitphati,R.,Auwanit,W.etal.(2005).Probable 1301

person-to-persontransmissionofavianinfluenzaA(H5N1).NEnglJMed,352,333-40. 1302 1303VanBorm,S.,Rosseel,T.,Marche,S.,Steensels,M.,Vangeluwe,D.etal. (2016).Complete 1304

codingsequencesofoneH9andthreeH7low-pathogenicinfluenzavirusescirculatingin 1305wildbirdsinBelgium,2009to2012.GenomeAnnounc,4(3)e00540-16. 1306

1307VanPoucke,S.G.,Nicholls, J.M.,Nauwynck,H. J.andVanReeth,K. (2010).Replicationof 1308

avian,humanandswineinfluenzavirusesinporcinerespiratoryexplantsandassociation 1309withsialicaciddistribution.VirolJ,7,38. 1310

1311Van Reeth, K., Brown, I. H. and Pensaert,M. (2000). Isolations of H1N2 influenza A virus 1312

frompigsinBelgium.VetRec,146,588-9. 1313 1314van Riel, D.,Munster, V. J., deWit, E., Rimmelzwaan, G. F., Fouchier, R. A. et al. (2007). 1315

Humanandavianinfluenzavirusestargetdifferentcellsinthelowerrespiratorytractof 1316humansandothermammals.AmJPathol,171,1215-23. 1317

1318Vasin,A.V.,Temkina,O.A.,Egorov,V.V.,Klotchenko,S.A.,Plotnikova,M.A.etal.(2014). 1319

Molecularmechanisms enhancing the proteomeof influenzaA viruses: an overviewof 1320recentlydiscoveredproteins.VirusRes,185,53-63. 1321

1322Vincent, A. L., Ma,W., Lager, K.M., Janke, B. H. and Richt, J. A. (2008). Swine influenza 1323

viruses:aNorthAmericanperspective.AdvVirusRes,72,127-54. 1324 1325Vines, A., Wells, K., Matrosovich, M., Castrucci, M. R., Ito, T. et al. (1998). The role of 1326

influenza A virus hemagglutinin residues 226 and 228 in receptor specificity and host 1327rangerestriction.JVirol,72,7626-31. 1328

1329

Page 52: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter1

41

Wagner, R., Matrosovich, M. and Klenk, H. D. (2002). Functional balance between 1330haemagglutininandneuraminidasein influenzavirus infections.RevMedVirol,12,159- 133166. 1332

1333Wan,H.andPerez,D.R.(2006).Quailcarrysialicacidreceptorscompatiblewithbindingof 1334

avianandhumaninfluenzaviruses.Virology,346,278-86. 1335 1336Wan, H. and Perez, D. R. (2007). Amino acid 226 in the hemagglutinin of H9N2 influenza 1337

virusesdeterminescell tropismand replication inhumanairwayepithelial cells. JVirol, 133881,5181-91. 1339

1340Wan,H.,Sorrell,E.M.,Song,H.,Hossain,M.J.,Ramirez-Nieto,G.etal(2008).Replication 1341

andtransmissionofH9N2influenzavirusesinferrets:evaluationofpandemicpotential. 1342PLoSOne,3,e2923. 1343

1344Wang,H.,Feng,Z.,Shu,Y.,Yu,H.,Zhou,L.etal.(2008).Probablelimitedperson-to-person 1345

transmissionof highly pathogenic avian influenzaA (H5N1) virus in China. Lancet, 371, 13461427-34. 1347

1348Wang,J.,Wu,M.,Hong,W.,Fan,X.,Chen,R.etal(2016).InfectivityandTransmissibilityof 1349

AvianH9N2InfluenzaVirusesinPigs.JVirol,90(7),3506-14. 1350 1351Wang,N.,Zou,W.,Yang,Y.,Guo,X.,Hua,Y.etal.(2012).Completegenomesequenceofan 1352

H10N5avianinfluenzavirusisolatedfrompigsincentralChina.JVirol,86,13865-6. 1353 1354Watson, S. J., Langat, P., Reid, S. M., Lam, T. T., Cotten, M. et al. (2015). Molecular 1355

epidemiology and evolution of influenza viruses circulating within European swine 1356between2009and2013.JVirol,89,9920-31. 1357

1358Webby,R.J.,Swenson,S.L.,Krauss,S.L.,Gerrish,P.J.,Goyal,S.M.etal.(2000).Evolutionof 1359

swineH3N2influenzavirusesintheUnitedStates.JVirol,74,8243-51. 1360 1361Webby,R.J.,Rossow,K.,Erickson,G.,Sims,Y.andWebster,R.(2004).Multiplelineagesof 1362

antigenically and genetically diverse influenza A virus co-circulate in the United States 1363swinepopulation.VirusRes,103,67-73. 1364

1365Webster, R. G., Bean, W. J., Gorman, O. T., Chambers, T. M. and Kawaoka, Y. (1992). 1366

EvolutionandecologyofinfluenzaAviruses.MicrobiolRev,56,152-79. 1367 1368Weingartl, H. M., Albrecht, R. A., Lager, K. M., Babiuk, S., Marszal, P. et al. (2009). 1369

Experimentalinfectionofpigswiththehuman1918pandemicinfluenzavirus.JVirol,83, 13704287-96. 1371

1372Wise, H. M., Foeglein, A., Sun, J., Dalton, R. M., Patel, S. et al. (2009). A complicated 1373

message: IdentificationofanovelPB1-relatedprotein translated from influenzaAvirus 1374segment2mRNA.JVirol,83,8021-31. 1375

1376Wise, H. M., Hutchinson, E. C., Jagger, B. W., Stuart, A. D., Kang, Z. H. et al. (2012). 1377

IdentificationofanovelsplicevariantformoftheinfluenzaAvirusM2ionchannelwith 1378anantigenicallydistinctectodomain.PLoSPathog,8,e1002998. 1379

1380

Page 53: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Generalintroduction

42

World Health Organization. (2017a). Influenza at the human-animal interface. Available: 1381http://www.who.int/influenza/human_animal_interface/Influenza_Summary_IRA_HA_in 1382terface_05_06_2017.pdf?ua=1. 1383

1384WorldHealthOrganization.(2017b).Cumulativenumberofconfirmedhumancasesfor 1385

avianinfluenzaA(H5N1)reportedtoWHO,2003-2017.Available: 1386http://www.who.int/influenza/human_animal_interface/2017_04_20_tableH5N1.pdf?ua 1387=1 1388

1389Wright, P. F.,Neumann,G. andKawaoka, Y. (2013).Orthomyxoviruses. In: Knipe,D.M.& 1390

Howley,P.M. (Eds.)FieldsVirology.6thed.LippincottWilliams&Wilkins,Philadelphia, 1391Pensylvania,USA,pp1186-243. 1392

1393Xu,C.,Fan,W.,Wei,R.andZhao,H. (2004). Isolationand identificationofswine influenza 1394

recombinantA/Swine/Shandong/1/2003(H9N2)virus.MicrobesInfect,6,919-25. 1395 1396Xu,L.,Bao,L.,Deng,W.,Zhu,H.,Li,F.etal.(2014).RapidadaptationofavianH7N9virusin 1397

pigs.Virology,452-453,231-6. 1398 1399Yamada, S., Suzuki, Y., Suzuki, T., Le, M. Q., Nidom, C. A. et al. (2006). Haemagglutinin 1400

mutations responsible for the binding of H5N1 influenza A viruses to human-type 1401receptors.Nature,444,378-82. 1402

1403Yang,X.,Steukers,L.,Forier,K.,Xiong,R.,Braeckmans,K.etal.(2014).Abeneficiaryrolefor 1404

neuraminidaseininfluenzaviruspenetrationthroughtherespiratorymucus.PLoSOne,9, 1405e110026. 1406

1407Yang,Z.F.,Mok,C.K.,Peiris,J.S.&Zhong,N.S.(2015).HumanInfectionwithaNovelAvian 1408

InfluenzaA(H5N6)Virus.NEnglJMed,373,487-9. 1409 1410Yu, H., Hua, R. H., Wei, T. C., Zhou, Y. J., Tian, Z. J. et al. (2008a). Isolation and genetic 1411

characterizationofavianoriginH9N2influenzavirusesfrompigsinChina.VetMicrobiol, 1412131,82-92. 1413

1414Yu,H.,Hua,R.H.,Zhang,Q.,Liu,T.Q.,Liu,H.L.etal. (2008b).Geneticevolutionofswine 1415

influenzaA(H3N2)virusesinChinafrom1970to2006.JClinMicrobiol,46,1067-75. 1416 1417Yu, H., Zhang, P. C., Zhou, Y. J., Li, G. X., Pan, J. et al. (2009). Isolation and genetic 1418

characterizationofavian-likeH1N1andnovelressortantH1N2influenzavirusesfrompigs 1419inChina.BiochemBiophysResCommun,386,278-83. 1420

1421Yu, H., Zhou, Y. J., Li, G. X., Ma, J. H., Yan, L. P. et al. (2011). Genetic diversity of H9N2 1422

influenzavirusesfrompigs inChina:apotential threattohumanhealth?VetMicrobiol, 1423149,254-61. 1424

1425Yu, H.,Wu, J. T., Cowling, B. J., Liao, Q., Fang, V. J. et al (2014). Effect of closure of live 1426

poultrymarkets on poultry-to-person transmission of avian influenza AH7N9 virus: an 1427ecologicalstudy.Lancet,383,541-8. 1428

1429Zhu,H.,Wang,D., Kelvin,D. J., Li, L., Zheng, Z. et al. (2013). Infectivity, transmission, and 1430

pathologyofhuman-isolatedH7N9influenzavirusinferretsandpigs.Science,341,183-6. 1431 1432

Page 54: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter1

43

Zhu,Q.,Yang,H.,Chen,W.,Cao,W.,Zhong,G.etal.(2008).Anaturallyoccurringdeletionin 1433itsNSgenecontributestotheattenuationofanH5N1swineinfluenzavirusinchickens.J 1434Virol,82,220-8. 1435

1436

Page 55: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY
Page 56: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

45

1437

AIMSOFTHETHESIS 1438

14392

Page 57: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

46

1440

1441

1442

1443

Page 58: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Aimsofthethesis

47

InfluenzaAvirusescauseinfluenzaor“flu” inhumansandfewanimalspeciessuch 1444

asbirdsorpigs.Thosevirusesareusuallyspecies-specificandtheyhavetoovercome 1445

a strong species barrier to infect new hosts. However, when a virus successfully 1446

overcomes thatbarrier itmayposea significant threat for thenovel host species. 1447

Birdsareconsideredasasourceforinfluenzavirusesthatcouldbecomeadaptedto 1448

mammals. On the other hand, pigs have been proposed for a long time as 1449

intermediate hosts where AIVs can adapt to mammals and become pandemic. 1450

However,themechanismsthatruleadaptationofinfluenzavirusesandthepossible 1451

roleofthepiginthegenerationofnovelpandemicsarenotelucidatedyet. 1452

1453

1. ToassesswhetheranavianH9N2viruscouldbecomeadaptedtopigsbyserial 1454

passagingandtodescribethegeneticchangesinducedbythatprocess.Since 1455

1998,H9N2AIVswithenhancedbindingtohuman-typereceptorshavebeen 1456

recurrently isolated from pigs and humans. These isolations increased the 1457

public health concern about those viruses. Other research groups already 1458

evaluated thepossibilityof adaptationby serial passagingofH9N2AIVs into 1459

mammalianspeciessuchas ferretsand/orguineapigs.However, thegenetic 1460

changes requiredbyavianH9N2 influenzaviruses toevolve intomammalian 1461

transmissibleformarenotelucidatedyet. 1462

1463

2. ToevaluateiftheintroductionofpH1N1internalgenesledtoanadvantagein 1464

theadaptationofH9N2AIVstopigsandifthisreassortantcouldreachefficient 1465

pig-to-pigtransmission.In2009thepH1N1influenzavirusemergedandspread 1466

worldwide inhumanandswinepopulations.Thisviruswasgenerated inpigs 1467

and has unique gene constellation containing genes from avian, human and 1468

swine origin. Interestingly, pH1N1 thoroughly reassorted with human and 1469

swine endemic viruses generating novel viruses containing pH1N1 internal 1470

genes.Furthermore,previousexperimentsdemonstratedthatbyreassortment 1471

with pH1N1 internal genes,H5N1 andH9N2AIVs enhanced their replication 1472

andtransmissioninferretsandpigs.However,inpigsthosereassortantviruses 1473

did not transmit with the same efficiency as the endemic swine influenza 1474

viruses. 1475

Page 59: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

48

1476

1477

1478

Page 60: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

49

1479

EFFECTOFSERIALPIGPASSAGES 1480

ONTHEADAPTATIONOFAN 1481

AVIANH9N2INFLUENZAVIRUS 1482

TOSWINE 1483

1484 1485 1486 1487 1488 1489 1490 1491 1492 1493 1494 1495 1496 1497 1498 1499 1500

1501

1502

1503

1504

1505

1506

Adaptedfrom: 1507

ManceraGracia,J.C.,VandenHoecke,S.,Saelens,X., 1508

VanReeth,K. 1509

PLoSONE(2017)12(4),e0175267 1510

3

Page 61: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

EffectofserialpigpassagesonadaptationofanavianH9N2influenzavirustoswine

50

Abstract 1511

H9N2 avian influenza viruses are endemic in poultry in Asia and theMiddle East. 1512

These viruses sporadically cause dead-end infections in pigs and humans raising 1513

concerns about their potential to adapt to mammals or reassort with human or 1514

swineinfluenzaviruses.WeperformedtenserialpassageswithanavianH9N2virus 1515

(A/quail/HongKong/G1/1997) in influenzanaïvepigstoassessthepotentialofthis 1516

virus to adapt to swine. Virus replication in the entire respiratory tract and nasal 1517

virus excretion were examined after each passage and we deep sequenced viral 1518

genomic RNA of the parental and passage 4 H9N2 virus isolated from the nasal 1519

mucosaandlung.TheparentalH9N2viruscausedaproductiveinfectioninpigswith 1520

apredominanttropismforthenasalmucosa,whereasonly50%lungsampleswere 1521

virus-positive. In contrast, inoculationofpigswithpassage4 virus resulted in viral 1522

replicationintheentirerespiratorytract.Subsequentpassageswereassociatedwith 1523

reducedvirusreplicationinthelungsandinfectiousviruswasnolongerdetectable 1524

in the upper and lower respiratory tract of inoculated pigs at passage ten. The 1525

broadertissuetropismafter4passageswasassociatedwithanaminoacidresidue 1526

substitutionatposition225,within the receptor-bindingsiteof thehemagglutinin. 1527

We also compared the parental H9N2, passage 4 H9N2 and the 2009 pandemic 1528

H1N1(pH1N1)virusinadirectcontacttransmissionexperiment.Whereasonly1out 1529

of6contactpigsshowednasalvirusexcretionofthewild-typeH9N2formorethan4 1530

days,all6contactanimalsshedthepassage4H9N2virus.Nevertheless,theamount 1531

of excreted virus was significantly lower when compared to that of the pH1N1, 1532

which readily transmitted and replicated in all 6 contact animals. Our data 1533

demonstratethatserialpassagingofH9N2virusinpigsenhancesitsreplicationand 1534

transmissibility. However, full adaptation of an avian H9N2 virus to pigs likely 1535

requiresanextensivesetofmutations. 1536

1537

Page 62: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter3

51

3.1 Introduction 1538

AIVsof theH9N2subtypeemergedfromthenaturalwaterfowlreservoirandhave 1539

becomeendemicinpoultryinAsiaandtheMiddleEastsincetheearly1990s(Sunet 1540

al., 2010). Genetic characterization and phylogenetic analysis revealed that most 1541

poultryH9N2virusesbelongto1of3differentlineages:G1-like,Y280-likeandY439- 1542

like,alsoknownasKorean-like(Guoetal.,2000,Slomkaetal.,2013).In1999,H9N2 1543

viruses were for the first time isolated from 2 patients with mild respiratory 1544

symptoms (Peiris et al., 1999). These human isolates were genetically and 1545

antigenically similar to theG1-like lineage (Linet al., 2000). Later, from2002until 1546

2016, H9N2 viruses belonging to the G1-like and Y280-like lineages have been 1547

occasionallyreportedinhumans(Peirisetal.,1999,Buttetal.,2010,WorldHealth 1548

Organization,2016).ThefirstH9N2virusthatwasisolatedfromswinebelongedto 1549

the Y280-like lineage andwas reported inHongKong in 1998 (Peiris et al., 2001). 1550

Sincethen,differentlineagesofH9N2virusesweresporadicallydetectedinswinein 1551

MainlandChina(Congetal.,2007,Yuetal.,2008,Yuetal.,2011).Althoughthese 1552

infectionsofhumansandpigsindicatethatH9N2virusescanovercomethespecies 1553

barrierwithoutprioradaptation,nohuman-to-humanorpig-to-pigtransmissionhas 1554

beenreportedsofar(SunandLiu,2015). 1555

Influenza A virus infection ismediated via the attachment of the viral HA RBS to 1556

sialyloligosaccharides present on the host cell surface. Avian influenza viruses 1557

preferentially bind sialic acids linked to galactose by anα2,3 linkage (Siaα2,3Gal). 1558

Conversely,mosthumanandswineinfluenzavirusesmorereadilybindtoreceptors 1559

thatcontainterminalα2,6-linkedsialicacid (Siaα2,6Gal) (Matrosovichetal.,1997). 1560

BecauseofthepredominantexpressionofSiaα2,6Galinthehumanandswineupper 1561

respiratory tract (VanPouckeet al., 2010), a switch fromSiaα2,3Gal to Siaα2,6Gal 1562

receptor binding preference is considered an important factor for avian influenza 1563

virusadaptationtomammals(Matrosovichetal.,2015).Specificaasubstitutionsin 1564

theHARBShavebeenassociatedwithenhancedSiaα2,6Galbinding(Taubenberger 1565

and Kash, 2010). For H1 subtype viruses, for example, a crucial role has been 1566

assigned to the substitution of glutamic acid by aspartic acid at position 190 (HA- 1567

E190D)(H3numbering),andglycinebyasparticacidatposition225(HA-G225D).For 1568

Page 63: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

EffectofserialpigpassagesonadaptationofanavianH9N2influenzavirustoswine

52

H2andH3subtypes,thecrucialchangesweresubstitutionofglutaminebyleucineat 1569

position226(HA-Q226L)andglycinebyserineatposition228(HA-G228S)(Connoret 1570

al.,1994,Vinesetal.,1998,Suzukietal.,2000,).Asignificantproportionofpoultry 1571

H9N2 field isolates contain the HA-Q226L mutation, which has been shown to 1572

enhance binding to Siaα2,6Gal and replication of these viruses in human airway 1573

epithelialcellsinvitro(Matrosovichetal.,2001,WanandPerez,2007).Inaddition, 1574

Wan et al. reported that HA-Q226L increased virus replication and direct contact 1575

transmissionofH9N2inferrets,whichareconsideredthe“goldstandard”modelfor 1576

human influenza pathogenesis and transmissibility studies (Wan et al., 2008, 1577

Matsuokaetal.,2009).However,virustransmissionoftheseH9N2viruseswasstill 1578

less efficient compared to that of human adapted viruses (Wan et al., 2008). This 1579

raises thecriticalquestion:whichotherchangesare required tomakeavianH9N2 1580

virusesfullyadaptedtoamammalianhost? 1581

PigsareimportantnaturalhostsforinfluenzaAviruses.Theseanimalshaveasimilar 1582

Sia receptor distribution as humans (Van Poucke et al., 2010), and they are 1583

susceptible to both avian and human influenza viruses (Kida et al., 1994, De 1584

Vleeschauweretal.,2009b).Since1985,pigshavebeenproposedas intermediate 1585

hosts for the adaptation and transmission of avian influenza viruses frombirds to 1586

humans(Scholtisseketal.,1985,Kahnetal.,2014).However,theexactmechanisms 1587

by which AIVs may fully adapt to pigs and cause a pandemic are not completely 1588

understood. Previous studies reported on the pathogenicity, infectivity and 1589

transmissibilityofdifferentH9N2viruses in swinebasedondifferentexperimental 1590

approaches(Kidaetal.,1994,DeVleeschauweretal.,2009b,Qiaoetal.,2012,The 1591

SJCEIRSH9WorkingGroup,2013,Wangetal.,2016).Furthermore,theinfectionwas 1592

subclinicalinallcases.IntranasalinoculationofpigswithH9N2virusesisolatedfrom 1593

humansorchickenssince the late1990s resulted innasalvirusexcretion formore 1594

than1day,buttransmissionwaseitherundetectableorfarlessefficientthanthatof 1595

endemicswineinfluenzaviruses(Qiaoetal.,2012,TheSJCEIRSH9WorkingGroup, 1596

2013,Wangetal.,2016).SerialpassagingofAIVsinmammalsisaprovenstrategyto 1597

promotetheselectionofvirusvariantsthatarebetteradaptedtoreplicate in,and 1598

transmit between this non-natural host (Sorrell et al., 2009, Herfst et al., 2012, 1599

Shichinoheetal.,2013).Herewesought to improve theadaptationofawild-type 1600

Page 64: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter3

53

H9N2AIVbyperformingtenblindserialpassages in influenzanaïvepigs.Tomimic 1601

the natural situation as much as possible, we used virus isolated from the nasal 1602

mucosaasinoculumforeverysubsequentpassageinanattempttoselectforviruses 1603

with improvednasalvirussheddingandtransmission.Bydoingso,weobtainedan 1604

H9N2viruswithapredominantmutationatposition225 inHAthatreplicatedand 1605

transmittedbetterinpigsthantheparentalvirus. 1606

1607

3.2 Materialsandmethods 1608

Ethicsstatement 1609

TheexperimentswereauthorizedandsupervisedbytheEthicalandAnimalWelfare 1610

Committee of the Faculty of Veterinary Medicine of Ghent University, with the 1611

EC2013/63number. 1612

Influenzaviruses 1613

A/quail/Hong Kong/G1/1997 (H9N2) was isolated from quail at a live birdmarket 1614

andunderwent7passages in11-day-oldembryonatedchickeneggs,3passages in 1615

Madin-Darby Canine Kidney cells (MDCK), and 2 passages in pigs. After each pig 1616

passagetheviruswasalsopassagedonceinMDCKcellstogrowalargestocktobe 1617

usedintheexperiment.Thevirusstockusedintheexperimentsharesatleast99% 1618

identity at the nucleotide and protein levels with the original A/quail/Hong 1619

Kong/G1/1997 virus (GenBank accession numbers: AF156435.1, AF156421.1, 1620

AF156449.1, AF156378.1, AF156407.1, AF156396.1, AF156463.1 and AF156477.2). 1621

This strain was selected because it is representative for the G1-like lineage and 1622

contains theHA-Q226Lsubstitution that isknowntoenhancehuman-like receptor 1623

specificity. 1624

A/California/04/2009(pH1N1)virusunderwent3passages inMDCKcells,1 ineggs 1625

and a last passage in MDCK cells before use. This virus is representative of the 1626

pH1N1virusesthatcirculateworldwideinswine. 1627

Animals 1628

Forty-seven 3-week-old piglets were purchased from a commercial herd that is 1629

serologicallynegative forswine influenzaandporcinereproductiveandrespiratory 1630

Page 65: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

EffectofserialpigpassagesonadaptationofanavianH9N2influenzavirustoswine

54

syndrome virus. Before the start of the experiments, all animals were free of 1631

influenzavirusantibodiesasdemonstratedbyacommercialblockinganti-influenza 1632

A nucleocapsid ELISA (ID-VET) and by virus neutralization (VN) tests using 1633

A/swine/Belgium/1/98 (H1N1), A/swine/Flanders/1/98 (H3N2), 1634

A/swine/Gent/7625/99 (H1N2) swine influenza viruses (SIVs), as well as 1635

A/California/04/09 (pH1N1). Upon arrival, the animalswere housed in a biosafety 1636

level-2 (BSL-2)highefficiencyparticle arresting (HEPA) filtered isolationunit for at 1637

least2daystoallowtheiracclimatization. 1638

BlindserialpassagesofavianH9N2influenzavirusinpigs 1639

Forthefirstpassage,2pigswerehousedinabiosafetylevel-3(BSL-3)HEPAfiltered 1640

isolator and inoculated intranasally with 3 ml of phosphate-buffered saline (PBS) 1641

containing 106.2 TCID50 of A/quail/Hong Kong/G1/1997 (H9N2). For inoculation 1642

unanesthesized pigs were held in a vertical positionwith the neck stretched. The 1643

inoculum(1.5mlpernostril)wasgraduallyinstilledintothenasalcavitybyinsertion 1644

ofa fifteenmmcannulaattachedtoasyringe.Todeterminevirusexcretion in the 1645

nose,individualpigswereswabbeddailyfrom0to4dayspost-inoculation(dpi).At4 1646

dpibothanimalswerehumanelyeuthanizedbyslowinjectionofanoverdose(³100 1647

mg/kg)ofpentobarbital in the jugularvein.At the timeofnecropsy, the following 1648

tissuesampleswerecollectedforvirustitrations:nasalmucosarespiratorypart(i.e. 1649

nasal turbinates), nasal mucosa olfactory part (i.e. ethmoid labyrinth), trachea 1650

(upper and lower half) and 5 different samples representative of the entire lung 1651

(apical+cardiaclobesleftandright,diaphragmaticlobesleftandright,andaccessory 1652

lobe). The nasal mucosae (respiratory part) were pooled and a 20% (w/v) tissue 1653

homogenatewas prepared and used to inoculate 2 pigswith this passage 1 virus 1654

inoculum. Ten blind (meaning that the viral load in the inoculumwas not known 1655

priortotheinfection)serialpassageswereperformedinthisway.Nasalswabsfrom 1656

all pigs, tissue samples and the inocula used for the subsequent passages were 1657

titratedinMDCKcells. 1658

Swinetransmissionstudies 1659

Theinoculumgivingthehighestvirusisolationratesandvirustitersthroughoutthe 1660

respiratorytractandinnasalswabswasexaminedforitstransmissionbetweenpigs. 1661

Page 66: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter3

55

Wecomparedthetransmissibilityofmentionedvirus to thatof theparentalH9N2 1662

andthatofthepH1N1.Nine3-week-oldpigswereused.At0dpi(=2daysbeforethe 1663

startofcontacttransmission),3pigswerehousedin3separateBSL-3HEPAfiltered 1664

isolators(1indexpigperisolator)andintranasallyinoculatedwith106.5TCID50ofthe 1665

respective virus. Forty-eight hours pi, 2 pigs were introduced in each isolator 1666

allowingdirectcontactwiththeinoculatedpig.Allanimalswereclinicallymonitored 1667

for general (depression and anorexia) and respiratory (coughing, dyspnoea, 1668

abdominalthumping,tachypnoea)diseasesigns,andnasalswabsforvirusisolation 1669

were collected daily fromall pigs during 11 days after cohousing. Sixteen dpi, the 1670

animalswererelocatedtoaBSL-2HEPAfilteredisolationunit.Serumsampleswere 1671

collectedat0,16,23and30dpiand0,14,21and28dayspost-contact(dpc). 1672

Growthkineticsofparentalandpassagedvirus 1673

Tocomparethesingle-stepgrowthcurvesoftheparental,passagedvirusandpH1N1 1674

confluentmonolayersofMDCKcellswereinoculatedwithanidenticalmultiplicityof 1675

infectionof5MOIpercellat37oC.After1hourofincubationthecellswerewashed 1676

with phosphate-buffered saline (PBS) containing 10 IU/ml penicillin and 10 µg/ml 1677

streptomycintoremoveunboundvirusparticlesandoverlaidwithMinimalEssential 1678

Medium(MEM)containingsupplements(1mg/mllactalbumin,100IU/mlpenicillin, 1679

10 µg/ml streptomycin, 50 µg/ml gentamycin and 2 µg/ml trypsin). The 3 viruses 1680

weretestedintriplicate,supernatantswerecollectedat0,4,6,12and24hourspost 1681

inoculationandtitratedinMDCKcellsasdescribedbelow. 1682

Virustitrations 1683

Cottonswabswereweighedbeforeandaftercollectiontodeterminevirustitersper 1684

100 milligram nasal secretions. Nasal swab samples from both nostrils were 1685

suspended in 1 ml PBS supplemented with 10% foetal bovine serum, 100 IU/ml 1686

penicillinand100μg/mlstreptomycinandmixedvigorouslyat4°Cfor1hour.Tissue 1687

sampleswereweighedandgrounded inPBSwith10 IU/mlpenicillinand10µg/ml 1688

streptomycin to obtain 20% (w/v) tissue homogenates. Nasal swab samples and 1689

tissue homogenates were clarified by centrifugation and stored at -70°C until 1690

titrationonMDCKcells.Briefly,confluentmonolayersofcellswereinoculatedwith 1691

Page 67: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

EffectofserialpigpassagesonadaptationofanavianH9N2influenzavirustoswine

56

10-foldserialdilutionsofthesample.After5daysofincubationat37oCwith5%CO2, 1692

virus positiveMDCK cellswere visualized by immunoperoxidase staining. The cells 1693

were fixed with 4% paraformaldehyde for 10 minutes at room temperature and 1694

subsequently incubated with mouse anti-NP monoclonal HB-65 antibody (1:50, 1695

ATCC) for 2 hours. Incubation with horseradish peroxidase-conjugated goat anti- 1696

mousepolyclonalantibody(1:200,Dako)for1hourwasfollowedbyadevelopment 1697

step with H2O2 as substrate and 3-amino-9-ethyl-carbazole (AEC) as precipitating 1698

agent.VirustiterswerecalculatedbythemethodofReedandMuench(1938)and 1699

expressed as log10 50% tissue culture infective doses (TCID50) per 100 milligram 1700

(nasalswabs)orpergram(tissues). 1701

Virusneutralizationassays 1702

VirusneutralizationtestswereperformedonMDCKcellsin96-wellplates,using100 1703

TCID50ofvirusperwellaspreviouslydescribed (VanReethetal.,2003).Briefly,2- 1704

foldserumdilutionswereincubated(1h,37oC)with100TCID50ofMDCKcell-grown 1705

virus.MDCKcells(800.000cellsperml)wereincubatedwiththevirus-serummixture 1706

for 24h, after which virus positive cells were visualized by immunoperoxidase 1707

staining. 1708

Dataanalysis 1709

Becausethedetection limitwas1.7 log10TCID50per100milligramnasalsecreteor 1710

gramtissues,samplesthat testednegative forvirusweregivenanumericvalueof 1711

1.6log10TCID50per100milligramnasalsecreteorgramtissues.Samplesthattested 1712

negative in the virus neutralization assay were assigned a value corresponding to 1713

half of theminimumdetectable titer. For each transmissionexperiment, thebasic 1714

reproductionratio(R0)wasestimatedonthebasisoftheoutcomeoftheexperiment 1715

(final-sizemethod)with use of themaximum likelihood estimator. Thus, themost 1716

likely reproduction ratio was estimated using the total number of animals in the 1717

experiment,thetotalnumberofsusceptibleandinfectiousanimalsatthebeginning 1718

of the experiment, and the number of animals that became infected during the 1719

experiment. A pig was considered to be infected when it experienced 1720

seroconversion.The95%confidence intervals (CIs)wereconstructedsymmetrically 1721

aroundtheestimatedvalueofR0(DeVleeschauweretal.,2009b). 1722

Page 68: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter3

57

Inaddition,nasal virus sheddingof individualpigswasquantifiedbycalculationof 1723

theareaunder the curve (AUC). Themeansof theAUCswere comparedbetween 1724

different viruses using standard two–sample Mann-Whitney U tests. Differences 1725

wereconsideredsignificantwhenp<0.05.GraphPadPrismSoftware,version5,was 1726

usedforstatisticalanalyses. 1727

Aminoacidsequencesalignment 1728

Amino acid sequences of HA proteins fromH9N2 viruses isolated from swine and 1729

humansinthefieldwereobtainedfromGenBank.Differenthumanandswineamino 1730

acid sequences were compared with the HA of the A/quail/Hong Kong/G1/1997 1731

(H9N2)strain,withspecialattentiontoaminoacidsatpositions190,225,226and 1732

228 because these contribute to transmission betweenmammals (Matrosovich et 1733

al.,1997,TaubenbergerandKash,2010).Aminoaciddifferenceswereidentifiedby 1734

alignmentusingMEGA6.06software. 1735

RT-PCR 1736

We compared the genetic diversity of the parental wild-type H9N2 virus and 2 1737

samples from the passage 4 virus (which was also selected for the transmission 1738

experiments):1 fromthenasalmucosa(upperrespiratorytract,duetothe limited 1739

amountoftissueobtainedtheviruswasamplifiedinMDCKcells)andanotherfrom 1740

the lungs(lowerrespiratorytract).TheRNAfromthesesampleswas isolatedusing 1741

theQIAampViralRNAMiniKit(Qiagen).cDNAwassynthesizedwiththeTranscriptor 1742

First Strand Synthesis kit (Roche), as described previously (Van denHoecke et al., 1743

2015). Two separate reactions were performed, using primers specific for the 1744

influenza A vRNAs: CommonUni12G (GCCGGAGCTCTGCAGATATCAGCGAAAGCAGG) 1745

and CommonUni12A (GCCGGAGCTCTGCAGATATCAGCAAAAGCAGG). Subsequently, 1746

all8genomicsegmentswereamplifiedin1PCRreactionusingamixcontainingan 1747

1:1 mix of CommonUni12G and CommonUni12A cDNA, primer CommonUni13 1748

(GCCGGAGCTCTGCAGATATCAGTAGAAACAAGG) (200 nM) and the Phusion High 1749

Fidelitypolymerase(ThermoScientific)(VandenHoeckeetal.,2015,Watsonetal., 1750

2013,Zhouetal.,2009).RT-PCRwasperformedasdescribed(VandenHoeckeetal., 1751

2015),withthefirst5PCRcyclesperformedwithanannealingtemperatureof45°C 1752

Page 69: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

EffectofserialpigpassagesonadaptationofanavianH9N2influenzavirustoswine

58

(instead of 72°C). PCR products were purified using the High Pure PCR Product 1753

PurificationKit(Roche)andelutionoftheDNAwasinsterileultrapurewater. 1754

IlluminaMiSeqlibrarypreparationandsequencing 1755

150 ng of each purified RT-PCR sample was sheared with an M220 focused- 1756

ultrasonicator(Covaris)settoobtainpeakfragmentlengthsof400bp.Thefragment 1757

endsof50ngoftheseDNAfragmentswererepairedusingtheNEBNextUltraDNA 1758

LibraryPreparationkit(NewEnglandBiolabs),followedbyadditionoftheadaptors 1759

byusingtheNEBNextMultiplexOligosforIlluminakit(DualIndexPrimersSet1,New 1760

EnglandBiolabs).Theresultingfragmentsweresize-selectedat300to400bpusing 1761

Agencourt AMPure XP bead sizing (Beckman Coulter). Afterwards, indexes were 1762

added in a limited-cycle PCR (10 cycles), followed by purification on Agencourt 1763

AMPureXPbeads.FragmentswereanalysedonaHighSensitivityDNAChiponthe 1764

Bioanalyzer(AgilentTechnologies)beforeloadingonthesequencingchip.Afterthe 1765

2×250 bp MiSeq paired-end sequencing run, the data were base called and 1766

convertedtoIlluminaFASTQfiles(Phred+64encoding). 1767

NextGenerationSequencingdataanalysis 1768

SequencedataanalyseswereperformedontheresultingIlluminaFASTQfiles(Phred 1769

+64encoding)usingCLCGenomicsWorkbench(Version7.0.3)followingtheanalysis 1770

pipelineasdescribed(VandenHoeckeetal.,2015).Theprocessedsequencingreads 1771

weremapped to the consensus sequence obtained afterde novoassembly of the 1772

sequencing reads for the A/quail/Hong Kong/G1/1997 (H9N2) virus stock sample, 1773

sincethisvirusstockwasusedtostartthevirusadaptation.Thisconsensussequence 1774

is available through GenBank accession number (KY785896-KY785903). The raw 1775

sequencingdataweresubmittedtotheNCBISequenceReadArchivewheretheycan 1776

befoundunderprojectnumberSRP078326. 1777

Geneticcharacterization 1778

Toevaluateifthemutationsdescribedinpassage4weremaintainedthroughoutthe 1779

subsequent passages, the partial coding sequences ofHA,M and PB1 geneswere 1780

determined forall inocula frompassage5onwardsbydirectSangersequencingof 1781

overlappingRT-PCRproducts.RNAwasextractedfromviruswiththeQIAampViral 1782

Page 70: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter3

59

RNAMiniKit (Qiagen,Valencia,CA).Reverse transcriptionandamplificationof the 1783

genes was done by one-step RT-PCR (One-step reverse-transcription polymerase 1784

reactionkit,Qiagen,Valencia,CA)usingcustomspecificprimers(primersequences 1785

availableuponrequest).Afteramplification,RT-PCRproductswerepurifiedusingthe 1786

Nucleo Spin Gel and PCR clean up (MACHEREY-NA-GEL GmbH&CoKG, Duren, 1787

Germany) DNA purification kit. Samples were sequenced by GATC Biotech AG 1788

(Constance,Germany)usingtheSangerABI3730xlplatform.Sequencingwasdone 1789

with custom designed primers (primer sequences available upon request). HA,M 1790

andPB1genesegmentswerecomparedatthenucleotideandaminoacid(aa)level 1791

usingMEGALIGN programwithin the DNASTAR 5.01 software package (DNASTAR, 1792

Inc., Madison, WI, USA). The complete genome sequences of A/quail/Hong 1793

Kong/G1/1997 (H9N2) were already available from GenBank (accession numbers: 1794

AF156378.1 (HA),AF156463.1 (M),AF156421.1 (PB1). The sequences generated in 1795

thisstudyareavailablethroughGenBankaccessionnumbers(KY785881-KY785895) 1796

1797

3.3 Results 1798

SerialpassagesofavianH9N2virusinswineisassociatedwithatransientincrease 1799

invirusreplication 1800

Theprimegoal of this studywas to assess the capacity of an avianH9N2 virus to 1801

adapttoswine.Forthis,tenblindserialpassageswereperformedininfluenzanaïve 1802

pigs. Animals were clinically scored and samples from the upper and lower 1803

respiratory tract were isolated to monitor viral loads. None of the pigs showed 1804

clinicalsigns.Anoverviewofthevirustitersinnasalswabsofindividualpigsthrough 1805

thedifferentpassagesisshowninFigure1.H9N2viruswasdetectedinnasalswabs 1806

ofallpigs,except for1pigduringpassage9andbothpigsduringpassage10.The 1807

highestvirustiterswerereachedduringpassages4and5(7.3log10TCID50/100mg). 1808

1809

Page 71: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

EffectofserialpigpassagesonadaptationofanavianH9N2influenzavirustoswine

60

1810

Figure1.NasalvirusexcretionofA/quail/HongKong/G1/1997influenzavirusduring 1811tenblindserialpigpassages.Twopigs(solid lineanddashedline)were involvedin 1812each passage, each line represents the individual virus titers in nose swabs. The 1813detectionlimitofthetestisindicatedwithadottedlineat1.7log10TCID50/100mgof 1814secrete. 1815

Page 72: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter3

61

Onday4after inoculation,pigswereeuthanizedandsamples fromtheupperand 1816

lowerrespiratory tractwerecollectedtodeterminetheviral load. InfectiousH9N2 1817

viruswas found in the respiratory tractof all pigsexcept for thoseofpassage ten 1818

(Table1).Thenumberofviruspositivesamplesandamountofvirusinthedifferent 1819

tissue samples were in concordance with nasal virus excretion results, with 1820

considerablevariationbetween individualpigsandpassages (compareTable1and 1821

Figure1). Interestingly, replication rateswerehigher in theupper respiratory tract 1822

(nasal mucosa: respiratory and olfactory parts) with 36 out of 40 (90%) samples 1823

testingpositive,thaninthelowerrespiratorytract(tracheaandlungs)with65outof 1824

134 (49%) samples positive. In the upper respiratory tract, virus was isolated at 1825

similarfrequencyfromtheolfactoryandtherespiratorypartsofthenasalmucosa. 1826

Afterthefirst3passagesviruswasisolatedfromsomeofthelowerrespiratorytract 1827

samples,indicatingthatatearlypassagesthevirusdidnotreplicateuniformlyinthe 1828

entirelung.Onlyduringpassage5,afterinoculationwithpassage4virus,infectious 1829

virus was clearly detected in all samples, suggesting replication in the entire 1830

respiratory tract. Remarkably, following passage 5, the virus seemed to gradually 1831

have lost its ability to replicate in the lower respiratory tract and eventually, at 1832

passage10,infectivitywascompletelylost. 1833

1834

Page 73: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Table1.DistributionofA/quail/HongKong/G1/1997avianinfluenzavirusintherespiratorytractduringtenserialpassagesinpigs. 1835 1836

Numberofpassage Pignumber

Virustiter(log10TCID50/gramoftissue)atday4post-inoculationaNasalmucosa

respiratorypartNasalmucosaolfactorypart Proximaltrachea Distaltrachea Apical+cardiac

loberightApical+cardiac

lobeleftDiaphragmatic

loberightDiaphragmatic

lobeleftAccessory

lobe

1#1 4 3 2

b 4.7 <

c 4.5 < <

#2 5.2 6.5 2.5 4.5 < < < 1.7

2#3 5.5 4.5 2 < < < < <

#4 6.5 4.2 < < < < < 2

3#5 6.5 6.5 < 2 < < < <

#6 5 5.3 1.7 < < < 1.7 1.7

4#7 7.2 6.2 < < < 1.7 < 1.7 <

#8 5.7 3.3 4.5 4.2 5 1.7 1.7 < 4.3

5#9 5 5.5 3.3 4.3 5.3 5.2 3.7 5.2 2.3

#10 7 7.7 5.8 5.3 3.8 2.2 2 5 4.7

6#11 4.7 5.5 3.7 2.7 4.5 2.6 < < 5.7

#12 5.7 4.5 3.5 5.3 5.5 2 4.4 4.4 5.5

7#13 7 2.8 5.5 < < < < < 1.7

#14 5.3 4 2.7 5 6.4 4.7 4.5 3.8 5.7

8#15 3.7 5 < < < 2.3 < < <

#16 5.3 1.7 3.5 5.5 2 < 4.5 3.3 4.7

9#17 2 1.7 < < < < < < 1.7

#18 4.2 2.3 < < < < < < 2.3

10#19 < < < < < < < < <

#20 < < < < < < < < <aVirustitersareshownforeachindividualpig(#). 1837bProximalanddistaltracheasampleswerecombinedduringpassages1to3. 1838

c<detectionlimit(1.7log10TCID50/gramoftissue). 1839 1840

Page 74: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter3

63

H9N2virusbecomescontacttransmissibleafter4serialpassagesinpigs 1841

To assess the level of adaptation of the virus after serial blind passages in pigs, 3 1842

different viruses were tested in 3 independent direct contact transmission 1843

experiments. As a positive control, we used the A/California/04/2009 (A/Cal/04/09) 1844

pH1N1virus,whichisrepresentativeofswine-adaptedinfluenzaviruses(Vincentetal., 1845

2014, Watson et al., 2015, Lewis et al., 2016). The parental A/quail/Hong 1846

Kong/G1/1997 (A/Qa/HK/P0) H9N2 virus served as starting material for the serial 1847

passages.Thepassage4H9N2virussample(A/Qa/HK/P4)thatwasusedtoinoculate 1848

animalsinpassage5wasalsoselectedforthetransmissionexperiment,becausebased 1849

onvirustitersinnasalswabsandrespiratorytractsamplesthisvirusseemedtohave 1850

gainedthehighestswine-adaptation.All3viruseswereamplifiedinMDCKcellsbefore 1851

inoculation of the index pigs and the transmission experiment was performed in 1852

triplicateforeachvirus. 1853

Figure2 shows thenasal virus sheddingof the inoculatedand theco-houseddirect- 1854

contact animals. All piglets remained clinically healthy, basedon clinical observation 1855

scores.All inoculatedanimalsexcretedvirusbetweendays1and8post-inoculation. 1856

Comparison of the AUC revealed lower virus excretion for A/Qa/HK/P0 (18.4) and 1857

A/Qa/HK/P4 (19.1) than forA/Cal/04/09 (26.6), although thesedifferenceswerenot 1858

statisticallysignificant(p<0.05).Ofall9inoculatedanimals5reachedamaximumvirus 1859

titer of ≥ 6.5 log10 TCID50/100 mg of secrete. All inoculated animals developed 1860

antibodies against the homologous virus (Table 2). Higher antibody titers were 1861

observedinA/Cal/04/09inoculatedpigsthaninH9N2infectedanimals. 1862

1863

Page 75: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

EffectofserialpigpassagesonadaptationofanavianH9N2influenzavirustoswine

64

1864

1865

Figure 2. Nasal virus excretion and direct contact transmission of A/Qa/HK/P0, 1866A/Qa/HK/P4 and A/Cal/04/09 influenza viruses in pigs. Three pigs were intranasally 1867inoculatedwith6.5log10TCID50oftheindicatedvirusperpigandindividuallyhousedin 1868different isolators. Forty-eight hours later, 2 direct contact animals were co-housed 1869with the inoculatedpigs.Eachgraphic is identifiedwitha2digitsnumber: the first1 1870correspondstotheisolatornumberandthesecondtothevirustested.Therefore,each 1871columnrepresentsadifferentvirusandeach rowrepresentsadifferent isolator.The 1872detectionlimit(dottedline)ofthetestwas1.7log10TCID50/100mgofsecrete. 1873 1874

Page 76: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter3

65

Table 2. Antibody responses in inoculated and direct contact pigs involved in 1875transmissionexperimentsmeasuredbyVNtest. 1876

1877

VirusstrainNumberofantibodypositivepigs(rangeofantibodytiters)

Inoculatedpigs(n=3) Directcontactpigs(n=6)

0 16 23 30dpia 0 14 21 28dpcb

A/Qa/HK/P0 0(<2) 3(2-12) 3(6-24) 3(6-12) 0(<2) 2(24-32) 2(8-16) 2(16-24)

A/Qa/HK/P4 0(<2) 3(32-384) 3(64-128) 3(48-128) 0(<2) 1(4) 5(2-64) 5(2-12)

A/Cal/04/09 0(<2) 3(128-192) 3(192-384) 3(512-768) 0(<2) 6(192-1024)6(256-1536) 6(192-1024)adpi:dayspost-inoculation. 1878bdpc:dayspost-contact. 1879

1880

Only1outof6directcontactanimalsintheA/Qa/HK/P0groupshedvirusduringmore 1881

than5 days resulting in ameanAUCof 2.8. In contrast, all 6 animals thatwere co- 1882

housedwithanA/Qa/HK/P4virus inoculatedpig, excretedvirus for5daysormore. 1883

Thevirusexcretionwasnothomogeneousovertime(meanAUCof5.9)andpeakviral 1884

loads in contact animals were approximately 100-fold lower compared to the viral 1885

titers in thenasalexcretionsof theA/Qa/HK/P4 indexpigs (Figure2). Incontrast,all 1886

directcontactpigsintheA/Cal/04/09groupshedvirusinapatternthatisverysimilar 1887

tothatofthe inoculatedpigs,withameanAUCof19.7,andsimilarpeakviraltiters. 1888

ThedifferencebetweentheAUCvaluesoftheA/Qa/HK/P4direct-contactpigsandthe 1889

A/Qa/HK/P0 direct contact pigs was not statistically significant (p<0.05). However, 1890

bothgroupsshedsignificantly lessvirus thanA/Cal/04/09contactpigs (p<0.05).Five 1891

out of 6 A/Qa/HK/P4 contact animals had antibodies against the homologous virus, 1892

while only 2 animals that had been exposed to A/Qa/HK/P0 infected index animals 1893

seroconverted. As expected, all 6 A/Cal/04/09 contact animals seroconverted, with 1894

higher titers than theonesdetected in theH9N2direct contact animals. Thesedata 1895

allowed us to determine the R0 value, a measure for the transmissibility of an 1896

infectious agent. R0was 0.76 (95%CI: 0.10-5.49) for A/Qa/HK/P0 and 2.27 (95%CI: 1897

0.54-9.29)forA/Qa/HK/P4.BecauseallA/Cal/04/09contactpigsbecameinfected,the 1898

estimatedR0valuewas∞(95%CI:0.83-∞)forthisexperimentalsetting.Insummary, 1899

A/Qa/HK/P4 showed enhanced transmission compared to A/Qa/HK/P0, but both 1900

virusestransmittedlessefficiencythanA/Cal/04/09. 1901

In addition, we evaluated the replication kinetics of the viruses tested in the 1902

transmissionexperimentsbydeterminingthesingle-stepgrowthcurve inMDCKcells 1903

Page 77: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

EffectofserialpigpassagesonadaptationofanavianH9N2influenzavirustoswine

66

foreachvirus.Asdemonstratedinfigure3,thegrowthkineticsofthe3viruseswere 1904

verysimilar.Therefore,theresultsshowthattheenhancedinvivotransmissionofthe 1905

A/Qa/HK/P4virusdidnothaveanimpactontheinvitroreplicationkineticsofthevirus 1906

inacontinuouscellline. 1907

1908

1909

Figure3.Theeffectoftheserialpassagingontheamountofvirusproducedoverthe 1910course of the experiment using a single-step growth assay inMDCK cells. Each data 1911pointonthecurveisthemean±SDofthe3independentexperiments. 1912 1913

Mutationsassociatedwithpigadaptation 1914

WecomparedtheviraldiversitypresentintheH9N2virusstockthatwasusedtostart 1915

theserialpassageswiththeviraldiversitypresentinthevirussampledafterpassage4 1916

fromthenasalmucosa (afterasingle roundofamplificationonMDCKcells)andthe 1917

lung. The viral diversity was analysed in virus (pooled from 2 pigs) sampled after 1918

passage 4, since higher virus shedding and higher viral replication in the upper and 1919

lower respiratory tract was obtained upon inoculation with this virus. It was 1920

anticipatedthatacomparisonoftheviraldiversitypresentinthevirusfromtheupper 1921

and lower respiratory tract would enable us to determine if these 2 airway 1922

compartments favour the acquirement of a different set of mutations for optimal 1923

adaptation. In addition, sequencing of the virus stock is needed to determine if the 1924

detectedpigmutationswerealreadypresentinthevirusinoculumatthestartofthe 1925

Page 78: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter3

67

serial passages or if they arose de novo. Illumina MiSeq deep sequencing was 1926

performedon full genomeRT-PCRproductsof the samples.Nucleotidevariants that 1927

differ fromtheconsensussequenceof theA/quail/HongKong/G1/1997 (H9N2)virus 1928

stocksamplethatwasusedtostarttheserialpassagesandthatoccuratafrequency 1929

of 5% or more are shown in Table 3. Two mutations were present in the starting 1930

material. These arenon-synonymousmutations that alter 2 adjacent aminoacidsof 1931

the polymerase acidic protein (PA). Interestingly, after 4 passages a substitution of 1932

aspartic acid by glycine at position 225 of the HA RBS (HA-D225G) was present in 1933

80.1%ofthesequencesderivedfromtheviralpopulationofthenasalmucosaandin 1934

99.6%oftheviralpopulationofthelungtissuesample.Anothersubstitutionwasclose 1935

to 100% present in lung homogenate virus, resulting in an alanine to threonine 1936

substitution at position 29 (M2-A29T) inmatrix protein 2 (M2). In addition, 2more 1937

substitutionsappeared in thenasalmucosaafter4passages:1 inPAandanother in 1938

non-structuralprotein1(NS1).These2mutationswerepresentatafrequencybelow 1939

10%.Inthelungvirussamples,3mutationsnewlyappearedwithfrequenciesranging 1940

from23.37to44.19%.Thesemutationswerepresentinpolymerasebasic1(PB1),HA 1941

andnucleoprotein(NP). 1942

1943

Table 3.Mutations present in parental and passage 4 H9N2 virus isolated from the 1944nasalrespiratorymucosaorfromthelung.Theviralgenesegmentisindicated,along 1945with thenucleotidepositionandsubstitutions, thepredictedaminoacidchangeand 1946itspositionandfinallythefrequency(percentage)ofsequencereadswiththedetected 1947mutations. Only nucleotide substitutions that resulted in amino acid changes and 1948appearedatafrequency≥5%inthereadsareshown.Thevirus inthenasalmucosa 1949samplewasamplifiedonMDCKcellsbeforesequencing. 1950

1951

Segment Nucleotideposition Reference Mutation Aminoacid

changeFrequency

A/Qa/HK/P0

FrequencyA/Qa/HK/P4(nasalmucosa)

FrequencyA/Qa/HK/P4

(lung)PB1 559 A G Glu172Gly <a < 42.34

PA1239 G A Glu399Lys < 5.00 <1506 A G Lys488Glu 10.25 11.21 7.841509 T A Cys489Ser 21.37 21.79 10.27

HA207 A G His44Arg < < 23.37750 A G Asp225Gly < 80.88 99.96959 T C Phe295Leu < < 44.19

NP 1347 G A Ala428Thr < 7.29 10.99M 818 G A M2:Ala29Thr < 23.26 98.33NS 191 A G NS1:Thr49Ala < 9.58 <

a<:mutationnotdetectedusing5%asvariantcallingthreshold 1952

Page 79: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

EffectofserialpigpassagesonadaptationofanavianH9N2influenzavirustoswine

68

Toevaluateifthesubstitutionspresentatthehighestfrequencyinthepassage4virus 1953

(HA-D225G, HA-F295L, M2-A29T and PB1-E172G) were maintained during the 1954

subsequent passages we sequenced the HA, M and PB1 coding-genes of the virus 1955

present in the inocula used to infect pigs from passages 6 to 10. Interestingly, the 1956

substitutions observed in the A/Qa/HK/P4 nasalmucosaweremaintained during all 1957

passages. However, the substitutions detected in the lung sample were no longer 1958

foundinfurtherpassages. 1959

1960

3.4 Discussion 1961

AvianH9N2virusesplayapivotalroleintheecologyofinfluenzainpoultryinEurasian 1962

countries.Sincethelate1990’s,recurrentdead-endinfectionswithH9N2viruseshave 1963

beenreportedinpigsandhumans(WorldHealthOrganization,2015,Buttetal.,2010, 1964

Guetal.,2014).Moreover,serologicalstudiesinAsianpoultryworkersandinChinese 1965

pigsrevealedsignificantexposuretoH9N2(Blairetal.,2013,Zhouetal.,2014,Wang 1966

etal.,2016).ThecontinuousexposuretoavianH9N2virusesmightposearealthreat 1967

forpublichealthiftheseviruseswouldacquiremutationsthatallowthemtotransmit 1968

efficientlybetweenmammals.Pigsareconsidered intermediatehosts inwhichavian 1969

H9N2 influenza viruses may acquire such mutations. We have therefore examined 1970

whetherblindserialpassagesofanavianH9N2virus inswinewouldresult inswine- 1971

adaptivemutations.Weconsideraninfluenzavirusasswine-adaptedifitsucceedsto 1972

transmitbetweenpigsinanexperimentalsettingwithasimilarefficiencyasendemic 1973

swineinfluenzaviruses.Therefore,wealsoperformedatransmissionexperimentwith 1974

theparentalandatleastpartiallyswineadaptedH9N2virus. 1975

OurresultsconfirmthesusceptibilityofpigstointranasalinoculationwithavianH9N2 1976

influenzavirusesreportedinpreviousexperimentalstudiesandinnature(TheSJCEIRS 1977

H9 Working Group, 2013, Wang et al., 2016, Kida et al., 1994, Sun et al., 2010). 1978

However, they are not in agreement with 2 previous studies in which avian H9N2 1979

virusesfailedtoreplicateinpigs.DeVleeschauweretal.(2009)intranasallyinoculated 1980

pigs with A/chicken/Belgium/818/1979 (H9N2) and found that this strain was not 1981

excretedatallbytheinoculatedpigs(DeVleeschauweretal.,2009b).Thoughgenetic 1982

information of this specific isolate is not available, the lack of replication in the 1983

Page 80: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter3

69

inoculatedpigswas likelyduetothe fact thatEuropeanH9N2 isolatesbelongtothe 1984

Y439-likelineage,whichlikelylacktheabilitytoreplicateinpigs(Slomkaetal.,2013, 1985

Wangetal.,2016).Inthesecondstudy,Qiaoetal.(2012)usedthesameA/quail/Hong 1986

Kong/G1/1997(H9N2)strain,toinoculatepigsintratracheallyandtheydetectednasal 1987

virusexcretioninonly1outof12inoculatedanimals,albeitatlowvirustiters(Qiaoet 1988

al.,2012).Theverypoorcapacitytoreplicateinswinecomparedtoourfindingswith 1989

A/quail/Hong Kong/G1/1997 (H9N2) can be explained by the different inoculation 1990

routesusedinourandQiao’sstudy,whichwillresultindifferentsitesofprimaryvirus 1991

replication. Ithasbeendemonstrated that replication in thenasalmucosaandnasal 1992

virusexcretionissecondarytoanddependentonreplicationinthelowerairwaysafter 1993

intratrachealexposure. Intratracheal inoculation thususually results indelayednasal 1994

virusexcretionand lowernasalvirustitersascomparedtothe intranasal inoculation 1995

(DeVleeschauweretal.,2009a).Moreover,weconfirmedpreviousreportsdescribing 1996

the susceptibility of pigs to AIVs of different subtypes (Kida et al., 1994, De 1997

Vleeschauweretal.,2009b,Liuetal.,2014).TheparentalH9N2virusreplicatedinthe 1998

upper respiratory tract at low to moderate titers while most samples of the lower 1999

respiratory tract tested virus negative. The relative lack of Siaα2,3Gal receptors in 2000

humanandswineupperrespiratorytractisthoughttorestricttheefficientreplication 2001

ofAIVsinmammals.Therefore,ashiftfromSiaα2,3GaltoSiaα2,6Galreceptor-binding 2002

preference has been appointed as a critical step in the adaptation of AIVs to 2003

mammalianhosts(ImaiandKawaoka,2012).ForH9,aswellasforH3,H5andH7avian 2004

subtypes, the HA-Q226L substitution contributes to increased Siaα2,6Gal receptor 2005

preferenceand isassociatedwithhigher replication ratesand transmissibility inpigs 2006

andferrets(WanandPerez,2007,Wanetal.,2008,Liuetal.,2014,VanPouckeetal., 2007

2013,Herfst et al., 2012). ThoughourparentalH9N2 virus already contains theHA- 2008

Q226Lsubstitution,thevirusdistributionandreplicationratesdescribedinourstudy 2009

were similar to those observed in pigs that had been inoculated with H5N2 AIV 2010

subtypeviruswitha“pure”aviangenome,i.e.withHA-226Q(DeVleeschauweretal., 2011

2009a). Our data therefore question the role of the HA-Q226L substitution in 2012

replication efficiency in pigs but are in line with more recent studies, which 2013

demonstratethatresidue226inHAisnotstrictlydeterminativeforthereplicationof 2014

H9N2 viruses in pigs or ferrets (The SJCEIRSH9WorkingGroup, 2013). Comparative 2015

Page 81: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

EffectofserialpigpassagesonadaptationofanavianH9N2influenzavirustoswine

70

studieswithHA-226LandHA-226QwouldberequiredtoevaluatetheeffectoftheHA- 2016

Q226L substitution inpigs. In contrast to theparentalH9N2virus, the virus isolated 2017

after4pigpassagesreplicatedhomogeneouslythroughouttheentirerespiratorytract. 2018

Wecomparedpig-to-pigtransmissionofthisviruswiththatoftheparentalH9N2and 2019

pH1N1.WhiletheparentalH9N2viruslargelyfailedtotransmittodirectcontactpigs, 2020

the fourth passage virus showed enhanced transmissibility as demonstrated by the 2021

AUCandtheR0.Thisvirusshowedalsohighertransmissionefficiencywhencompared 2022

withpreviousstudieswithH9N2aswellasotheravianinfluenzavirussubtypesinpigs. 2023

Inallofthesestudiesthedirectcontactpigsexcretednoorminimalamountofvirus 2024

(De Vleeschauwer et al., 2009b,Wang et al., 2016, The SJCEIRS H9WorkingGroup, 2025

2013).However, transmissionof the fourth passage virus remained far less efficient 2026

thanthatofendemicswineinfluenzaviruses.Althoughthe3virusesshoweddifferent 2027

phenotypesinpigs,theirgrowthkineticsinMDCKcellsweresimilar,indicatingapoor 2028

correlationbetweentheinvivophenotypeandinvitroreplicationratesoncontinuous 2029

cell lines. Furthermore, from passage 7 onwards the virus replication progressively 2030

decreaseduntilitwaslost.Thisresultmaybeexplainedbythegenerationofanarrow 2031

bottleneck after passage 4 due to the strong genetic pressure posed by the 2032

experimental setup,whichmaydecrease thediversityof theviralpopulationwhich 2033

canhampertheadaptationprocess(Varbleetal.,2014,Zaraketetal.,2015). 2034

GeneticchangesduringAIVpassageinanimalsarenotpredictable(Dlugolenskietal., 2035

2011).Tobetterunderstandtheeffectoftheserialpassaging intheviruspopulation 2036

andthebehaviourofthevirusinourtransmissionexperimentwecomparedtheviral 2037

diversityintheoriginalwild-typeH9N2viruswiththevirusisolatedfromnasalmucosa 2038

and lung after 4 passages.We observed that the upper and lower respiratory tract 2039

selected fordifferentvirusvariants.Moreover, themutations identified in theupper 2040

respiratorytractweremaintainedduringthesubsequentpassages,whilethosefound 2041

inthe lungvirussampleswerenotmaintainedinthesubsequentpassages.Although 2042

more genetic analyses might be necessary to better understand this discrepancy 2043

between the viral selection pressure in the upper and lower respiratory tract, this 2044

points to a possible role of the mutations detected in the lung samples in the 2045

enhanced replicationand transmissibility.Only1outof the10mutationswe found, 2046

theHA-D225Gsubstitution,hasbeenpreviouslydescribed in the literature (Romero- 2047

Page 82: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter3

71

Tejeda and Capua, 2013, Richard et al., 2014, Taubenberger and Kash, 2010). This 2048

mutationarosedenovoinboththeupperandlowerrespiratorytractafter4passages 2049

and it was associated with a higher replication efficiency during passage 5. 2050

Interestingly,thismutationwasalsopresentinall42swineand17humanH9N2field 2051

isolatesavailableinGenBank(seeFigures4and5).In1918and2009H1N1pandemic 2052

viruses,HA-D225GsubstitutionhasbeenassociatedwithincreasedSiaα2,3Galtropism 2053

conferring those viruses dual Siaα2,6Gal and Siaα2,3Gal receptor binding affinity 2054

(Lakdawalaetal.,2015,Belseretal.,2011,Tumpeyetal.,2007).Inpigs,aswellasin 2055

humans, Siaα2,3Gal receptors are predominantly found in the lungs and not in the 2056

upperrespiratorytract(VanPouckeetal.,2010).Theemergenceofthismutationafter 2057

4 passages could therefore explain the enhanced replication in the lungs. 2058

Nevertheless,ininvitrosialylglycoproteinbindingassaysH9N2virusescontainingHA- 2059

225G and HA-226L, as our fourth passage virus, showed only slightly increased 2060

Siaα2,6Galbindingaffinity (Lakdawalaetal.,2015,Matrosovichetal.,2001).Though 2061

specific binding tests would be needed to clarify the exact role of the HA-D225G 2062

substitution,ourdata suggest that it isan importantmarker foradaptationofH9N2 2063

AIVstopigs. 2064

Insummary,ourresultsdonotrejectthetheoryofthepigasanintermediatehostfor 2065

H9N2 AIVs, but demonstrate that adaptation of these viruses to pigs is a complex 2066

processandthatthemutationsselectedafter4passagesinpigswerenotsufficientto 2067

confer efficient pig-to-pig transmission. It also shows that additional molecular 2068

featuresmayberequiredforefficienttransmissionofavianH9N2virusesinpigs.Qiao 2069

et al. (2012) and Obadan et al. (2015) showed that reassortant H9N2 viruses 2070

containing pH1N1 internal genes improved replication and transmissibility in pigs, 2071

althoughtheywerestill lessefficientthanpH1N1virus. InpreviousH9N2adaptation 2072

studies in mammals, efficient transmission was only reached with ferret-passaged 2073

reassortantH9N2viruses containingeitherhumanseasonalH3N2orpH1N1 internal 2074

genes (Sorrell et al., 2009, Kimble et al., 2011). Therefore, the combination of 2075

mammalianadaptedinternalgeneswithserialpassagingmayberequiredtoselecta 2076

fullytransmissibleH9N2virus. 2077

2078

Page 83: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

EffectofserialpigpassagesonadaptationofanavianH9N2influenzavirustoswine

72

2079

Figure4.AlignmentofthededucedaminoacidsequencesintheHAofallswineH9N2 2080isolates (n=42)available inGenBankon22ndAugust2016.Thenameofeachstrain 2081included in the analysis is followed by the accession number between brackets. 2082Residuesatpositions190,225,226and228arehighlightedingray.Aminoacidsthat 2083are different from those in A/quail/Hong Kong/G1/1997 are shown; conserved 2084residuesareshownasdots. 2085 2086

Page 84: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter3

73

2087

Fig 5. Alignment of deduced amino acid sequences in the HA of all human H9N2 2088isolates (n=17)available inGenBankon22ndAugust2016.Thenameofeachstrain 2089included intheanalysis is followedbytheaccessionnumber inbrackets.Residuesat 2090positions190,225,226and228arehighlightedingray.Aminoacidsthataredifferent 2091fromthoseinA/quail/HongKong/G1/1997areshown;conservedresiduesareshown 2092asdots. 2093 2094

3.5 Acknowledgements 2095

TheauthorswouldliketoexpresstheirgratitudetoDr.JohnNichollsforprovidingthe 2096

H9N2 influenza viruses and Lieve Sys,Melanie Bauwens, Nele Dennequin and Laura 2097

VanDriesscheforexcellent technicalassistance.ThisstudywassupportedbytheEU 2098

FLUPIG project (FP7-GA 258084). Silvie Van denHoecke is supported by Fonds voor 2099

WetenschappelijkOnderzoek(3G052412). 2100

2101

3.6 References 2102

Belser, J. A., Jayaraman, A., Raman, R., Pappas, C., Zeng, H. et al. (2011). Effect of D222G 2103mutation in the hemagglutinin protein on receptor binding, pathogenesis and 2104transmissibilityofthe2009pandemicH1N1influenzavirus.PLoSOne,6,e25091. 2105

2106Blair,P. J.,Putnam,S.D.,Krueger,W.S.,Chum,C.,Wierzba,T.F.etal. (2013).Evidence for 2107

avian H9N2 influenza virus infections among rural villagers in Cambodia. J Infect Public 2108Health,6,69-79. 2109

2110Butt, A. M., Siddique, S., Idrees, M. and Tong, Y. (2010). Avian influenza A (H9N2): 2111

computational molecular analysis and phylogenetic characterization of viral surface 2112proteinsisolatedbetween1997and2009fromthehumanpopulation.VirolJ,7,319. 2113

2114Cong, Y. L., Pu, J., Liu, Q. F., Wang, S., Zhang, G. Z. et al. (2007). Antigenic and genetic 2115

characterizationofH9N2swineinfluenzavirusesinChina.JGenVirol,88,2035-41. 2116 2117

Page 85: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

EffectofserialpigpassagesonadaptationofanavianH9N2influenzavirustoswine

74

Connor, R. J., Kawaoka, Y.,Webster, R. G. and Paulson, J. C. (1994). Receptor specificity in 2118human,avian,andequineH2andH3influenzavirusisolates.Virology,205,17-23. 2119

2120De Vleeschauwer, A., Atanasova, K., Van Borm, S., van den Berg, T., Rasmussen, T. B. et al. 2121

(2009a).ComparativepathogenesisofanavianH5N2andaswineH1N1influenzavirusin 2122pigs.PLoSOne,4,e6662. 2123

2124DeVleeschauwer,A.,VanPoucke,S.,Braeckmans,D.,VanDoorsselaere,J.andVanReeth,K. 2125

(2009b). Efficient transmission of swine-adapted but not wholly avian influenza viruses 2126amongpigsandfrompigstoferrets.JInfectDis,200,1884-92. 2127

2128Dlugolenski,D., Jones,L.,Saavedra,G.,Tompkins,S.M.,Tripp,R.A.etal. (2011).Passageof 2129

low-pathogenicavianinfluenza(LPAI)virusesmediatesrapidgeneticadaptationofawild- 2130birdisolateinpoultry.ArchVirol,156,565-76. 2131

2132Gu,M.,Chen,H.,Li,Q.,Huang,J.,Zhao,M.etal. (2014).EnzooticgenotypeSofH9N2avian 2133

influenza virusesdonates internal genes to emerging zoonotic influenza viruses inChina. 2134VetMicrobiol,174,309-15. 2135

2136Guo, Y. J., Krauss, S., Senne, D. A.,Mo, I. P., Lo, K. S. et al. (2000). Characterization of the 2137

pathogenicityofmembersof thenewlyestablishedH9N2 influenzavirus lineages inAsia. 2138Virology,267,279-88. 2139

2140Herfst, S., Schrauwen, E. J., Linster, M., Chutinimitkul, S., deWit, E. et al. (2012). Airborne 2141

transmissionofinfluenzaA/H5N1virusbetweenferrets.Science,336,1534-41. 2142 2143Imai, M. and Kawaoka, Y. (2012). The role of receptor binding specificity in interspecies 2144

transmissionofinfluenzaviruses.CurrOpinVirol,2,160-7. 2145 2146Kahn, R. E.,Ma,W. and Richt, J. A. (2014). Swine and influenza: a challenge to one health 2147

research.CurrTopMicrobiolImmunol,385,205-18. 2148 2149Kida,H., Ito,T., Yasuda, J., Shimizu,Y., Itakura,C.etal. (1994).Potential for transmissionof 2150

avianinfluenzavirusestopigs.JGenVirol,75(Pt9),2183-8. 2151 2152Kimble,J.B.,Sorrell,E.,Shao,H.,Martin,P.L.andPerez,D.R.(2011).CompatibilityofH9N2 2153

avianinfluenzasurfacegenesand2009pandemicH1N1internalgenesfortransmissionin 2154theferretmodel.ProcNatlAcadSciUSA,108,12084-8. 2155

2156Lakdawala,S.S., Jayaraman,A.,Halpin,R.A., Lamirande,E.W.,Shih,A.R.etal. (2015).The 2157

soft palate is an important site of adaptation for transmissible influenza viruses.Nature, 2158526,122-5. 2159

2160Lewis, N. S., Russell, C. A., Langat, P., Anderson, T. K., Berger, K. et al. (2016). The global 2161

antigenicdiversityofswineinfluenzaAviruses.Elife,2016;5:e122175. 2162 2163Lin, Y. P., Shaw, M., Gregory, V., Cameron, K., Lim, W. et al. (2000). Avian-to-human 2164

transmissionofH9N2 subtype influenzaA viruses: relationshipbetweenH9N2andH5N1 2165humanisolates.ProcNatlAcadSciUSA,97,9654-8. 2166

2167

Page 86: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter3

75

Liu,Q.,Zhou,B.,Ma,W.,Bawa,B.,Ma,J.etal.(2014).AnalysisofrecombinantH7N9wild-type 2168and mutant viruses in pigs shows that the Q226L mutation in HA is important for 2169transmission.JVirol,88,8153-65. 2170

2171Matrosovich, M. N., Gambaryan, A. S., Teneberg, S., Piskarev, V. E., Yamnikova, S. S. et al. 2172

(1997). Avian influenza A viruses differ from human viruses by recognition of 2173sialyloligosaccharides and gangliosides and by a higher conservation of theHA receptor- 2174bindingsite.Virology,233,224-34. 2175

2176Matrosovich, M. N., Krauss, S. and Webster, R. G. (2001). H9N2 influenza A viruses from 2177

poultryinAsiahavehumanvirus-likereceptorspecificity.Virology,281,156-62. 2178 2179Matrosovich,M.,Herrler,G.andKlenk,H.D.(2015).SialicAcidReceptorsofViruses.TopCurr 2180

Chem,367,1-28. 2181 2182Matsuoka,Y.,Lamirande,E.W.andSubbarao,K. (2009).Theferretmodelfor influenza.Curr 2183

ProtocMicrobiol,Chapter15,Unit15G2. 2184 2185Obadan,A.O.,Kimble,B. J.,Rajao,D.S., Lager,K.,Santos, J. J.etal. (2015).Replicationand 2186

transmission of mammalian-adapted H9 subtype influenza virus in pigs and quail. J Gen 2187Virol,96(9),2511-21. 2188

2189Peiris,M.,Yuen,K.Y., Leung,C.W.,Chan,K.H., Ip,P. L.etal. (1999).Human infectionwith 2190

influenzaH9N2.Lancet,354,916-7. 2191 2192Peiris, J. S., Guan, Y.,Markwell, D., Ghose, P.,Webster, R. G. et al. (2001). Cocirculation of 2193

avianH9N2andcontemporary"human"H3N2 influenzaAviruses inpigs insoutheastern 2194China:potentialforgeneticreassortment?JVirol,75,9679-86. 2195

2196Qiao,C.,Liu,Q.,Bawa,B.,Shen,H.,Qi,W.etal. (2012).Pathogenicityandtransmissibilityof 2197

reassortant H9 influenza viruses with genes from pandemic H1N1 virus. J Gen Virol, 93, 21982337-45. 2199

2200Richard,M., deGraaf,M. andHerfst, S. (2014). Avian influenza A viruses: from zoonosis to 2201

pandemic.FutureVirol,9,513-24. 2202 2203Romero-Tejeda, A. and Capua, I. (2013). Virus-specific factors associated with zoonotic and 2204

pandemicpotential.InfluenzaOtherRespirViruses,7Suppl2,4-14. 2205 2206Scholtissek, C., Burger, H., Kistner, O. and Shortridge, K. F. (1985). The nucleoprotein as a 2207

possiblemajor factor in determining host specificity of influenza H3N2 viruses.Virology, 2208147,287-94. 2209

2210Shichinohe,S.,Okamatsu,M.,Sakoda,Y.andKida,H. (2013).SelectionofH3avian influenza 2211

viruseswithSAalpha2,6Galreceptorspecificityinpigs.Virology,444,404-8. 2212 2213Slomka, M. J., Hanna, A., Mahmood, S., Govil, J., Krill, D. et al. (2013). Phylogenetic and 2214

molecularcharacteristicsofEurasianH9avianinfluenzavirusesandtheirdetectionbytwo 2215differentH9-specific RealTime reverse transcriptase polymerase chain reaction tests.Vet 2216Microbiol,162,530-42. 2217

2218

Page 87: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

EffectofserialpigpassagesonadaptationofanavianH9N2influenzavirustoswine

76

Sorrell, E. M., Wan, H., Araya, Y., Song, H. and Perez, D. R. (2009). Minimal molecular 2219constraintsforrespiratorydroplettransmissionofanavian-humanH9N2influenzaAvirus. 2220ProcNatlAcadSciUSA,106,7565-70. 2221

2222Sun,Y.,Pu,J.,Jiang,Z.,Guan,T.,Xia,Y.etal.(2010).Genotypicevolutionandantigenicdriftof 2223

H9N2influenzavirusesinChinafrom1994to2008.VetMicrobiol,146,215-25. 2224 2225Sun,Y.andLiu,J.(2015).H9N2influenzavirusinChina:acauseofconcern.ProteinCell,6,18- 2226

25. 2227 2228Suzuki,Y.,Ito,T.,Suzuki,T.,Holland,R.E.,Jr.,Chambers,T.M.etal.(2000).Sialicacidspecies 2229

asadeterminantofthehostrangeofinfluenzaAviruses.JVirol,74,11825-31. 2230 2231Taubenberger, J. K. and Kash, J. C. (2010). Influenza virus evolution, host adaptation, and 2232

pandemicformation.CellHostMicrobe,7,440-51. 2233 2234TheSJCEIRSH9WorkingGroup (2013).Assessing the fitnessofdistinct cladesof influenzaA 2235

(H9N2)viruses.EmergMicrobesInfect,2,e75. 2236 2237Tumpey, T.M.,Maines, T. R., VanHoeven,N.,Glaser, L., Solorzano,A. et al. (2007).A two- 2238

aminoacidchangeinthehemagglutininofthe1918influenzavirusabolishestransmission. 2239Science,315,655-9. 2240

2241VandenHoecke,S.,Verhelst,J.,Vuylsteke,M.andSaelens,X.(2015).Analysisofthegenetic 2242

diversityofinfluenzaAvirusesusingnext-generationDNAsequencing.BMCGenomics,16, 224379. 2244

2245Van Poucke, S. G., Nicholls, J.M., Nauwynck, H. J. and Van Reeth, K. (2010). Replication of 2246

avian,humanand swine influenzaviruses inporcine respiratoryexplantsandassociation 2247withsialicaciddistribution.VirolJ,7,38. 2248

2249VanPoucke,S.,Uhlendorff,J.,Wang,Z.,Billiau,V.,Nicholls,J.etal.(2013).Effectofreceptor 2250

specificity of A/Hong Kong/1/68 (H3N2) influenza virus variants on replication and 2251transmissioninpigs.InfluenzaOtherRespirViruses,7,151-9. 2252

2253Van Reeth, K., Gregory, V., Hay, A. and Pensaert,M. (2003). Protection against a European 2254

H1N2swine influenzavirus inpigspreviously infectedwithH1N1and/orH3N2subtypes. 2255Vaccine,21,1375-81. 2256

2257Varble,A.,Albrecht,R.A.,Backes, S.,Crumiller,M.,Bouvier,N.M.etal. (2014). InfluenzaA 2258

virustransmissionbottlenecksaredefinedbyinfectionrouteandrecipienthost.CellHost 2259Microbe,16,691-700. 2260

2261Vincent,A.,Awada,L.,Brown,I.,Chen,H.,Claes,F.etal.(2014).ReviewofinfluenzaAvirusin 2262

swineworldwide:acallforincreasedsurveillanceandresearch.ZoonosesPublicHealth,61, 22634-17. 2264

2265Vines,A.,Wells,K.,Matrosovich,M.,Castrucci,M.R.,Ito,T.etal.(1998).Theroleofinfluenza 2266

A virus hemagglutinin residues 226 and 228 in receptor specificity and host range 2267restriction.JVirol,72,7626-31. 2268

2269

Page 88: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter3

77

Wan, H. and Perez, D. R. (2007). Amino acid 226 in the hemagglutinin of H9N2 influenza 2270virusesdeterminescelltropismandreplicationinhumanairwayepithelialcells.JVirol,81, 22715181-91. 2272

2273Wan,H.,Sorrell,E.M.,Song,H.,Hossain,M.J.,Ramirez-Nieto,G.etal.(2008).Replicationand 2274

transmissionofH9N2 influenzaviruses in ferrets:evaluationofpandemicpotential.PLoS 2275One,3,e2923. 2276

2277Wang, J.,Wu,M.,Hong,W.,Fan,X.,Chen,R.etal. (2016). InfectivityandTransmissibilityof 2278

AvianH9N2InfluenzaVirusesinPigs.JVirol,90(7),3506-14. 2279 2280Watson, S. J.,Welkers,M. R., Depledge, D. P., Coulter, E., Breuer, J.M. et al. (2013). Viral 2281

population analysis and minority-variant detection using short read next-generation 2282sequencing.PhilosTransRSocLondBBiolSci,368,20120205. 2283

2284Watson, S. J., Langat, P., Reid, S. M., Lam, T. T., Cotten, M. et al. (2015). Molecular 2285

Epidemiology and Evolution of Influenza Viruses Circulating within European Swine 2286between2009and2013.JVirol,89,9920-31. 2287

2288World Health Organization. (2015). Influenza at the human-animal interface. Available: 2289

http://www.who.int/influenza/human_animal_interface/Influenza_Summary_IRA_HA_inte 2290rface_23_June_2015.pdf. 2291

2292WorldHealthOrganization.(2016).Antigenicandgeneticcharacteristicsofzoonoticinfluenza 2293

viruses and development of candidate vaccine viruses for pandemic preparedness. 2294Available: 2295http://www.who.int/influenza/vaccines/virus/201602_zoonotic_vaccinevirusupdate.pdf?u 2296a=1. 2297

2298Yu, H., Hua, R. H., Wei, T. C., Zhou, Y. J., Tian, Z. J. et al. (2008). Isolation and genetic 2299

characterizationof avianoriginH9N2 influenza viruses frompigs inChina.VetMicrobiol, 2300131,82-92. 2301

2302Yu,H.,Zhou,Y.J.,Li,G.X.,Ma,J.H.,Yan,L.P.etal.(2011).GeneticdiversityofH9N2influenza 2303

virusesfrompigsinChina:apotentialthreattohumanhealth?VetMicrobiol,149,254-61. 2304 2305Zaraket, H., Baranovich, T., Kaplan, B. S., Carter, R., Song, M. S. et al. (2015). Mammalian 2306

adaptation of influenza A(H7N9) virus is limited by a narrow genetic bottleneck. Nat 2307Commun,6,6553. 2308

2309Zhou,B.,Donnelly,M.E.,Scholes,D.T.,StGeorge,K.,Hatta,M.etal.(2009).Single-reaction 2310

genomic amplification accelerates sequencing and vaccine production for classical and 2311Swineoriginhumaninfluenzaaviruses.JVirol,83,10309-13. 2312

2313Zhou,P.,Zhu,W.,Gu,H.,Fu,X.,Wang,L.etal. (2014).AvianinfluenzaH9N2seroprevalence 2314

amongswinefarmresidentsinChina.JMedVirol,86,597-600. 2315 2316 2317

Page 89: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

2318 2319

Page 90: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

79

2320

AREASSORTANTH9N2 2321

INFLUENZAVIRUSCONTAINING 2322

2009PANDEMICH1N1 2323

INTERNAL-PROTEINGENES 2324

ACQUIREDENHANCEDPIG-TO- 2325

PIGTRANSMISSIONAFTER 2326

SERIALPASSAGESINSWINE 2327

2328

2329

2330

2331

2332

2333

2334

2335

2336

2337

Adaptedfrom: 2338

ManceraGracia,J.C.,VandenHoecke,S.,RichtJ.A.,Ma,W., 2339

SaelensX.,VanReethK. 2340

ScientificReports(2017)7:1323 2341

2342

4

Page 91: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

EffectofserialpassagesintheadaptationofareassortantH9N2containingpH1N1internalgenes

80

Abstract 2343

AvianH9N2and2009pandemicH1N1 (pH1N1) influenza viruses can infectpigs and 2344

humans,raisingtheconcernthatH9N2:pH1N1reassortantvirusescouldemerge.Such 2345

reassortant viruses demonstrated increased replication and transmissibility in pig 2346

experiments,butwerestillinefficientwhencomparedtopH1N1.Here,weevaluatedif 2347

a reassortantviruscontaining thehemagglutininandneuraminidaseofA/quail/Hong 2348

Kong/G1/1997 (H9N2) in theA/California/04/2009 (pH1N1) backbone could become 2349

better adapted to pigs by serial passaging. The tropism of the original H9N2:pH1N1 2350

(P0)viruswasrestrictedtothenasalmucosa,withnovirusdetectedinthetracheaor 2351

thelungs.Nevertheless,after7passages(H9N2:pH1N1(P7))thevirusreplicatedinthe 2352

entire respiratory tract.We also compared the transmissibility ofH9N2:pH1N1 (P0), 2353

H9N2:pH1N1 (P7)andpH1N1.Whileonly2/6direct-contactpigs showednasal virus 2354

excretionofH9N2:pH1N1(P0)formorethan5days,4/6direct-contactanimalsshed 2355

theH9N2:pH1N1(P7).Interestingly,virustitersinnasalsecretionsofthose4animals 2356

were similar to those obtained with the pH1N1, which readily transmitted to all 6 2357

contact animals. The broader tissue tropism and the increased post-transmission 2358

replicationafter7passageswereassociatedwiththeHA-D225Gsubstitution.Ourdata 2359

demonstratethatthepH1N1internal-proteingenestogetherwiththeserialpassages 2360

favouravianH9N2virusadaptationtopigs. 2361

2362

Page 92: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter4

81

4.1 Introduction 2363

H9N2avian influenzavirusesarecurrentlyendemic inpoultry inSouthEastAsiaand 2364

the Middle East (Sun et al., 2010). Since the late 1990s H9N2 viruses have been 2365

occasionally isolated from in humans and swine in China, leading to increasing 2366

concernsabouttheirpandemicpotential(Peirisetal.,1999,Linetal.,2000,Peiriset 2367

al., 2001, Yu et al., 2008, Butt et al., 2010, Wang et al., 2016, World Health 2368

Organization, 2016a). However, all reported human or swine H9N2 virus infections 2369

were dead-end events and the virus failed to spread within the human or swine 2370

population(SunandLiu,2015). 2371

A significant proportion of poultry H9N2 field isolates contains a leucine instead of 2372

glutamine residue at position 226 in the HA RBS (HA-Q226L, H3 numbering used 2373

throughout). This mutation has been shown to enhance HA binding to terminal 2374

Siaα2,6GalandtoimprovethereplicationofH9N2virusesinhumanairwayepithelial 2375

cells invitro,supportingconcernsabouttheirpandemicpotential(Matrosovichetal., 2376

2001, Wan and Perez, 2007, Wan et al., 2008). The binding of the viral HA to 2377

sialyloligosacharides, present on the host cell surface, is the first step for influenza 2378

virus infection. Because of the predominant expression of Siaα2,6Gal in human and 2379

swineupperrespiratorytract(VanPouckeetal.,2010,Nellietal.,2010),mosthuman 2380

and swine influenza virusesmorewillingly bind to receptors that contain Siaα2,6Gal 2381

(Matrosovichetal.,1997).Incontrast,avianinfluenzavirusespreferentiallybindsialic 2382

acids linked to galactose by an α2,3 linkage (Siaα2,3Gal). Therefore, a switch from 2383

Siaα2,3GaltoSiaα2,6Galreceptor-bindingpreferenceisconsideredanimportantstep 2384

for avian influenza virus adaptation to mammals (Matrosovich et al., 2015). 2385

Nevertheless, enhanced Siaα2,6Gal binding is not entirely sufficient to make H9N2 2386

viruses transmissible between mammals (Wan et al., 2008, Qiao et al., 2012, The 2387

SJCEIRSH9WorkingGroup, 2013). This suggests that other amino acid substitutions 2388

and/or an adequate constellation of internal genes is also required for efficient 2389

transmissionofH9N2virusesbetweenmammals. 2390

Due to the segmented nature of the influenza viruses, the RNA segments of 2 (or 2391

more)differentinfluenzavirusescan“reassort”whenco-infectingthesamehostcell, 2392

therebygeneratingprogenyviruseswithpropertiesdifferentfromtheparentalviruses 2393

(Taubenberger and Kash, 2010). In that sense, the sporadic isolation of avian H9N2 2394

Page 93: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

EffectofserialpassagesintheadaptationofareassortantH9N2containingpH1N1internalgenes

82

influenza viruses from pigs and humans in China increases the possibility of co- 2395

infectionswithendemic swineorhuman influenza viruses,which could result in the 2396

generationofnovelreassortantviruseswithenhancedtransmissibilityinmammals. 2397

The2009pandemicH1N1virus(pH1N1)isaswine-originreassortantviruscontaining 2398

human, swine and avian influenza virus genes (Smith et al., 2009). After its first 2399

appearancein2009,thevirushasspreadaroundtheworldinbothhumanandswine 2400

populations (Brookes et al., 2010). Moreover, novel reassortant viruses containing 2401

pH1N1 internal-protein genes and surface-protein genes from other endemic swine 2402

influenzavirushavebeenisolatedfrequentlyfrompigsworldwide(Nelsonetal.,2012, 2403

Liang et al., 2014, Simonet al., 2014,Vincent et al., 2014). In addition,H3N2 swine 2404

influenza viruses containing the pH1N1-derived matrix protein gene (H3N2v) were 2405

isolatedfrom364humancasesintheUSsince2011(CentersforDiseaseControland 2406

Prevention, 2016). This suggests that pH1N1 internal-protein genes are compatible 2407

with several surface-protein gene combinations and allow for robust replication in 2408

mammals. 2409

Intransmissionstudiesinferrets,areassortantH9N2viruscontainingpH1N1internal- 2410

protein geneswas readily transmitted to all contact animals by respiratory droplets 2411

(Kimble et al., 2011). Although similar reassortant viruses showed increased 2412

mammaliantransmissioncomparedtotheparentalH9N2,theirtransmissionwasstill 2413

notasefficientasswine-adaptedviruseslikepH1N1(Qiaoetal.,2012,Obadanetal., 2414

2015). We previously demonstrated that serial passages of A/quail/Hong 2415

Kong/G1/1997 (H9N2) virus in pigs mildly enhanced replication and transmission in 2416

swine(ManceraGraciaetal.,2017).Althoughtheresultingpig-adaptedviruscarrieda 2417

number of mutations compared to the parental virus, transmission was still less 2418

efficientthanthatofnaturallycirculatingviruses(ManceraGraciaetal.,2017).Inthe 2419

present study,wehaveexamined the replicationand transmissibility after ten serial 2420

pig passages of a reassortant virus containing A/quail/Hong Kong/G1/1997 (H9N2) 2421

surface-proteingenesandNPwithintheA/California/04/2009(pH1N1)backgroundto 2422

evaluateifthepH1N1internalgenesconfersanadvantageinH9N2adaptationtopigs. 2423

ThisserialpassagingoftheH9N2:pH1N1reassortantresultedinavirusthatreplicated 2424

in and transmitted between pigs at high rates. The predominant mutation in the 2425

passaged reassortant viruswas an aspartic acid to glycine at position 225 in theHA 2426

Page 94: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter4

83

RBS. Therefore, our results showed that the combination of reassortment and 2427

mutations induced by the serial passages generated a virus with a predominant 2428

mutation at position 225 inHARBS that replicated and transmitted at high rates in 2429

pigs. 2430

2431

4.2 Materialsandmethods 2432

Viruses 2433

The reassortant virus containing A/California/04/2009 (pH1N1) internal genes and 2434

A/quail/HongKong/G1/1997(H9N2)HAandNAwasproducedbyreversegeneticsat 2435

theDepartmentofDiagnostic/PathobiologyatKansasStateUniversity.Theviruswas 2436

plaque purified, passaged 3 times in MDCK cells, characterized and experimentally 2437

validated(Qiaoetal.,2012).AnotherpassageinMDCKcellswasmadeatthearrivalof 2438

thevirustotheLaboratoryofVirologyatGhentUniversitytogenerateastocktobe 2439

usedinthisstudy. 2440

A/California/04/2009(pH1N1)waskindlyprovidedbytheCentersforDiseaseControl 2441

andPrevention(USCDC).Thevirusunderwent3passagesinMDCKcellsattheUSCDC. 2442

Later 1 passage in eggs and 1 in MDCK cells were performed in the Laboratory of 2443

VirologyatGhentUniversitybeforeuse. 2444

Pigpassagesandtransmissionstudies 2445

Forty-seven3-week-oldpigletswerepurchasedfromacommercialherdfreeofswine 2446

influenzaandporcinereproductiveandrespiratorysyndromevirus.Uponarrival,pigs 2447

were confirmed seronegative to influenza virus with a commercial blocking anti- 2448

influenza A nucleocapsid ELISA (ID-VET) and by virus neutralization (VN) tests. 2449

Consecutivepassagesstartedwiththehousingof2pigs inabiosafety level-3(BSL-3) 2450

HEPAfilteredisolator,andtheirintranasalinoculationwith3mlofphosphate-buffered 2451

saline (PBS) containing 106.5 TCID50 of virus. Pigs were clinicallymonitored daily for 2452

general (depression, anorexia) and respiratory (coughing, dyspnoea, abdominal 2453

thumping,tachypnoea)symptoms.Nasalswabswerealsocollecteddaily from0to4 2454

dpi.At4dpibothpigswereeuthanizedwithalethaldoseofpentobarbitalsodium(³ 2455

100mg/kg) in the jugularvein.The following tissuesampleswerecollected forvirus 2456

Page 95: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

EffectofserialpassagesintheadaptationofareassortantH9N2containingpH1N1internalgenes

84

titrations:nasalmucosarespiratorypart(i.e.nasalturbinates),nasalmucosaolfactory 2457

part(i.e.ethmoidlabyrinth),trachea(distalandproximalhalf)and5differentsamples 2458

representativeof the entire lung. Thenasalmucosae (respiratory part)werepooled 2459

anda20%(w/v) tissuehomogenatewaspreparedandusedto inoculate2pigswith 2460

thispassage1virus inoculum.Tenblind(meaningthattheviral load inthe inoculum 2461

was not known prior to the infection) serial passages were performed in this way. 2462

Nasal swabs from all pigs, tissue samples and the inocula used for the subsequent 2463

passagesweretitratedonMDCKcells. 2464

Foreachtransmissionexperimentnine3-week-oldpigswereused.At0dpi3pigswere 2465

housed in 3 separate BSL-3 HEPA filtered isolators (1 index pig per isolator) and 2466

intranasally inoculatedwith106.5TCID50of therespectivevirus.Twodpi,2pigswere 2467

introducedineachisolatorallowingdirectcontactwiththeinoculatedpig.Allanimals 2468

wereclinicallymonitoredandnasalswabsforvirusisolationwerecollecteddailyfrom 2469

allpigsduringelevendaysaftercohousing.Sixteendpi,theanimalswererelocatedto 2470

aBSL-2HEPAfilteredisolationunit.Serumsampleswerecollectedat0,16,23and30 2471

dpiand0,14,21and28dayspost-contact. 2472

Ethicalstatement 2473

AllexperimentalprocedureswereconductedinaccordancewithE.U.AnimalWelfare 2474

Directives, and authorized and supervised by the Local Ethical and Animal Welfare 2475

Committee of the Faculty of Veterinary Medicine of Ghent University (EC2013/63 2476

number). 2477

Virustitrations 2478

Nasalswabsfrombothnostrilsweresuspended in1mlPBSsupplementedwith10% 2479

foetal bovine serum, 100 IU/ml penicillin and 100 μg/ml streptomycin andmixed 2480

vigorouslyat4°Cfor1hour.TissuesampleswereweighedandgroundedinPBSwith 2481

10 IU/ml penicillin and 10 µg/ml streptomycin to obtain 20% (w/v) tissue 2482

homogenates. Briefly, confluent monolayers of cells were inoculated with 10-fold 2483

serial dilutionsof the sample.After 5 days of incubation at 37oCwith 5%CO2, virus 2484

positive MDCK cells were visualized by immunoperoxidase staining. The cells were 2485

fixed with 4% paraformaldehyde for 10 minutes at room temperature and 2486

subsequentlyincubatedwithmouseanti-NPmonoclonalHB-65antibody(1:50,ATCC) 2487

Page 96: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter4

85

for 2 hours. Incubation with horseradish peroxidase-conjugated goat anti-mouse 2488

polyclonalantibody(1:200,Dako)for1hourwasfollowedbyadevelopmentstepwith 2489

H2O2 as substrate and 3-amino-9-ethyl-carbazole (AEC) as precipitating agent. Virus 2490

titerswere calculatedby themethodof Reed andMuench (1938) andexpressed as 2491

log1050%tissuecultureinfectivedoses(TCID50)per100milligram(nasalswabs)orper 2492

gram(tissues). 2493

Virusneutralizationassays 2494

VNtestswereperformedonMDCKcellsin96-wellplates,using100TCID50ofvirusper 2495

well as previously described (Van Reeth et al., 2003). Briefly, 2-fold serum dilutions 2496

were incubated (1h, 37oC) with 100 TCID50 of MDCK cell-grown virus. MDCK cells 2497

suspension(800.000cellsperml)wasincubatedwiththevirus-serummixturefor24h, 2498

after which the virus positive cells were visualized by immunoperoxidase staining. 2499

Antibody titers were expressed as the reciprocal of the highest serum dilution that 2500

completelyinhibitedvirusreplicationinMDCKcells. 2501

Dataanalysis 2502

Nasalvirussheddingof individualpigswasquantifiedbycalculationof theAUC.The 2503

means of the AUCs of different viruses were compared using standard two–sample 2504

Mann-Whitney U tests. Differences were considered significant when p<0.05. 2505

GraphPadPrismSoftware,version5,wasusedforstatisticalanalyses. 2506

RT-PCR 2507

The RNA from the virus samples was isolated using the QIAamp Viral RNAMini Kit 2508

(Qiagen, Valencia, CA). cDNA was synthesized with the Transcriptor First Strand 2509

Synthesiskit (Roche),alreadydescribed(VandenHoeckeetal.,2015).Twoseparate 2510

reactions were performed, using primers specific for the influenza A vRNAs: 2511

CommonUni12G (GCCGGAGCTCTGCAGATATCAGCGAAAGCAGG) and CommonUni12A 2512

(GCCGGAGCTCTGCAGATATCAGCAAAAGCAGG).Subsequently,all8genomic segments 2513

were amplified in 1 PCR reaction containing an 1:1 mix of CommonUni12G and 2514

CommonUni12A cDNA, primer CommonUni13 2515

(GCCGGAGCTCTGCAGATATCAGTAGAAACAAGG) (200 nM) and the Phusion High 2516

Fidelity polymerase (Thermo Scientific) (VandenHoecke et al., 2015,Watson et al., 2517

Page 97: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

EffectofserialpassagesintheadaptationofareassortantH9N2containingpH1N1internalgenes

86

2013,Zhouetal.,2009).RT-PCRwasperformedasdescribed(VandenHoeckeetal., 2518

2015),with the first 5PCR cyclesperformedwithanannealing temperatureof45°C 2519

(instead of 72°C). PCR products were purified using the High Pure PCR Product 2520

PurificationKit(Roche)andelutionoftheDNAinsterileultrapurewater. 2521

IlluminaMiSeqlibrarypreparationandsequencing 2522

500 ng of each purified RT-PCR sample was sheared with an M220 focused- 2523

ultrasonicator (Covaris) set to obtain peak fragment lengths of 400 bp. Next the 2524

NEBNextUltraDNALibraryPreparationkit (NewEnglandBiolabs)wasusedtorepair 2525

the end and to add the Illumina MiSeq-compatible barcode adapters to 100 ng 2526

fragmentedDNA.The resulting fragmentswere size-selectedat300 to400bpusing 2527

AgencourtAMPureXPbeadsizing(BeckmanCoulter).Then, indexeswereaddedina 2528

limited-cyclePCR(10cycles),followedbypurificationonAgencourtAMPureXPbeads. 2529

The fragments were analysed on a High Sensitivity DNA Chip on the Bioanalyzer 2530

(Agilent Technologies) before loading on the sequencing chip. After the 2×250 bp 2531

MiSeqpaired-endsequencingrun,thedatawerebase-calledandconvertedtoIllumina 2532

FASTQfiles(Phred+64encoding). 2533

NextGenerationSequencingdataanalysis 2534

Sequencedataanalyseswereperformedontheresulting IlluminaFASTQfiles (Phred 2535

64+encoding)usingCLCGenomicsWorkbench (Version7.0.3) following theanalysis 2536

pipelineasdescribed(VandenHoeckeetal.,2015).Theprocessedsequencingreads 2537

were subsequently mapped to the de novo assembled consensus sequence of the 2538

H9N2:pH1N1(p7)stockvirussequence.Thisconsensussequenceisavailablethrough 2539

GenBank accession number (KY785904-KY785911). The processed sequencing reads 2540

fortheH9N2:pH1N1(P7)stockvirusweremappedtoareferencegenomecomposed 2541

of the H9N2:pH1N1 (P7) stock virus sequence and the A/quail/Hong 2542

Kong/G1/1997(H9N2)virusgenome. Therawsequencingdataweresubmittedtothe 2543

NCBI Sequence Read Archive where they can be found under project number: 2544

SRP095510. 2545

2546

2547

Page 98: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter4

87

4.3 Results 2548

SerialpassagesofareassortantH9N2virusresultedinincreasedvirusreplication 2549

Toevaluate if serialpig infectionsmade reassortantH9N2virusesbetter adapted to 2550

swine, 10 blind serial passages were performed in influenza naïve pigs. For each 2551

passage 2 co-housed animals were intranasally inoculated with 106,5 TCID50 of 2552

H9N2:pH1N1 (P0). Todeterminenasal virus excretion, individual pigswere swabbed 2553

dailyfrom0to4dayspost-inoculation(dpi).Noneofthepigsshowedclinicalsignsof 2554

disease.ThereassortantH9N2viruswasdetectedinnasalswabsofallexperimentally 2555

infected pigs. The highest amount of virus was excreted during passages 3 and 8 2556

(Figure1).At4daysafterinfection,pigswereeuthanizedandsamplesfromtheentire 2557

respiratory tract were collected to determine the viral load. Infectious virus was 2558

recoveredfromtherespiratorytractofallpigsduringall10serialpassages(Table1). 2559

Replicationrateswerehigherintheupperrespiratorytract(nasalmucosa:respiratory 2560

and olfactory parts) with all 40 out of 40 (100%) samples testing positive, when 2561

comparedtothelowerrespiratorytract(tracheaandlungs)with81outof140(58%) 2562

samplestestingpositive.Inthefirstpassage,noviruscouldbeisolatedfromthelower 2563

respiratorytract.Incontrast,duringpassages2,3and8,theviruswasdetectedin17 2564

outof18(93%)samples,indicatingreplicationintheentirerespiratorytract(Table1). 2565

Page 99: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

EffectofserialpassagesintheadaptationofareassortantH9N2containingpH1N1internalgenes

88

2566

Figure 1.Nasal virus shedding of the reassortantH9N2 virus containing pH1N1 internal- 2567proteingenes (H9N2:pH1N1)during10blindserialpigpassages.Twopigs (solid lineand 2568dashed line)wereused for ineachpassage,each line represents thevirus titers innasal 2569swabsofanindividualpig.Thedetectionlimitofthetestisindicatedwithadottedlineat 25701.7log10TCID50/100mgofsecretion. 2571

Days post-inoculation

Vir

us ti

ter

log 1

0 TC

ID50

/100

mg

of n

asal

sec

retio

n Passage 1

0 1 2 3 40

2

4

6

8

Passage 2

0 1 2 3 40

2

4

6

8

Passage 3

0 1 2 3 40

2

4

6

8

Passage 4

0 1 2 3 40

2

4

6

8

Passage 5

0 1 2 3 40

2

4

6

8

Passage 6

0 1 2 3 40

2

4

6

8

Passage 7

0 1 2 3 40

2

4

6

8

Passage 8

0 1 2 3 40

2

4

6

8

Passage 9

0 1 2 3 40

2

4

6

8

Passage 10

0 1 2 3 40

2

4

6

8

Page 100: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

2572Table 1. Distribution of reassortant H9N2 virus containing pH1N1 internal-protein genes in the respiratory tract during 10 serial 2573passagesinpigs. 2574

2575

Numberofpassage Pignumber

Virustiter(log10TCID50/gramoftissue)atday4post-inoculationaNasalmucosarespiratorypart

Nasalmucosaolfactorypart Proximaltrachea Distaltrachea Apical+cardiac

loberightApical+cardiac

lobeleftDiaphragmatic

loberightDiaphragmatic

lobeleftAccessory

lobe

1#1 5.3 5.5 <

b < < < < < <

#2 4.5 5 < < < < < < <

2#3 5.7 5.7 2 4.2 < 3.3 2 3.5 2.3#4 7 5.7 4.3 4 4.3 2.5 2.5 3.8 2.5

3#5 5.7 5.5 5.7 4.7 2.3 3.7 2.3 3 1.7#6 5.7 7.3 2.7 2 2.3 4.5 1.7 2.5 <

4#7 5.5 6.3 2.3 3.8 1.7 < 3.7 < 1.7#8 6.3 5.5 5 4.7 5.7 4 4.5 4.5 2.7

5#9 6 1.7 1.7 < < < < < <#10 4.7 2.5 4.2 2.7 6 2,8 3.2 < 5.5

6#11 5.5 3.5 1.7 < < < < < <#12 6.3 4 < < < < < < <

7#13 5.7 5.5 3.3 2.5 < 1.7 2.8 < <#14 5.5 4.3 1.7 < < < < < <

8#15 6.3 7 4.3 5.5 5.3 5.5 5.5 5.5 4.5#16 6.7 6.3 2.5 2.8 < 3.2 4,8 3,3 4,3

9 #17 6.5 6.7 1.7 < < < 1.7 < <#18 6 5.5 2.5 3.5 < 5.5 4.3 3.5 2,7

10#19 7 5.3 1.7 < 2 < 3.5 2.5 <#20 6.8 3.7 1.7 5 5.5 2.2 < 4.7 <

aVirustitersareshownforeachindividualpig(#). 2576b<detectionlimit(1,7log10TCID50/gramoftissue 2577

2578

Page 101: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

EffectofserialpassagesintheadaptationofareassortantH9N2containingpH1N1internalgenes

90

After7serialpassagesinpigs,thereassortantH9N2:pH1N1virusshowedenhanced 2579

contacttransmission 2580

To compare the level of adaptation of the reassortant virus before and after serial 2581

passages in pigs, we performed direct-contact transmission experiments with the 2582

H9N2:pH1N1 (P0) virus and its descendant isolated after 7 passages in pigs 2583

(H9N2:pH1N1(P7)).Thelatterviruswaschosenbecausevirustitersinnasalswabsand 2584

the respiratory tract samples were highest at this passage, suggesting a substantial 2585

degree of swine-adaptation. As a positive control, we used a representative swine- 2586

adapted virus, the A/California/04/2009 (pH1N1) virus (A/Cal/04/09). All 3 viruses 2587

wereamplifiedinMDCKcellsbeforepiginoculation,andthetransmissionexperiment 2588

wasperformedintriplicateforeachvirus.Figure2illustratesthenasalvirusshedding 2589

of the inoculated and the co-housed direct-contact animals. All animals remained 2590

clinically healthy, based on clinical observation. All inoculated pigs excreted virus 2591

between days 1 and 7 post-inoculation. A comparison of the averages of the areas 2592

under the curve (AUC) revealeda lower virusexcretion forH9N2:pH1N1 (P0) (mean 2593

AUC19.4)andH9N2:pH1N1(P7)(24.0)thanforA/Cal/04/09(26.6),eventhoughthese 2594

differenceswerenotstatisticallysignificant(p>0.05).All3virusesreachedamaximum 2595

virus titer ≥ 6.5 log10 TCID50/100 mg of secrete. All inoculated animals developed 2596

neutralizingantibodiesagainst thehomologousvirusand thesewerehighest for the 2597

A/Cal/04/09infectedpigs(Table2). 2598

Page 102: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter4

91

2599

2600

2601

Figure 2. Nasal virus shedding and direct-contact transmission of H9N2:pH1N1 (P0), 2602H9N2:pH1N1(P7) and A/Cal/04/09 influenza viruses in pigs. Three pigs were 2603intranasally inoculated with 6,5 log10 TCID50 of the indicated virus and housed in 3 2604separate isolators. Forty-eight hours later, 2 direct contact animals were co-housed 2605witheachinoculatedpigs.Eachgraphisidentifiedwitha2digitsnumber:thefirstone 2606corresponds to the isolator number and the second to the virus tested. Therefore, 2607eachcolumnrepresentsadifferentvirusandeachrowrepresentsadifferentisolator. 2608Thedetectionlimit(dottedline)ofthetestwas1.7log10TCID50/100mgofsecretion. 2609 2610

A/Cal/04/09 isolator 1.3

-2 -1 0 1 2 3 4 5 6 7 8 9 10 110

2

4

6

8

isolator 2.3

-2 -1 0 1 2 3 4 5 6 7 8 9 10 110

2

4

6

8

isolator 3.3

-2 -1 0 1 2 3 4 5 6 7 8 9 10 110

2

4

6

8

-2 -1 0 1 2 3 4 5 6 7 8 9 10 110

2

4

6

8H9N2:pH1N1 (P7)

isolator 1.2

-2 -1 0 1 2 3 4 5 6 7 8 9 10 110

2

4

6

8 isolator 2.2

-2 -1 0 1 2 3 4 5 6 7 8 9 10 110

2

4

6

8 isolator 3.2

-2 -1 0 1 2 3 4 5 6 7 8 9 10 110

2

4

6

8

H9N2:pH1N1 (P0) isolator 1.1

-2 -1 0 1 2 3 4 5 6 7 8 9 10 110

2

4

6

8 isolator 2.1

-2 -1 0 1 2 3 4 5 6 7 8 9 10 110

2

4

6

8 isolator 3.1

A/Qa/HK/P0 isolator 1.1

-2 -1 0 1 2 3 4 5 6 7 8 9 10 110

2

4

6

8

isolator 2.1

-2 -1 0 1 2 3 4 5 6 7 8 9 10 110

2

4

6

8

isolator 3.1

-2 -1 0 1 2 3 4 5 6 7 8 9 10 110

2

4

6

8

A/Cal/04/09 isolator 1.3

-2 -1 0 1 2 3 4 5 6 7 8 9 10 110

2

4

6

8

isolator 2.3

-2 -1 0 1 2 3 4 5 6 7 8 9 10 110

2

4

6

8

isolator 3.3

-2 -1 0 1 2 3 4 5 6 7 8 9 10 110

2

4

6

8

A/Qa/HK/P4 isolator 1.2

-2 -1 0 1 2 3 4 5 6 7 8 9 10 110

2

4

6

8

isolator 2.2

-2 -1 0 1 2 3 4 5 6 7 8 9 10 110

2

4

6

8

isolator 3.2

-2 -1 0 1 2 3 4 5 6 7 8 9 10 110

2

4

6

8

Days post-contact inoculated pigs direct contact pigs detection limit!

Viru

s tite

r log

10 T

CID 50

/100

mg o

f sec

rete!

A/Qa/HK/P0 isolator 1.1

-2 -1 0 1 2 3 4 5 6 7 8 9 10 110

2

4

6

8

isolator 2.1

-2 -1 0 1 2 3 4 5 6 7 8 9 10 110

2

4

6

8

isolator 3.1

-2 -1 0 1 2 3 4 5 6 7 8 9 10 110

2

4

6

8

A/Cal/04/09 isolator 1.3

-2 -1 0 1 2 3 4 5 6 7 8 9 10 110

2

4

6

8

isolator 2.3

-2 -1 0 1 2 3 4 5 6 7 8 9 10 110

2

4

6

8

isolator 3.3

-2 -1 0 1 2 3 4 5 6 7 8 9 10 110

2

4

6

8

A/Qa/HK/P4 isolator 1.2

-2 -1 0 1 2 3 4 5 6 7 8 9 10 110

2

4

6

8

isolator 2.2

-2 -1 0 1 2 3 4 5 6 7 8 9 10 110

2

4

6

8

isolator 3.2

-2 -1 0 1 2 3 4 5 6 7 8 9 10 110

2

4

6

8

Days post-contact inoculated pigs direct contact pigs detection limit!

Viru

s tite

r log

10 T

CID 50

/100

mg o

f sec

rete!

Vir

us ti

ter

log 1

0 TC

ID50

/100

mg

of n

asal

secr

etio

n

Page 103: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

EffectofserialpassagesintheadaptationofareassortantH9N2containingpH1N1internalgenes

92

Table 2. Serum VN antibody titers in inoculated and direct contact pigs involved in 2611transmissionexperiments. 2612

2613 Numberofantibodypositivepigs(rangeofantibodytiters) Inoculatedpigs(n=3) Directcontactpigs(n=6)

Virusstrain 0 16 23 29dpia 0 14 21 28dpcb

H9N2:pH1N1(P0) 0(<2) 3(16-128) 3(32-256) 3(32-192) 0(<2) 3(24-192) 6(12-192) 6(48-256)

H9N2:pH1N1(P7) 0(<2) 3(48-96) 3(64-256) 3(48-128) 0(<2) 5(2-256) 4(96-256) 4(64-192)

A/Cal/04/09 0(<2) 3(128-192) 3(192-384) 3(512-768) 0(<2) 6(192-1024) 6(256-1536) 6(192-1024)adpi:dayspost-inoculation.bdpc:dayspost-contact.

2614

Asexpected,all6A/Cal/04/09direct-contactpigsexcretedhighamountsofvirus(AUC 2615

>17)andseroconvertedwithVNtiters≥192.Whileall6direct-contactanimalsinthe 2616

H9N2:pH1N1(P0)groupalsoseroconvertedandexcretedvirus,only2shedviruswith 2617

anAUC>6.IntheH9N2:pH1N1(P7)group,incontrast,just4outof6direct-contact 2618

animalsexcretedvirusbutallofthemshowedanAUC>21,similartotheA/Cal/04/09 2619

group.Theremaining2H9N2:pH1N1(P7)direct-contactpigsdidnotexcreteanyvirus 2620

and failed to seroconvert. VN titers in the 6 H9N2:pH1N1 (P0) and 4 out of 6 2621

H9N2:pH1N1(P7)direct-contactpigswere<256. 2622

Mutationsassociatedwithenhancedtransmission 2623

WenextcomparedthevariantspresentintheH9N2:pH1N1(P0)viruspopulationand 2624

theH9N2:pH1N1(P7)virusisolatedfromthenasalmucosaofadirectlyinoculatedpig 2625

andthedirect-contactpigwiththehighestnasalexcretion inthetransmissionstudy. 2626

Bycomparingtheviruspopulationfromthedirectly-inoculatedandthedirect-contact 2627

pigsweaimedtodetermineifthemutationsselectedduringtheserialpassagingwere 2628

maintainedaftertransmissionorifthetransmissionitselffavouredtheacquirementof 2629

adifferentsetofmutations.Inaddition,theH9N2:pH1N1(P0)virusstockwasincluded 2630

to determine whether the detected variants in the passage 7 virus were already 2631

presentinthevirusstockbeforepigadaptation.IlluminaMiSeqdeepsequencingwas 2632

performed on full genome RT-PCR products of the samples. Sequencing of 2633

H9N2:pH1N1 (P0) virus revealed contamination of theH9N2:pH1N1 virus stockwith 2634

H9N2 internal-protein genes,whichweremost pronounced for the PB1,NS andNP 2635

gene segments (see Table 3). Interestingly, passage of the reassortant H9N2:pH1N1 2636

virus stock in pigs resulted in the selection of a virus that had lost these internal- 2637

Page 104: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter4

93

protein coding H9N2 gene segments, except for the NP segment which was still of 2638

H9N2-origin after 7 pig passages. Sequence analysis of the H9N2:pH1N1 (P7) virus 2639

after contact transmission showed that the geneticmakeup of this viruswas nearly 2640

identicaltotheH9N2:pH1N1(P7)stockvirus.TheselectionforaH9N2viruswiththe 2641

pH1N1-origin internal protein-coding gene segments suggests a strong genetic 2642

bottleneckthatleadstoeliminationofreassortantviruseswithH9N2internalprotein- 2643

codinggenesegmentsuponviralpassaginginpigs.Thenonsynonymousvariantsthat 2644

were detected at a frequency ≥ 5% in the H9N2:pH1N1 (P7) stock virus and the 2645

H9N2:pH1N1 (P7) virus isolated from the direct-contact pig after mapping the 2646

sequencing reads to thedenovo assembledconsensus sequenceof theH9N2:pH1N1 2647

(P7) stock virusare shown in Table 4. As a consequence of the contamination, the 2648

sequencing reads of the H9N2:pH1N1 (P0) stock virus weremapped to a reference 2649

genomecomposedofthedenovoassembledconsensussequenceoftheH9N2:pH1N1 2650

(P7) stock virus and the reference sequence for the A/quail/Hong 2651

Kong/G1/1997(H9N2) virus. The nonsynonymous variants detected at a frequency ≥ 2652

0.5%intheH9N2:pH1N1(P7)genomeareshowninSupplementaryTableS1. 2653

2654

Page 105: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

EffectofserialpassagesintheadaptationofareassortantH9N2containingpH1N1internalgenes

94

Table3.MappingofthereadsofthevirusstockofH9N2:pH1N1(P0),H9N2:pH1N1 2655(P7)andH9N2:pH1N1(P7)isolatedafterdirect-contacttransmissiontothereference 2656genome sample obtained from A/quail/Hong Kong/G1/1997 (H9N2) and 2657A/California/04/2009 (pH1N1). The viral gene segment is indicated along with the 2658frequency(percentage)ofsequencereadsoriginatingfromeitheroneoftheparental 2659strains. 2660

2661

Virusstock SegmentPercentageofgenesfrom…virus

A/quail/HongKong/G1/1997(H9N2)

A/California/04/2009(pH1N1)

H9N2:pH1N1(P0)

PB2 6 94PB1 19 81PA 11 89HA 100 0NP 91 9NA 100 0M 26 74NS 91 9

H9N2:pH1N1(P7)

PB2 0 100PB1 0 100PA 0 100HA 100 0NP 100 0NA 100 0M 0 100NS 0 100

H9N2:pH1N1(P7)

direct-contact

PB2 0 100PB1 2 98PA 0 100HA 100 0NP 100 0NA 100 0M 0 100NS 0 100

2662 2663

Page 106: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter4

95

Table4.Variantspresentinthepassage7reassortant(H9N2:pH1N1(P7))virusisolated 2664from the nasal mucosa and from the nasal swab of the direct-contact pig with the 2665highest excretion. The viral gene segment is indicated, along with the nucleotide 2666positionandsubstitutions, thepredictedaminoacidchangeand itspositionand the 2667frequency (percentage) of sequence reads with the detected mutations. Only 2668nonsynonymoussubstitutionswithafrequency≥5%inthereadsareshown.Thevirus 2669inthenasalmucosasamplewasamplifiedonMDCKcellsbeforesequencing. 2670 2671

Segment Nucleotideposition Reference Mutation Aminoacid

change

FrequencyH9N2/pH1N1(P7)(nasalmucosa)

FrequencyH9N2/pH1N1(P7)

(nasalswab)

PA1260 T A Trp406Arg - 5.091990 TA - Leu649- - 5.56

PB2220 C G Thr58Ala - 18.551651 C T Thr535Met 46.74 -1891 T C Ile615Thr 8.09 -

HA 407 C T Leu119Phe 27.52 -750 A G Asp225Gly 47.43 99.70

NS 582 G A NS1:Gly179GlnNS2:Gly22Arg 30.45 -

862 C T NS2:Ala115Val - 25.83 2672

TheH9N2:pH1N1(P7)stockvirusshowedvariationabove5%atpositions535and615 2673

ofthebasicpolymerase2protein(PB2),position119oftheHAandposition179ofthe 2674

non-structural 1 protein (NS1) (Table 4). Nonetheless, those variants were not 2675

maintained after transmission to the contact pig. Interestingly, only 1 mutation 2676

associated with an amino acid substitution was selected after 7 passages and 2677

maintained after transmission, i.e. the substitution of aspartic acid by glycine at 2678

position 225 of the HA RBS (HA-D225G). This mutation was absent (Supplementary 2679

TableS1)intheH9N2:pH1N1(P0)virusstockandpresentin47.4%and99.7%ofthe 2680

sequences derived from the viral population isolated after 7 passages and the 2681

transmitted virus, respectively. Two other mutations appeared de novo after 2682

transmissionatafrequency>15%:asubstitutionofalaninetovalineatposition115of 2683

theNS1andasubstitutionofthreoninetoalanineatposition58ofthePB2. 2684

2685

4.4 Discussion 2686

Sincethelate1990s,avianH9N2viruseshavebeenisolatedfrompigsandhumans,so 2687

far always as dead end events (Butt et al., 2010, Wang et al., 2016, World Health 2688

Organization,2016b).However,thecontinuousexposureofhumansandpigstoavian 2689

Page 107: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

EffectofserialpassagesintheadaptationofareassortantH9N2containingpH1N1internalgenes

96

H9N2virusesmightposearealthreatforpublichealthiftheseviruseswouldacquire 2690

thegeneticchangesthatallowthemtotransmitefficientlybetweenmammals.Inthis 2691

study, we evaluated the efficiency of direct-contact transmission between pigs of a 2692

reassortant H9N2 virus containing pH1N1 internal-protein genes, and the effect of 2693

serial pig passages on transmission efficiency.We demonstrated, for the first time, 2694

thatapig-passagedreassortantH9N2:pH1N1viruswasexcretedbymorethanhalfof 2695

thedirect-contactpigsattiterssimilartothoseoftheparentalpH1N1virus. 2696

Ourdataconfirmtheabilityof theH9N2:pH1N1reassortantviruses to infectpigsas 2697

was reported in previous studies (Qiao et al., 2012, The SJCEIRSH9WorkingGroup, 2698

2013,Obadanetal.,2015).Infact,virusexcretionfromthenasalcavityandreplication 2699

intherespiratorytractwerepresentatvariableratesduringthe10serialpigpassages. 2700

This findingcontrastswithapreviousstudy fromourgroupusing thesameparental 2701

H9N2virus(A/quail/HongKong/G1/1997),howeverwithoutreassortmentwithpH1N1 2702

internal-proteingenes(ManceraGraciaetal.,2017).Inthelatterstudy,replicationand 2703

sheddingoftheparentalH9N2viruswasslightlyenhancedafter4pigpassagesbutit 2704

wascompletelylostafter10passagesinpigs.Thisdemonstratesthatthepresenceof 2705

thewellpig-adaptedpH1N1-origin internal-proteingenesmayposeanadvantagefor 2706

theadaptationofH9N2virustopigs.WhiletheH9N2:pH1N1(P0)virusdidnotshow 2707

replication in the lungs during passage 1, it replicated homogeneously in the entire 2708

respiratory tract during passage 2. Strikingly, the virus replication in the lungs then 2709

progressivelydecreasedduringpassages4,5and6toincreaseagainatpassage7.This 2710

suggeststhepresenceofaselectionbottleneckduetothegeneticpressuregenerated 2711

bytheexperimentalsetup(Wilkeretal.,2013).However,adeeperanalysisoftheviral 2712

populationwould be needed to elucidate the possible cause of the decrease in the 2713

replicationrates. 2714

We consider an influenza virus as swine-adapted when it succeeds to transmit 2715

between pigswith a similar efficiency as described for the endemic swine influenza 2716

viruses.Therefore,wecomparedpig-to-pigtransmissionoftheseventhpassagevirus 2717

with that of the original reassortant and pH1N1 viruses.Whereas both reassortant 2718

virusestransmittedtodirect-contactpigs,theseventhpassageviruswasclearlyshed 2719

at higher titers by 4 out of 6 direct-contact pigs. This virus also showed higher 2720

Page 108: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter4

97

transmissionefficiencywhencomparedwithpreviousstudiesdescribingH9N2:pH1N1 2721

reassortant viruses in pigs (Qiao et al., 2012, Obadan et al., 2015). In the 2722

aforementioned studies ≤ 50% of the direct-contact pigs excreted virus. This higher 2723

transmission rate suggests that the serial passaging in pigs contributed to the 2724

adaptation of the reassortantH9N2 virus. Yet of the 6 direct-contact pigs 2 animals 2725

thatwerehoused in thesame isolatordidnotexcretevirusatall.This ismost likely 2726

duetothelowamountofvirusexcretedbythedirect-inoculatedpig(AUC17.1),which 2727

not have reached a critical threshold to allow virus transmission. Further detailed 2728

genetic analyses of the virus excreted by the donor pigwould be needed to better 2729

understand if there is, besides the low titer, also a genetic basis for the lack of 2730

transmission. 2731

Toelucidatetheeffectsoftheserialpassagingandthepig-to-pigtransmissiononthe 2732

viruspopulation,wecomparedtheviraldiversityintheoriginalreassortantviruswith 2733

thevirus isolatedafter7passages inpigsand thevirusexcretedafterdirect-contact 2734

transmission. It should be mentioned here that we detected H9N2 internal-gene 2735

segments in our original reassortant virus stock. Interestingly, the serial passaging 2736

resulted in the purification of the original virus and, after 7 passages only the NP- 2737

codinggenewascompletelyofH9N2-origin.As intheoriginalstocktheH9N2-derive 2738

NP gene segment was present at 91%, this high percentage might have been the 2739

reason for the purification towards the H9N2-origin instead of towards the pH1N1- 2740

originasseenfortheothergenesegments.However,theNS-codinggeneshowedthe 2741

same percentage of contamination and was completely selected upon passaging. 2742

Althoughprevious studies demonstrated that pH1N1-origin internal genes conferred 2743

anadvantageinreplicationandtransmissionofinfluenzavirusesinmammals(Mehle 2744

and Doudna, 2009, Lakdawala et al., 2011, Kimble et al., 2011, Zhang et al., 2012, 2745

Campbelletal.,2014,Abenteetal.,2016),thosestudiesfocusedeitherontheroleof 2746

thePB2andtheM-codinggenesoronthecompleteinternalgenecassette.Notmuch 2747

is knownabout theexact roleofpH1N1-originNP-proteingene in theadaptationof 2748

influenza viruses to mammals. However, it has been described that the interaction 2749

between the NP and importin-α can influence the influenza virus host range. For 2750

example, thepresenceof theNP-N319K substitutionwasdescribed as an important 2751

factorforthereplicationofH7N7viruses inmice(Gabrieletal.,2008).Nevertheless, 2752

Page 109: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

EffectofserialpassagesintheadaptationofareassortantH9N2containingpH1N1internalgenes

98

both the H9N2 and the pH1N1 NP-protein genes lack that mutation. Thus, further 2753

analysiswithreversegeneticgeneratedreassortantswouldbenecessarytoelucidateif 2754

thecombinationofH9N2-originNP-proteingeneandpH1N1-origininternalgeneshas 2755

an effect in the replication and transmission of influenza viruses in mammals. 2756

Regarding themutations detected during the analysis, only 1 of themutations that 2757

appeared in the virus after 7 passages andwasmaintained even after transmission, 2758

theHA-D225Gsubstitution in theRBS.Thismutationwas therefore likelyassociated 2759

withthehigherreplicationandtransmissionefficiencyoftheH9N2:pH1N1(P7)virus. 2760

Interestingly, this mutation was present in all 42 swine and 17 human H9N2 field 2761

isolates available in GenBank in November 2016. Thismutationwas also associated 2762

withenhancedreplicationandtransmissionofparentalH9N2after4passagesinpigs 2763

(Mancera Gracia et al., 2017). In the 1918 and 2009 pandemic H1N1 viruses this 2764

mutationhasbeenassociatedwith increasedSiaα2,3Gal tropism(Belseretal.,2011, 2765

Lakdawalaetal.,2015).InpigsandhumansSiaα2,3Galreceptorsaremainlyfoundin 2766

the lungs (VanPouckeetal.,2010).Thepresenceof theHA-D225Gmutationafter7 2767

passagesmaythereforeexplaintheconsistentreplicationinthelungsduringpassage 2768

8.Althoughspecificreceptor-bindingtestswouldbenecessarytoelucidatetheexact 2769

roleoftheHA-D225GmutationwithintheHA-RBS,ourdatasuggestthatitmaybea 2770

markerforadaptationofH9N2virusestoswine. 2771

In line with previous studies (Qiao et al., 2012, Obadan et al., 2015), this report 2772

demonstrated that avianH9N2 influenza viruses could reassortwith pH1N1 internal 2773

genes, resulting in enhanced virus transmission in pigs when compared to the 2774

parental, non-reassorted H9N2 virus. The present study also underscores that 2775

repeated introduction of reassortant H9N2 viruses into the swine or humansmight 2776

resultintheselectionofvirusvariantswithtransmissionefficiencyclosetothatofthe 2777

endemicswineorhumaninfluenzaviruses.However,thelackoftransmissiondetected 2778

in 1 of the contact groupsused for transmissionof passage 7 virus, emphasizes the 2779

complexityoftheadaptationprocessofanavianvirustoamammalianspeciesandthe 2780

need for additional research to better understand this crucial step in cross-species 2781

transmissionofinfluenzaviruses. 2782

2783

Page 110: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter4

99

4.5 Acknowledgements 2784

The authors thank the Centers for Disease Control and Prevention (US CDC) for 2785

providing the pH1N1 influenza viruses and Lieve Sys, Melanie Bauwens and Nele 2786

Dennequin for excellent technical assistance. This study was supported by the EU 2787

FLUPIGproject(FP7-GA258084).SilvieVandenHoeckewassupportedbyFondsvoor 2788

WetenschappelijkOnderzoek(Flanders,Belgium)(3G052412). 2789

2790

Authorcontributions 2791

K.V.R. and J.C.M.G. designed research; J.C.M.G. performed the animal experiments; 2792

J.C.M.G. and S.V.D.H. performed the laboratory and the genetic analysis; K.V.R., 2793

J.C.M.G., S.V.D.H. and X.S. analysed data; K.V.R., J.C.M.G., S.V.D.H., X.S., W.M. and 2794

J.A.R.wrotethepaper. 2795

2796

Competingfinancialinterests 2797

Theauthorsdeclarenocompetingfinancialinterest. 2798

2799

4.6 References 2800

Abente, E. J., Kitikoon, P., Lager, K.M.,Gauger, P. C., Anderson, T. K. et al. (2016). A highly 2801pathogenic avian influenza virus H5N1 with 2009 pandemic H1N1 internal genes 2802demonstratesincreasedreplicationandtransmissioninpigs.JGenVirol,98(1),18-30. 2803

2804Belser, J. A., Jayaraman, A., Raman, R., Pappas, C., Zeng, H. et al. (2011). Effect of D222G 2805

mutation in the hemagglutinin protein on receptor binding, pathogenesis and 2806transmissibilityofthe2009pandemicH1N1influenzavirus.PLoSOne,6,e25091. 2807

2808Brookes, S. M., Nunez, A., Choudhury, B., Matrosovich, M., Essen, S. C. et al. (2010). 2809

Replication,pathogenesisandtransmissionofpandemic(H1N1)2009virusinnon-immune 2810pigs.PLoSOne,5,e9068. 2811

2812Butt, A. M., Siddique, S., Idrees, M. and Tong, Y. (2010). Avian influenza A (H9N2): 2813

computational molecular analysis and phylogenetic characterization of viral surface 2814proteinsisolatedbetween1997and2009fromthehumanpopulation.VirolJ,7,319. 2815

2816 2817 2818 2819

Page 111: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

EffectofserialpassagesintheadaptationofareassortantH9N2containingpH1N1internalgenes

100

Campbell, P. J., Danzy, S., Kyriakis, C. S., Deymier,M. J., Lowen, A. C. et al. (2014). TheM 2820segment of the 2009 pandemic influenza virus confers increased neuraminidase activity, 2821filamentous morphology, and efficient contact transmissibility to A/Puerto Rico/8/1934- 2822basedreassortantviruses.JVirol,88,3802-14. 2823

2824CentersforDiseaseControlandPrevention.(2016).SituationSummaryonInfluenzaA(H3N2) 2825

VariantViruses("H3N2").Available:http://www.cdc.gov/flu/swineflu/h3n2v-situation.htm. 2826 2827Gabriel,G.,Herwig,A.andKlenk,H.D.(2008).InteractionofpolymerasesubunitPB2andNP 2828

with importinalpha1 isadeterminantofhost rangeof influenzaAvirus.PLoSPathog, 4, 2829e11. 2830

2831Kimble,J.B.,Sorrell,E.,Shao,H.,Martin,P.L.andPerez,D.R.(2011).CompatibilityofH9N2 2832

avianinfluenzasurfacegenesand2009pandemicH1N1internalgenesfortransmissionin 2833theferretmodel.ProcNatlAcadSciUSA,108,12084-8. 2834

2835Lakdawala,S.S., Jayaraman,A.,Halpin,R.A., Lamirande,E.W.,Shih,A.R.etal. (2015).The 2836

soft palate is an important site of adaptation for transmissible influenza viruses.Nature, 2837526,122-5. 2838

2839Liang,H.,Lam,T.T.,Fan,X.,Chen,X.,Zeng,Y.etal, (2014).Expansionofgenotypicdiversity 2840

andestablishmentof2009H1N1pandemic-origininternalgenesinpigsinChina.JVirol,88, 284110864-74. 2842

2843Lin, Y. P., Shaw, M., Gregory, V., Cameron, K., Lim, W. et al, (2000). Avian-to-human 2844

transmission ofH9N2 subtype influenzaA viruses: relationship betweenH9N2 andH5N1 2845humanisolates.ProcNatlAcadSciUSA,97,9654-8. 2846

2847ManceraGracia,J.C.,VandenHoecke,S.,Saelens,X.andVanReeth,K.(2017).Effectofserial 2848

pigpassageson the adaptationof an avianH9N2 influenza virus to swine.PLoSOne, 12, 2849e0175267. 2850

2851Matrosovich, M. N., Gambaryan, A. S., Teneberg, S., Piskarev, V. E., Yamnikova, S. S. et al. 2852

(1997). Avian influenza A viruses differ from human viruses by recognition of 2853sialyloligosaccharides and gangliosides and by a higher conservation of the HA receptor- 2854bindingsite.Virology,233,224-34. 2855

2856Matrosovich, M. N., Krauss, S. and Webster, R. G. (2001). H9N2 influenza A viruses from 2857

poultryinAsiahavehumanvirus-likereceptorspecificity.Virology,281,156-62. 2858 2859Matrosovich,M.,Herrler,G.andKlenk,H.D.(2015).SialicAcidReceptorsofViruses.TopCurr 2860

Chem,367,1-28. 2861 2862Mehle,A.andDoudna,J.A.(2009).Adaptivestrategiesofthe influenzaviruspolymerasefor 2863

replicationinhumans.ProcNatlAcadSciUSA,106,21312-6. 2864 2865Nelli,R.K.,Kuchipudi,S.V.,White,G.A.,Perez,B.B.,Dunham,S.P.etal.(2010).Comparative 2866

distributionofhumanandaviantypesialicacidinfluenzareceptorsinthepig.BMCVetRes, 28676,4. 2868

2869

Page 112: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter4

101

Nelson,M.I.,Vincent,A.L.,Kitikoon,P.,Holmes,E.C.andGramer,M.R.(2012).Evolutionof 2870novel reassortant A/H3N2 influenza viruses inNorthAmerican swine and humans, 2009- 28712011.JVirol,86,8872-8. 2872

2873Obadan,A.O.,Kimble,B. J.,Rajao,D.S., Lager,K.,Santos, J. J.etal. (2015).Replicationand 2874

transmission of mammalian-adapted H9 subtype influenza virus in pigs and quail. J Gen 2875Virol,96(9),2511-21. 2876

2877Peiris,M.,Yuen,K.Y., Leung,C.W.,Chan,K.H., Ip,P. L.etal. (1999).Human infectionwith 2878

influenzaH9N2.Lancet,354,916-7. 2879 2880Peiris, J. S., Guan, Y.,Markwell, D., Ghose, P.,Webster, R. G. et al. (2001). Cocirculation of 2881

avianH9N2andcontemporary "human"H3N2 influenzaAviruses inpigs in southeastern 2882China:potentialforgeneticreassortment?JVirol,75,9679-86. 2883

2884Qiao,C.,Liu,Q.,Bawa,B.,Shen,H.,Qi,W.etal. (2012).Pathogenicityandtransmissibilityof 2885

reassortant H9 influenza viruses with genes from pandemic H1N1 virus. J Gen Virol, 93, 28862337-45. 2887

2888Simon,G.,Larsen,L.E.,Durrwald,R.,Foni,E.,Harder,T.etal. (2014).Europeansurveillance 2889

network for influenza inpigs: surveillanceprograms,diagnostic toolsand swine influenza 2890virus subtypes identified in 14 European countries from 2010 to 2013. PLoS One, 9, 2891e115815. 2892

2893Smith, G. J., Vijaykrishna, D., Bahl, J., Lycett, S. J., Worobey, M. et al. (2009). Origins and 2894

evolutionarygenomicsof the2009 swine-originH1N1 influenzaAepidemic.Nature, 459, 28951122-5. 2896

2897Sun,Y.,Pu,J.,Jiang,Z.,Guan,T.,Xia,Y.etal.(2010).Genotypicevolutionandantigenicdriftof 2898

H9N2influenzavirusesinChinafrom1994to2008.VetMicrobiol,146,215-25. 2899 2900Sun,Y.andLiu,J.(2015).H9N2influenzavirusinChina:acauseofconcern.ProteinCell,6,18- 2901

25. 2902 2903Taubenberger, J. K. and Kash, J. C. (2010). Influenza virus evolution, host adaptation, and 2904

pandemicformation.CellHostMicrobe,7,440-51. 2905 2906TheSJCEIRSH9WorkingGroup (2013).Assessing the fitnessofdistinct cladesof influenzaA 2907

(H9N2)viruses.EmergMicrobesInfect,2,e75. 2908 2909VandenHoecke,S.,Verhelst,J.,Vuylsteke,M.andSaelens,X.(2015).Analysisofthegenetic 2910

diversityofinfluenzaAvirusesusingnext-generationDNAsequencing.BMCGenomics,16, 291179. 2912

2913Van Poucke, S. G., Nicholls, J.M., Nauwynck, H. J. and Van Reeth, K. (2010). Replication of 2914

avian, humanand swine influenza viruses in porcine respiratory explants and association 2915withsialicaciddistribution.VirolJ,7,38. 2916

2917Van Reeth, K., Gregory, V., Hay, A. and Pensaert,M. (2003). Protection against a European 2918

H1N2 swine influenza virus inpigspreviously infectedwithH1N1and/orH3N2 subtypes. 2919Vaccine,21,1375-81. 2920

2921

Page 113: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

EffectofserialpassagesintheadaptationofareassortantH9N2containingpH1N1internalgenes

102

Vincent,A.,Awada,L.,Brown,I.,Chen,H.,Claes,F.etal.(2014).ReviewofinfluenzaAvirusin 2922swineworldwide:acallforincreasedsurveillanceandresearch.ZoonosesPublicHealth,61, 29234-17. 2924

2925Wan, H. and Perez, D. R. (2007). Amino acid 226 in the hemagglutinin of H9N2 influenza 2926

virusesdeterminescelltropismandreplicationinhumanairwayepithelialcells.JVirol,81, 29275181-91. 2928

2929Wan,H.,Sorrell,E.M.,Song,H.,Hossain,M.J.,Ramirez-Nieto,G.etal.(2008).Replicationand 2930

transmissionofH9N2 influenza viruses in ferrets: evaluationof pandemicpotential.PLoS 2931One,3,e2923. 2932

2933Wang, J.,Wu,M.,Hong,W.,Fan,X.,Chen,R.etal. (2016). InfectivityandTransmissibilityof 2934

AvianH9N2InfluenzaVirusesinPigs.JVirol,90(7),3506-14. 2935 2936Watson, S. J.,Welkers,M. R., Depledge, D. P., Coulter, E., Breuer, J.M. et al. (2013). Viral 2937

population analysis and minority-variant detection using short read next-generation 2938sequencing.PhilosTransRSocLondBBiolSci,368,20120205. 2939

2940Wilker, P. R., Dinis, J. M., Starrett, G., Imai, M., Hatta, M. et al. (2013). Selection on 2941

haemagglutininimposesabottleneckduringmammaliantransmissionofreassortantH5N1 2942influenzaviruses.NatCommun,4,2636. 2943

2944WorldHealthOrganization.(2016a).Antigenicandgeneticcharacteristicsofzoonoticinfluenza 2945

viruses and development of candidate vaccine viruses for pandemic preparedness. 2946Available: 2947http://www.who.int/influenza/vaccines/virus/201602_zoonotic_vaccinevirusupdate.pdf?u 2948a=1. 2949

2950World Health Organization. (2016b). Influenza at the human-animal interface. Available: 2951

http://www.who.int/influenza/human_animal_interface/Influenza_Summary_IRA_HA_inte 2952rface_10_03_2016.pdf?ua=1. 2953

2954Yu, H., Hua, R. H., Wei, T. C., Zhou, Y. J., Tian, Z. J. et al. (2008). Isolation and genetic 2955

characterization of avian originH9N2 influenza viruses frompigs in China.VetMicrobiol, 2956131,82-92. 2957

2958Zhang, Y., Zhang, Q., Gao, Y., He, X., Kong, H. et al. (2012). Key molecular factors in 2959

hemagglutinin and PB2 contribute to efficient transmission of the 2009 H1N1 pandemic 2960influenzavirus.JVirol,86,9666-74. 2961

2962Zhou,B.,Donnelly,M.E.,Scholes,D.T.,StGeorge,K.,Hatta,M.etal.(2009).Single-reaction 2963

genomic amplification accelerates sequencing and vaccine production for classical and 2964Swineoriginhumaninfluenzaaviruses.JVirol,83,10309-13. 2965

2966

Page 114: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter4

103

Supplementary Table S1: Variants present in H9N2:pH1N1 (P0) virus stock. The 2967sequencing reads of the H9N2:pH1N1 (P0) stock virusweremapped to a combined 2968reference genome composed of thede novo assembled consensus sequence of the 2969H9N2:pH1N1 (P7) stock virus and the reference sequence for the A/quail/Hong 2970Kong/G1/1997(H9N2) virus. The nonsynonymous variants detected in the 2971H9N2:pH1N1(P7)genomeabove0.5%areshownpergenomesegment. 2972 2973PB2(H1N1)

ReferencePosition Reference Allele Frequency Aminoacidchange81 T C 0.53 PB2:p.Ser12Pro90 C A 0.61 PB2:p.Arg15Ser141 A - 0.67 PB2:p.Lys32fs145 A G 1.16 PB2:p.Lys33Arg175 C A 0.69 PB2:p.Pro43His196 T A 0.87 PB2:p.Met50Lys199 T - 0.82 PB2:p.Met51fs214 C A 0.57 PB2:p.Pro56Gln237 A T 0.51 PB2:p.Met64Leu242 C A 0.80 PB2:p.Asp65Glu242 C G 0.55 PB2:p.Asp65Glu244 T C 0.55 PB2:p.Met66Thr325 C A 0.53 PB2:p.Pro93His1651 C T 100.00 PB2:p.Thr535Met1933 G A 11.11 PB2:p.Ser629Asn1987 TACTGG - 56.89 PB2:p.Ile647_Val649delinsIle1993 T - 3.36 PB2:p.Val649fs2100 G T 0.64 PB2:p.Gly685Trp2101 G T 0.62 PB2:p.Gly685Val2138 G T 0.51 PB2:p.Leu697Phe2146 A C 0.76 PB2:p.Glu700Ala2157 - AT 7.05 PB2:p.Tyr704fs2232 G T 0.54 PB2:p.Gly729Trp2233 G T 0.67 PB2:p.Gly729Val2263 G T 0.60 PB2:p.Arg739Leu

PB1(H1N1) ReferencePosition Reference Allele Frequency Aminoacidchange

74 AAAAATTCCAGCGCA - 1.25 PB1:p.Leu10_Gln15delinsLeu112 C A 0.67 PB1:p.Pro23His186 C A 0.53 PB1:p.Gln48Lys190 ACT GAA 13.38 PB1:p.Tyr49_Ser50delins*Thr192 T - 4.14 PB1:p.Ser50fs192 T A 12.87 PB1:p.Ser50Thr205 A G 55.27 PB1:p.Lys54Arg269 G T 6.88 PB1:p.Glu75Asp2146 C A 0.60 PB1:p.Pro701His2187 G A 0.87 PB1:p.Val715Met2224 G T 0.63 PB1:p.Arg727Met

Page 115: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

EffectofserialpassagesintheadaptationofareassortantH9N2containingpH1N1internalgenes

104

SupplementaryTableS1:VariantspresentinH9N2:pH1N1(P0)stockvirus 2974(Continued). 2975

2976PA(H1N1)

ReferencePosition Reference Allele Frequency Aminoacidchange117 G T 0.52 PA:p.Gly25Trp118 G T 0.60 PA:p.Gly25Val211 A T 5.97 PA:p.Glu56Val214 G T 1.31 PA:p.Arg57Leu247 C A 1.23 PA:p.Pro68Gln340 G T 0.65 PA:p.Gly99Val418 G T 0.60 PA:p.Arg125Met695 A C 70.88 PA:p.Gln217His938 G T 1.82 PA:p.Glu298Asp1260 T A 2.67 PA:p.Trp406Arg1696 G T 0.54 PA:p.Arg551Met1775 G T 0.76 PA:p.Trp577Cys1921 G T 0.54 PA:p.Arg626Met1922 G T 0.68 PA:p.Arg626Ser1944 G T 0.56 PA:p.Gly634Trp1957 G A 1.28 PA:p.Arg638Lys2062 G T 0.68 PA:p.Arg673Met2094 G T 0.55 PA:p.Gly684Trp2095 G T 0.61 PA:p.Gly684Val2095 GG AA 0.69 PA:p.Gly684Glu2097 G T 0.55 PA:p.Gly685Trp2107 A G 0.82 PA:p.Glu688Gly2140 G T 0.59 PA:p.Trp699Leu

HA(H9N2) ReferencePosition Reference Allele Frequency Aminoacidchange

180 C A 0.56 HA:p.Pro43His254 C A 0.62 HA:p.Leu68Ile300 C A 0.76 HA:p.Pro83His314 C A 0.53 HA:p.Leu88Met381 C A 0.59 HA:p.Pro110His383 G T 0.57 HA:p.Gly111Trp459 C A 0.54 HA:p.Pro136Gln575 C A 0.58 HA:p.Gln175Lys591 G T 0.57 HA:p.Arg180Met616 G T 0.51 HA:p.Trp188Cys630 C A 0.67 HA:p.Pro193Gln757 G T 0.75 HA:p.Gln235His821 G T 0.74 HA:p.Gly257Trp899 A G 3.12 HA:p.Ser283Gly996 C A 0.60 HA:p.Pro315His1158 G T 0.63 HA:p.Gly369Val

Page 116: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter4

105

SupplementaryTableS1:VariantspresentinH9N2:pH1N1(P0)stockvirus 2977(Continued). 2978 2979HA(H9N2)

ReferencePosition Reference Allele Frequency Aminoacidchange1437 G T 0.55 HA:p.Arg462Met1589 G T 0.68 HA:p.Gly513Trp1590 G T 0.57 HA:p.Gly513Val1669 G T 0.56 HA:p.Met539Ile

NP(H9N2) ReferencePosition Reference Allele Frequency Aminoacidchange

321 G T 0.62 NP:p.Gly86Trp331 C A 0.54 NP:p.Pro89Gln376 G T 0.62 NP:p.Trp104Leu525 C A 0.51 NP:p.Leu154Ile547 C A 0.54 NP:p.Pro161His579 C A 0.62 NP:p.Leu172Ile583 C A 0.83 NP:p.Pro173Gln617 G T 0.65 NP:p.Lys184Asn624 G T 0.54 NP:p.Gly187Trp632 G T 0.51 NP:p.Met189Ile747 G T 0.70 NP:p.Gly228Trp810 G T 0.56 NP:p.Gly249Trp943 G T 0.73 NP:p.Arg293Met948 G T 0.64 NP:p.Gly295Trp1041 A G 1.50 NP:p.Ser326Gly1110 G T 0.66 NP:p.Gly349Trp1111 G T 0.57 NP:p.Gly349Val1355 G T 0.62 NP:p.Lys430Asn1356 G T 0.53 NP:p.Gly431Trp1442 G T 0.51 NP:p.Gln459His1443 G T 0.73 NP:p.Gly460Trp1447 G T 0.72 NP:p.Arg461Leu

NA(H9N2) ReferencePosition Reference Allele Frequency Aminoacidchange

167 C A 0.69 NA:p.Pro43Gln328 C A 0.75 NA:p.Pro97Thr329 C A 0.61 NA:p.Pro97His367 G T 0.59 NA:p.Gly110Trp368 G T 0.57 NA:p.Gly110Val377 G T 0.90 NA:p.Trp113Leu522 G T 0.51 NA:p.Leu161Phe540 G T 0.69 NA:p.Leu167Phe619 G T 0.53 NA:p.Gly194Trp620 G T 0.71 NA:p.Gly194Val811 G T 0.62 NA:p.Gly258Trp

Page 117: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

EffectofserialpassagesintheadaptationofareassortantH9N2containingpH1N1internalgenes

106

SupplementaryTableS1:VariantspresentinH9N2:pH1N1(P0)stockvirus 2980(Continued). 2981 2982NA(H9N2)

ReferencePosition Reference Allele Frequency Aminoacidchange878 C A 0.62 NA:p.Pro280His1046 G T 0.61 NA:p.Arg336Met1066 G T 0.54 NA:p.Gly343Trp1084 G T 0.62 NA:p.Gly349Trp1119 G T 0.56 NA:p.Met360Ile1166 G T 0.61 NA:p.Arg376Met1318 G T 0.59 NA:p.Gly427Trp1415 G T 0.56 NA:p.Gly459Val

M(H1N1) ReferencePosition Reference Allele Frequency Aminoacidchange

92 C A 0.69 M1:p.Pro16Gln103 C A 0.65 M1:p.Leu20Ile301 G T 0.52 M1:p.Gly86Trp307 G T 0.51 M1:p.Gly88Trp308 G T 0.51 M1:p.Gly88Val314 C A 0.57 M1:p.Pro90Gln366 A G 0.77 M1:p.Ile107Met450 G T 0.62 M1:p.Met135Ile514 T G 0.52 M1:p.Ser157Ala670 A G 0.66 M1:p.Thr209Ala687 T G 0.84 M1:p.His214Gln703 G T 0.52 M1:p.Gly220Trp745 C A 1.30 M1:p.Leu234Ile762 C T 1.29 M2:p.[Pro10Leu]771 G A 1.15 M2:p.[Ser13Asn]774 A G 1.20 M2:p.[Glu14Gly]

777 G T 0.70 M1:p.[Met244Ile]M2:p.[Trp15Leu]

780 A G 1.12 M2:p.[Glu16Gly]814 CA TG 1.19 M2:p.Val27_Ile28delinsValVal825 A G 1.64 M2:p.Asn31Ser833 G T 0.53 M2:p.Gly34Trp860 AC CT 1.47 M2:p.Thr43Leu951 G T 0.64 M2:p.Arg73Met963 AA GG 1.02 M2:p.Gln77Arg978 G A 1.13 M2:p.Ser82Asn

NS(H1N1) ReferencePosition Reference Allele Frequency Aminoacidchange

61 CA TG 3.90 NS1:p.[Thr5_Met6delinsThrVal]NS2:p.[Thr5_Met6delinsThrVal]

98 A G 2.75 NS1:p.Ile18Val

Page 118: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter4

107

SupplementaryTableS1:VariantspresentinH9N2:pH1N1(P0)stockvirus 2983(Continued). 2984

2985NS(H1N1)

ReferencePosition Reference Allele Frequency Aminoacidchange119 A C 1.63 NS1:p.Asn25His127 G T 0.75 NS1:p.Leu27Phe138 C A 0.55 NS1:p.Pro31Gln161 G A 0.74 NS1:p.Asp39Asn177 A G 0.82 NS1:p.Lys44Arg186 G A 0.75 NS1:p.Gly47Asp189 A G 0.84 NS1:p.Asn48Ser222 T G 0.77 NS1:p.Leu59Arg235 A T 0.76 NS1:p.Gln63His244 AT GC 0.74 NS1:p.Glu66_Trp67delinsGluArg272 A G 0.58 NS1:p.Thr76Ala329 C A 0.75 NS1:p.Leu95Ile342 C A 0.66 NS1:p.Ser99355 C A 0.73 NS1:p.Phe103Leu364 G T 0.51 NS1:p.Met106Ile477 - C 0.95 NS1:p.Leu144fs502 G T 2.33 NS1:p.Glu152Asp505 G T 0.52 NS1:p.Glu153Asp507 G A 0.56 NS1:p.Gly154Glu557 T G 1.07 NS1:p.[Tyr171Asp]559 T C 1.11 NS2:p.[Met14Thr]578 G A 1.51 NS1:p.[Val178Ile]

582 G T 0.57 NS1:p.[Gly179Val]NS2:p.[Gly22Trp]

612 G A 1.30 NS1:p.[Gly189Asp]NS2:p.[Val32Ile]

619 G A 1.16 NS2:p.[Arg34Gln]

636 A C 1.00 NS1:p.[Asn197Thr]NS2:p.[Ile40Leu]

638 A C 0.93 NS1:p.[Ile198Leu]650 G A 1.23 NS1:p.[Ala202Thr]

660 A G 1.08 NS1:p.[Asn205Ser]NS2:p.[Thr48Ala]

662 T A 0.87 NS1:p.[Cys206Ser]

674 G T 0.78 NS1:p.[Gly210Trp]NS2:p.[Met52Ile]

680 C T 1.48 NS1:p.[Pro212Ser]683 T C 1.40 NS1:p.[Ser213Pro]688 A C 1.04 NS2:p.[Tyr57Ser]695 G A 1.30 NS1:p.[Glu217Lys]697 G A 1.25 NS2:p.[Ser60Asn]704 T C 1.02 NS1:p.[220Arg]

2986

Page 119: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

EffectofserialpassagesintheadaptationofareassortantH9N2containingpH1N1internalgenes

108

SupplementaryTableS1:VariantspresentinH9N2:pH1N1(P0)stockvirus 2987(Continued). 2988 2989NS(H1N1)

ReferencePosition Reference Allele Frequency Aminoacidchange

706 A G 1.05 NS1:p.[220Trp]NS2:p.[Glu63Gly]

726 G A 1.02 NS2:p.Gly70Arg742 A G 0.91 NS2:p.Glu75Gly765 A G 1.03 NS2:p.Met83Val861 G A 0.74 NS2:p.Ala115Thr

Page 120: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

109

2990

GENERALDISCUSSION 2991

29925

Page 121: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Generaldiscussion

110

PotentialofadaptationofavianH9N2influenzavirusestopigs 2993

AvianH9N2 influenza virusesarewidespread in land-basedpoultry inmostEurasian 2994

countries(SunandLiu,2015).Since1998,thoseviruseshavebeenrepeatedlyisolated 2995

from pigs and humans, but always as dead-end events (Guo et al., 2000, Yu et al., 2996

2011,WorldHealthOrganization,2017).However, thecontinuousexposuretoH9N2 2997

AIVs might pose a threat if those viruses could be transmitted efficiently among 2998

mammals.Althoughpigs are considered toplay a role as intermediatehosts for the 2999

transmissionofAIVs tohumans, it remainsunknownwhetherH9N2AIVs couldever 3000

becomeadaptedtopigs.Sixstudiesbyother researchersalreadydemonstratedthat 3001

pigs are susceptible to different H9N2 virus strains, but they did not answer the 3002

questionastowhetherH9N2virusesmightbecomeestablished inswine(Kidaetal., 3003

1994,Qiaoetal.,2012,TheSCEIRSH9N2workinggroup,2013,Obadanetal.,2015, 3004

Wangetal.,2016).Therefore,thefirstaimofthisthesiswastoevaluatethepotential 3005

ofH9N2virusestobecomeadaptedtopigs. 3006

OurresearchconfirmstheabilityofH9N2AIVsto infectpigsas reported inprevious 3007

experimentalstudiesandinthefield(Kidaetal.,1994,Sunetal.,2010,TheSJCEIRSH9 3008

Working Group, 2013, Wang et al., 2016). The susceptibility of pigs to diverse AIV 3009

subtypes has been demonstrated by several researchers and it is one of the main 3010

argumentstosupporttheroleofthepigasanintermediatehostinthegenerationof 3011

pandemicinfluenzaviruseswithavianHAgenes(Kidaetal.,1994,DeVleeschauweret 3012

al.,2009a,Zhuetal.,2013).Inourstudy,thereplicationratesoftheoriginalH9N2and 3013

itsvirusdistributionintherespiratorytractofpigsweresimilartothosedescribedby 3014

De Vleeschauwer and colleagues in studies with a “purely avian” H5N2 LPAIV (De 3015

Vleeschauwer et al., 2009a). However, as described with other AIVs, infection with 3016

H9N2didnotresultinefficientpig-to-pigtransmission. 3017

Theserialpigpassagesinducedaselectivepressureonthevirusthatledtoabroader 3018

tissue infectionand increasedvirusreplicationafter4passages.Thisconsequenceof 3019

theserialpassagingwasnotonlydescribedbytheincreasedbindingofanavianH3N2 3020

virus toSiaα2,6Gal receptors inpigs (Shichinoheetal.,2013),butalsoshownbythe 3021

adaptationofH5N1andH9N2AIVstoferrets(Sorrelletal.,2009,Herfstetal.,2012).It 3022

is interesting to mention that the broader tissue infection and the increased virus 3023

replication described after 4 passages were not correlated with the in vitro growth 3024

Page 122: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter5

111

kineticsofthevirus.Thisfindingconfirmsthat invitroresults incontinuouscell lines 3025

are often not relevant for the performance of the virus in the animal host. Similar 3026

findings were made in previous H9N2 studies, in which the pathogenicity and the 3027

virulenceofthevirusinpigsdidnotmimicthereplicationkineticsinMDCKandA549 3028

cell lines(Qiaoetal.,2012). Inaddition,ourkineticassaywasperformedwithMDCK 3029

cells that are known to express in both avian-type (Siaα2,3Gal) and human-type 3030

(Siaα2,6Gal)cell receptors.Thus, thiscell line ispermissive tomost influenzaviruses 3031

andthedifferencesduetoadifferentreceptor-bindingaffinityandnot influencethe 3032

celllineinfection. 3033

From pig passage 7 onwards replication of the H9N2 virus progressively decreased 3034

until itwas lost.This loss-of-functionmaybeexplainedby thenegativeeffectof the 3035

selectivepressure.Itwasalreadydemonstratedthattransmissionofinfluenzaviruses 3036

in ferrets incurs in a selective pressure. This pressure is supposed to generate a 3037

bottleneckthatdecreasesviraldiversityallowingminorvariantstobecomedominant 3038

(Wilker et al., 2013). The stringency of those bottlenecks depends in part on the 3039

infection route (aerosol infection versus direct contact infection), and it can change 3040

duringhostadaptation(Varbleetal.,2014,Monclaetal.,2014). InthecaseofH5N1 3041

virusesand1918pandemicH1N1itappearedthattheselectivepressurefavouredthe 3042

viruseswithenhancedfitness(Wilkeretal.,2013,Monclaetal.,2014).However,ina 3043

similarstudydonewiththeH7N9subtypethebottleneckseemedtohavetheopposite 3044

effect and limited the transmissionof the virus (Zaraketet al., 2015). Therefore,we 3045

hypothesized that the serial passages had a positive effect on the selection of virus 3046

variantswithhigher replicationefficiencies.However, at a certainpoint theadditive 3047

effectofsuccessiveselectivepressuresmaybecomenegativeandthismayresultina 3048

progressive decrease of the virus replication and excretion (Figure 1). As our serial 3049

passages were blind this progressive decrease in virus replication resulted in the 3050

inoculation of the subsequent animals with insufficient amounts of virus and a 3051

completelossofthevirusatpassage10.Extensivenextgenerationsequencing(NGS) 3052

analysisofallpassageswouldbeneededtoexaminethegeneticevolutionofthevirus 3053

duringthe10passagesandtoproveourhypothesis. 3054

Page 123: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Generaldiscussion

112

A B 3055

Figure 1. (A) Hypothesis on the effect of serial passaging in the generation of a 3056selective pressure on the virus that selects for different virus variants but also 3057decreasesvirusdiversity.(B)Theselectivepressurecomesmorerestrictive(narrower 3058bottleneck)withmorepassages.Thisresultsinadecreaseinvirusfitnessthatwilllead 3059to the complete loss of the virus at passage 10 (Figure adapted fromMoncla et al. 30602016). 3061 3062ThefourthpassageH9N2virusshowedenhanceddirect-contacttransmissionbetween 3063

pigswhen compared to the original virus. Though transmission of this virus did not 3064

result in high virus excretion by the direct-contact pigs, it was higher than that 3065

observedinpreviousH9N2studiesinpigs,orinotherstudieswithH7N9andotherAIV 3066

subtypes(DeVleeschauweretal.,2009b,TheSJCEIRSH9WorkingGroup,2013,Liuet 3067

al.,2014,Wangetal.,2016).However,transmissionrateswerelowerwhencompared 3068

withH9N2adaptationstudies inmammalsother than thepig.Forexample,after15 3069

passageswithanavianH9N2isolateinguineapigs3outof3direct-contactguineapigs 3070

excretedhighamountsofvirus(Sangetal.2015).Ofcourse it isdifficulttocompare 3071

ourresultsinpigswiththoseobtainedinotheranimalspeciesbecauseofthedifferent 3072

animal models, the different virus strains and experimental conditions used. We 3073

selected swine because it is a natural influenza virus host that may act as an 3074

intermediary in theadaptationofAIVs tomammals,butalsobecausepigs resemble 3075

humans in terms of physiology, anatomy and Sia receptor distribution. In contrast, 3076

other researchers used the ferret as it is considered the “gold standard”model for 3077

research on adaptation of avian influenza viruses tomammals (Belser et al., 2016). 3078

Guineapigsormicearealsobeingusedtoevaluatetransmissionand/orvirulenceof 3079

“adapted”AIVsduetotheireasymanagementinexperimentalconditions.Inaddition 3080

to the evident physiological or physical differences posed by those animal models 3081

therearealsodifferencesinexperimentaldesign.Inpigs,duethelimitationsposedby 3082

their size, we performed direct-contact transmission experiments. However, most 3083

Serial'passages'put'selec.ve'pressure'on'the'virus'that'promote'the'selec.on'of'few'virus'variants'and'decrease'viral'diversity'

The' selec.ve' pressure' turns' to' be' more'restric.ve'“narrower'bo;leneck”'as'passages'are' performed.' This' results' in' a' decrease' in'virus' fitness' that' will' lead' to' the' complete'loss'of'the'virus'at'passage'10''

Passage'1' Passage'2'

...'Passage'7' Passage'8' Passage'9' Passage'10'

...'

Page 124: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter5

113

studies using ferrets or guinea pigs were more restrictive and considered efficient 3084

droplet transmission as a requirement for efficient adaptation (Sorrell. et al., 2009, 3085

Herfst et al., 2012, Imai et al., 2012, Sang et al., 2015). Although we consider that 3086

respiratory droplet transmission restricts virus transmission, it is clear that direct- 3087

contact transmission is one of themain pathways of influenza virus transmission in 3088

nature.Weassumethatavirusthattransmitsamongpigswithasimilarefficiencyas 3089

endemicswineinfluenzaviruses,willbeefficientlytransmittedinnatureaswell. 3090

In conclusion, pigs are susceptible to H9N2 infection under experimental conditions 3091

andserialpassagesinpigsposeaselectivepressurethatenhancesvirusfitness.Thus, 3092

the pig may act as intermediate host for H9N2 AIVs. However, our results 3093

demonstrated that serial passages were not sufficient to confer efficient pig-to-pig 3094

transmission. This is consistent with the fact that H9N2 influenza viruses have 3095

recurrently infected pigs in nature but never became established in swine. 3096

Furthermore, previous experimentswithH9N2 in ferrets also support thesedata. In 3097

those experiments reassortment with human seasonal H3N2 internal genes was 3098

necessary to achieve ferret-to-ferret transmission (Sorrel et al., 2009). However, 3099

introductionof4punctualmutationsintheHAand1inthePB2genesinaH5N1virus 3100

wassufficienttoachieveefficientdroplettransmissioninferrets(Herfstetal.,2012). 3101

ThisrevealsthatadaptationofH9N2AIVstopigsisnotastraightforwardprocessand 3102

thatacombinationofmolecularchangesmaybe required toachieve fulladaptation 3103

(ofH9N2AIVsinpigs). 3104

3105

TheroleofpH1N1internalgenesintheadaptationofavianH9N2virusestopigs 3106

Our results demonstrate that the “pig-adapted”pH1N1-origin internal protein-genes 3107

mayposeanadvantagefortheadaptationofH9N2virustopigs.Thisisconsistentwith 3108

previous studies in which similar reassortant H9N2 viruses showed enhanced 3109

transmission inpigswhencomparedwith theoriginalavianH9N2 (Qiaoetal.,2012, 3110

Obadanet al., 2015).Although those virusesdidnot transmit asefficientlybetween 3111

pigs as the “swine-adapted” viruses, similar reassortant viruses showed efficient 3112

droplet transmission in ferrets (Kimble et al., 2011). These results also highlight the 3113

importance of the pH1N1 internal gene cassette in the adaptation of influenza A 3114

viruses to mammals. This “quadruple-reassortant” internal gene cassette contains 3115

Page 125: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Generaldiscussion

114

avian,human,NorthAmericanandEuropeanswine-origininfluenzavirusgenesandis 3116

widespreadinswineandhumansworldwide(Watsonetal.,2015,Rajaoetal.,2016). 3117

As mentioned in Chapter 4.4.3, the H9N2 reassortant virus used in our study was 3118

contaminated. Its internal genes were a combination of H9N2 and pH1N1-origin, 3119

insteadof only pH1N1-origin. This contaminationwas possibly originatedduring the 3120

reverse genetic generation of the virus due to the unexpected presence of H9N2 3121

internalgenesplasmids.However, theserialpassagingof thesevirusesclearly led to 3122

the selection of a virus possessing mainly pH1N1-origin internal genes, the only 3123

exceptionwasthegeneencodingtheNP,whichoriginatedfromtheavianH9N2.The 3124

NPproteinhasbeenshowntoplayaroleinthehostadaptationbyitsinteractionwith 3125

the host-cell importin-a. This mediates the host-cell protein migration of the viral 3126

ribonucleoprotein to the nucleus and facilitates the evasion from the immune 3127

response in humans (Cauldwell et al., 2014). It was shown that human NP was 3128

necessary forefficient replicationofH7viruses in transgenicmiceexpressinghuman 3129

MxA,whichisaninterferon-stimulatedproteinthatrestrictsvirusreplication(Deeget 3130

al., 2017). Therefore, the fact that avian-originNP remained in our virus and itwas 3131

transmissibleinswinecontrastswiththeseexperimentsintransgenicmice.However, 3132

it raises thequestionhowthis“swine-adapted”viruswouldperform inhumansas it 3133

was demonstrated that avian viruses require a human adapted NP to evade the 3134

negativeeffectoftheMxArestrictionfactorinvirusreplication(Deegetal.,2017). 3135

Unlike the original H9N2, the reassortant H9N2 was not lost after serial passaging. 3136

Moreover, after 7 passages in pigs the reassortant virus showed enhanced 3137

transmission efficiency when compared with the original virus and with previous 3138

studieswithH9N2:pH1N1reassortantvirusesinpigs(Qiaoetal.,2012,Obadanetal., 3139

2015), but also with the “adapted” H9N2 virus tested in Chapter 3. This higher 3140

transmissionratesuggeststhatthecombinationofreassortmentandserialpassaging 3141

in pigs contributed to the adaptation of the reassortant H9N2 virus. This finding is 3142

important because bothH9N2 and pH1N1 viruses are co-circulating in Asia and can 3143

infect pigs and humans increasing the possibilities of reassortment. The repeated 3144

introductionof such reassortantH9N2viruses inhumansor swinemay result in the 3145

selection of virus variants with a transmission efficiency close to that of the 3146

mammalianadaptedinfluenzaviruses. 3147

Page 126: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter5

115

GenetictraitsthatinfluencetheadaptationofavianH9N2influenzavirusestopigs 3148

InfluenzaAvirusadaptationtoanewhostrelieson2mainmechanisms:aamutations 3149

andgeneticreassortment.Sincethemid1990s,fewkeypointaminoacids(i.e.aa190, 3150

225,226and228intheHARBSoraa627and701inthePB2proteingenes)havebeen 3151

identified as important geneticmarkers for AIVs to achieve adaptation tomammals 3152

(Subbarao et al., 1993, Connor et al., 1994, Vines et al., 1998, Glaser et al., 2005). 3153

However,theirroleintheadaptationofAIVstopigsremainsuncertain. 3154

Forinstance,theoriginalH9N2strainusedinourexperimentscontainedaleucineat 3155

position 226 of the HA RBS instead of glutamine that is typical for AIVs. This 3156

substitution,whichwasshowntoincreasetheSiaα2,6Galbindingpreferenceinhuman 3157

respiratory cells, has been also associated with higher replication rates and 3158

transmissibility of H3, H5, H7 and H9 subtype viruses in pigs and ferrets (Wan and 3159

Perez,2007,Wanetal.,2008,Herfstetal.,2012,VanPouckeetal.,2013,Liuetal., 3160

2014).Thus,thepresenceofthismutationinouroriginalviruswassupposedtobean 3161

adaptationadvantage.However,inourexperimentsthissubstitutiondidnotresultin 3162

enhancedvirus replicationandtropismwhencomparedto thatofH5N2AIVs,which 3163

didnothaveleucine,inpigs(DeVleeschauweretal.,2009b).Thus,ourdataquestion 3164

theroleoftheHA-Q226LsubstitutioninreplicationefficiencyofH9N2virusesinpigs. 3165

Thisisconsistentwithotherstudies,whichshowthatresidue226inHARBSwasnot 3166

strictlydeterminativeforthereplicationofH9N2virusesinpigsorferrets(TheSJCEIRS 3167

H9WorkingGroup,2013).AlthoughcomparativestudieswithHA-226LandHA-226Q 3168

would be required to evaluate the effect of the HA-Q226L substitution in pigs, our 3169

results show that the adaptation process of H9N2 viruses to pigs is much more 3170

complexthantheacquisitionofasinglepointmutationintheHARBS. 3171

During the pig passages with the wholly avian H9N2 virus, we observed a new aa 3172

substitution, which was related with a broader tissue tropism and increased 3173

transmission. In addition, we demonstrated that upper and lower respiratory tract 3174

selectedfordifferentvirusvariants.Similarfindingsweremadeinferrets(Lakdawala 3175

etal.2015)andtheymaybeduetothedifferentreceptordistributionpresentinthe 3176

lungscomparedtotheupperrespiratorytract(VanPouckeetal.,2010,Trebbienetal., 3177

2011). During the serial passages with the reassortant virus (Chapter 4), we also 3178

observed the emergence of new substitutions. Only 1 out of the 19 mutations 3179

Page 127: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Generaldiscussion

116

described in both experiment, the HA-D225G substitution, was common to both 3180

experiments.ThissubstitutionislocatedintheHAreceptorbindingsiteandisknown 3181

toresultinadifferenceintheHARBSsurfacestructure,seeFigure2.Furthermore,the 3182

interactionoftheaaontheRBSwiththeSiareceptorisdependentonelectriccharges 3183

andthismutationresultsinthesubstitutionofanegativecharged(asparticacid)aaby 3184

anunchargedone (glycine). Thus, itmayaffect the interactionof the viruswith Sia. 3185

However,asdemonstratedinChapter3,thismutationwasmaintainedwhenthevirus 3186

wasprogressivelygettinglostduringtheserialpassages.Interestingly,all47swineand 3187

12 human H9N2 field isolates available in GenBank also showed this HA-D225G 3188

mutation,whileHA-Q226Lwaslackinginsomeofthem(seeTable3). 3189

3190

Table 1.Numberof swine andhumanH9N2 field isolates available inGenBank that 3191containtheHA-D225Gand/ortheHA-Q226Lsubstitutions. 3192 3193

H9N2virus

isolatedfrom

Numberofisolateswith…substitution

D225G Q226L

Humans(n=17) 17/17(100%) 14/17(82%)

Pigs(n=42) 42/42(100%) 25/42(60%)

3194

The HA-D225G substitution has been previously described in the literature as an 3195

important host specificity marker in H1 viruses (Taubenberger and Kash, 2010, 3196

Romero-Tejeda and Capua, 2013, Richard et al., 2014). In 1918 and 2009 H1N1 3197

pandemic viruses, this substitution has been associated with increased Siaα2,3Gal 3198

tropism conferring those viruses dual Siaα2,6Gal and Siaα2,3Gal receptor binding 3199

affinity(Tumpeyetal.,2007,Belseretal.,2011,Lakdawalaetal.,2015).Inpigsandin 3200

humansSiaα2,3Galreceptorsarepredominantlyfoundinthelungs(VanPouckeetal., 3201

2010). The emergence of this mutation could therefore explain the enhanced virus 3202

replication in the lungs. However, in vitro sialylglycoprotein binding assays H9N2 3203

viruses containing HA-225G and HA-226L, showed only slightly increased Siaα2,6Gal 3204

binding affinity (Matrosovich et al., 2001, Lakdawala et al., 2015). In addition, this 3205

substitution has never been described as an in vivoadaptationmarker of other AIV 3206

subtypessuchasH5,H7orH9(Sorrelletal.,2009,Herfstetal.,2012,Liuetal,2014). 3207

Thoughourdata suggest that theHA-D225Gsubstitution isan importantmarker for 3208

Page 128: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter5

117

adaptation ofH9N2 viruses to pigs, further lectin-binding analysiswill be needed to 3209

confirmtheimportanceofthismutationforthereceptor-bindingaffinity. 3210

3211

3212

3213

Figure2.Comparisonofthesurfacerepresentationofthereceptor-bindingsiteinthe 3214HA1 monotrimer of: (A) A/quail/Hong Kong/G1/1997 (H9N2) virus before serial 3215passagingcontainingD225andL226,and (B) thesamevirusafter4passages inpigs 3216containingG225andL226.Inbothfiguresaa225and226arehighlightedinmagenta 3217andorangerespectively.Thearrowpointstothedifferent3drepresentationproduced 3218bythesubstitutionintheaa225. 3219 3220

Thesecondmechanismofadaptationisthereassortmentofgenesegmentsbetween2 3221

(ormore) different influenza viruses that co-infect the same cell. Thismechanism is 3222

more drastic but genetic reassortment involving AIVs has been involved in the 3223

generationofmostendemicinfluenzavirusesinpigsandhumans.Actually,theH3N2 3224

andH1N2SIVthatareendemic inEuropeanpigsandtheH1N1,H3N2andH1N2SIV 3225

that circulated in North America between 1998 and 2009 were generated by 3226

reassortment of avian, and human viruses. In humans, H2N2 and H3N2 pandemic 3227

viruses were also reassortants containing avian-origin surface genes combined with 3228

internalgenesofhuman-adaptedviruses.Furthermore,the2009pandemicH1N1virus 3229

was a reassortant containing avian, human and swine-origin genes. Its particular 3230

internalgenecassettebecameefficientlyadapted topigsandhumansandhasbeen 3231

describedtoenhancehumantransmissionofotherAIVssuchasH5,and/orH9(Mehle 3232

andDoudna,2009,Kimbleetal.,2011,Lakdawalaetal.,2011,Sunetal.,2011,Imaiet 3233

al.,2012,Zhangetal.,2012,Abenteetal.,2016).Ourexperimentsconfirmedprevious 3234

reportsand,besidestheNPprotein-gene,wedemonstratedthatpH1N1internalgenes 3235

A BA

Page 129: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Generaldiscussion

118

were selected upon adaptation to pigs. After 7 passages the reassortant virus was 3236

transmitted at higher rates to 4 our out of 6 contact-pigs. Those transmission rates 3237

werehigherwhen compared tootherAIVsbutwere still not at the level of pH1N1, 3238

which transmitted to 6 out of 6 contact-pigs. To elucidate the reason why the 3239

reassortant H9N2 virus was not transmitted to all the direct-contact pigs, genetic 3240

analysis of the viruses isolated from the transmission experiments should be 3241

performed. In addition, a subsequent transmission experiment performed with the 3242

virus excreted from the direct-contact pigs may result in transmission to all direct- 3243

contact animals. Thiswould be in agreementwith theH5N1 adaptation experiment 3244

performed byHerfst and colleagues inwhich they obtained efficient ferret-to-ferret 3245

transmission after 10 serial passages and 3 transmission experiments (Herfst et al., 3246

2012) 3247

3248

Conclusionsandimplications 3249

• SerialpassagesofanavianH9N2influenzavirusinpigsresultedinanenhanced 3250

virus replication and transmission. However, it was less efficient when 3251

compared to theendemic swine influenza viruses. This is consistentwith the 3252

naturalscenarioinwhichavianH9N2virusesarerecurrentlyisolatedfrompigs 3253

butneverbecameestablishedinswinepopulations.Similarly, inexperimental 3254

studies in ferrets efficient droplet transmission was only obtained upon 3255

reassortmentwithmammalianadaptedstrains. 3256

• The combination of pH1N1 internal genes and serial pig passages enhanced 3257

H9N2virusreplicationinandtransmissionbetweenpigs. 3258

• TheHA-D225Gsubstitutionemergedinbothexperimentalset-ups.Itispresent 3259

intheRBSoftheHA.Thus,itthatmayhaveanimportantroleintheadaptation 3260

of avian H9N2 to pigs. Nevertheless, further research will be needed to 3261

elucidatetheexactroleofthismutation. 3262

• OurstudiesputlightintheadaptationofH9N2topigs,whichisaninteresting 3263

model to evaluateAIVs transmission tomammals.However, up tonowadays 3264

thepH1N1wastheonlyswine-originvirusthatbecameestablishedinhumans. 3265

So far, the ferret is the reference animal model to evaluate the pandemic 3266

threat of influenza viruses. It could be interesting to perform further 3267

Page 130: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter5

119

transmissionexperiments in ferretswiththevirusesgenerated inourstudies. 3268

Ontheotherhand,neitherpigsnorferretsarehumansandferretsseemtobe 3269

moresusceptibletoinfluenzavirusesthananyothermammalianspecies. 3270

• Toconclude,our studies showed thatadaptationofH9N2viruses topigs isa 3271

complexprocessthatinvolvesmutationsinsingleprotein-genesaswellasthe 3272

interactionsbetweenthosegenes. 3273

3274

References: 3275 3276Abente, E. J., Kitikoon, P., Lager, K.M.,Gauger, P. C., Anderson, T. K. et al. (2016). A highly 3277

pathogenic avian influenza virus H5N1 with 2009 pandemic H1N1 internal genes 3278demonstratesincreasedreplicationandtransmissioninpigs.JGenVirol,98,18-30. 3279

3280Belser, J. A., Jayaraman, A., Raman, R., Pappas, C., Zeng, H. et al. (2011). Effect of D222G 3281

mutation in the hemagglutinin protein on receptor binding, pathogenesis and 3282transmissibilityofthe2009pandemicH1N1influenzavirus.PLoSOne,6,e25091. 3283

3284Belser, J. A. and Tumpey, T. (2016). Mammalian experimental models and implications for 3285

understanding zoonotic potential. In: Swayne, D. E. (Ed.)Animal influenza. First ed. John 3286WileyandSons,Ames,Iowa,594-619. 3287

3288Connor, R. J., Kawaoka, Y.,Webster, R. G. and Paulson, J. C. (1994). Receptor specificity in 3289

human,avian,andequineH2andH3influenzavirusisolates.Virology,205,17-23. 3290 3291Deeg,C.M.,Hassan,E.,Mutz,P.,Rheinemann,L.,Gotz,V.etal.(2017).InvivoevasionofMxA 3292

byavianinfluenzavirusesrequireshumansignatureintheviralnucleoprotein.JExpMed. 3293214,5,1239-48. 3294

3295De Vleeschauwer, A., Atanasova, K., Van Borm, S., van den Berg, T., Rasmussen, T. B. et al. 3296

(2009a).ComparativepathogenesisofanavianH5N2andaswineH1N1influenzavirus in 3297pigs.PLoSOne,4,e6662. 3298

3299DeVleeschauwer,A.,VanPoucke,S.,Braeckmans,D.,VanDoorsselaere,J.andVanReeth,K. 3300

(2009b). Efficient transmission of swine-adapted but not wholly avian influenza viruses 3301amongpigsandfrompigstoferrets.JInfectDis,200,1884-92. 3302

3303Glaser,L.,Stevens,J.,Zamarin,D.,Wilson,I.A.,Garcia-Sastre,A.etal.(2005).Asingleamino 3304

acidsubstitutionin1918influenzavirushemagglutininchangesreceptorbindingspecificity. 3305JVirol,79,11533-6. 3306

3307Guo, Y. J., Krauss, S., Senne, D. A., Mo, I. P., Lo, K. S. et al (2000). Characterization of the 3308

pathogenicityofmembersof thenewlyestablishedH9N2 influenzavirus lineages inAsia. 3309Virology,267,279-88. 3310

3311Herfst, S., Schrauwen, E. J., Linster, M., Chutinimitkul, S., deWit, E. et al. (2012). Airborne 3312

transmissionofinfluenzaA/H5N1virusbetweenferrets.Science,336,1534-41. 3313 3314

Page 131: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Generaldiscussion

120

Imai,M.,Watanabe,T.,Hatta,M.,Das,S.C.,Ozawa,M.etal.(2012).Experimentaladaptation 3315of an influenza H5 HA confers respiratory droplet transmission to a reassortant H5 3316HA/H1N1virusinferrets.Nature,486,420-8. 3317

3318Kida,H., Ito,T., Yasuda, J., Shimizu,Y., Itakura,C.etal. (1994).Potential for transmissionof 3319

avianinfluenzavirusestopigs.JGenVirol,75(Pt9),2183-8. 3320 3321Kimble,J.B.,Sorrell,E.,Shao,H.,Martin,P.L.andPerez,D.R.(2011).CompatibilityofH9N2 3322

avianinfluenzasurfacegenesand2009pandemicH1N1internalgenesfortransmissionin 3323theferretmodel.ProcNatlAcadSciUSA,108,12084-8. 3324

3325Lakdawala, S. S., Lamirande, E.W., Suguitan,A. L., Jr.,Wang,W., Santos, C. P. et al. (2011). 3326

Eurasian-origin gene segments contribute to the transmissibility, aerosol release, and 3327morphologyofthe2009pandemicH1N1influenzavirus.PLoSPathog,7,e1002443. 3328

3329Lakdawala,S.S., Jayaraman,A.,Halpin,R.A., Lamirande,E.W.,Shih,A.R.etal. (2015).The 3330

soft palate is an important site of adaptation for transmissible influenza viruses.Nature, 3331526,122-5. 3332

3333Liu,Q.,Zhou,B.,Ma,W.,Bawa,B.,Ma,J.etal.(2014).AnalysisofrecombinantH7N9wild-type 3334

and mutant viruses in pigs shows that the Q226L mutation in HA is important for 3335transmission.JVirol,88,8153-65. 3336

3337Matrosovich, M. N., Krauss, S. and Webster, R. G. (2001). H9N2 influenza A viruses from 3338

poultryinAsiahavehumanvirus-likereceptorspecificity.Virology,281,156-62. 3339 3340Mehle,A.andDoudna,J.A.(2009).Adaptivestrategiesofthe influenzaviruspolymerasefor 3341

replicationinhumans.ProcNatlAcadSciUSA,106,21312-6. 3342 3343Moncla,L.H.,Zhong,G.,Nelson,C.W.,Dinis,J.M.,Mutschler,J.etal(2016).Selective 3344

BottlenecksShapeEvolutionaryPathwaysTakenduringMammalianAdaptationofa1918- 3345likeAvianInfluenzaVirus.CellHostMicrobe,19,169-80. 3346

3347Obadan, A. O., Kimble, B. J., Rajao, D., Lager, K., Santos, J. J. et al. (2015). Replication and 3348

transmission of mammalian-adapted H9 subtype influenza virus in pigs and quail. J Gen 3349Virol,96,2511-21. 3350

3351Qiao,C.,Liu,Q.,Bawa,B.,Shen,H.,Qi,W.etal. (2012).Pathogenicityandtransmissibilityof 3352

reassortant H9 influenza viruses with genes from pandemic H1N1 virus. J Gen Virol, 93, 33532337-45. 3354

3355Rajao,D.,Walia,R.,Gauger,P.,Janas-Martindale,A.,Killian,M.L.etal.(2016).Reassortment 3356

betweenswineH3N2and2009pandemicH1N1generateddiversegeneticconstellationsin 3357influenza viruses circulating in United States pigs. In: 24th International Pig Veterinary 3358SocietyCongress.P157,Dublin. 3359

3360Romero-Tejeda, A. and Capua, I. (2013). Virus-specific factors associated with zoonotic and 3361

pandemicpotential.InfluenzaOtherRespirViruses,7Suppl2,4-14. 3362 3363Sang,X.,Wang,A.,Ding,J.,Kong,H.,Gao,X.etal. (2015).AdaptationofH9N2AIV inguinea 3364

pigs enables efficient transmission by direct contact and inefficient transmission by 3365respiratorydroplets.SciRep,5,15928. 3366

Page 132: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter5

121

3367Shichinohe, S., Okamatsu,M., Sakoda, Y. & Kida, H. (2013). Selection of H3 avian influenza 3368

viruseswithSAalpha2,6Galreceptorspecificityinpigs.Virology,444,404-8. 3369 3370Sorrell, E. M., Wan, H., Araya, Y., Song, H. and Perez, D. R. (2009). Minimal molecular 3371

constraintsforrespiratorydroplettransmissionofanavian-humanH9N2influenzaAvirus. 3372ProcNatlAcadSciUSA,106,7565-70. 3373

3374Subbarao,E.K.,London,W.andMurphy,B.R.(1993).AsingleaminoacidinthePB2geneof 3375

influenzaAvirusisadeterminantofhostrange.JVirol,67,1761-4. 3376 3377Sun,Y.,Pu,J.,Jiang,Z.,Guan,T.,Xia,Y.etal.(2010).Genotypicevolutionandantigenicdriftof 3378

H9N2influenzavirusesinChinafrom1994to2008.VetMicrobiol,146,215-25. 3379 3380Sun,Y.,Qin,K.,Wang,J.,Pu,J.,Tang,Q.etal.(2011).Highgeneticcompatibilityandincreased 3381

pathogenicityofreassortantsderivedfromavianH9N2andpandemicH1N1/2009influenza 3382viruses.ProcNatlAcadSciUSA,108,4164-9. 3383

3384Sun,Y.andLiu,J.(2015).H9N2influenzavirusinChina:acauseofconcern.ProteinCell,6,18- 3385

25. 3386 3387Taubenberger, J. K. and Kash, J. C. (2010). Influenza virus evolution, host adaptation, and 3388

pandemicformation.CellHostMicrobe,7,440-51. 3389 3390TheSJCEIRSH9WorkingGroup (2013).Assessing the fitnessofdistinct cladesof influenzaA 3391

(H9N2)viruses.EmergMicrobesInfect,2,e75. 3392 3393Trebbien, R., Larsen, L. E. and Viuff, B. M. (2011). Distribution of sialic acid receptors and 3394

influenzaAvirusofavianandswineorigininexperimentallyinfectedpigs.VirolJ,8,434. 3395 3396Tumpey, T.M.,Maines, T. R., VanHoeven,N.,Glaser, L., Solorzano,A. et al. (2007).A two- 3397

aminoacidchangeinthehemagglutininofthe1918influenzavirusabolishestransmission. 3398Science,315,655-9. 3399

3400Van Poucke, S. G., Nicholls, J.M., Nauwynck, H. J. and Van Reeth, K. (2010). Replication of 3401

avian, humanand swine influenza viruses in porcine respiratory explants and association 3402withsialicaciddistribution.VirolJ,7,38. 3403

3404VanPoucke,S.,Uhlendorff,J.,Wang,Z.,Billiau,V.,Nicholls,J.etal.(2013).Effectofreceptor 3405

specificity of A/Hong Kong/1/68 (H3N2) influenza virus variants on replication and 3406transmissioninpigs.InfluenzaOtherRespirViruses,7,151-9. 3407

3408Varble,A.,Albrecht,R.A.,Backes, S.,Crumiller,M.,Bouvier,N.M.etal. (2014). InfluenzaA 3409

virustransmissionbottlenecksaredefinedby infectionrouteandrecipienthost.CellHost 3410Microbe,16,691-700. 3411

3412Vines,A.,Wells,K.,Matrosovich,M.,Castrucci,M.R.,Ito,T.etal.(1998).Theroleofinfluenza 3413

A virus hemagglutinin residues 226 and 228 in receptor specificity and host range 3414restriction.JVirol,72,7626-31. 3415

3416

Page 133: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Generaldiscussion

122

Wan, H. and Perez, D. R. (2007). Amino acid 226 in the hemagglutinin of H9N2 influenza 3417virusesdeterminescelltropismandreplicationinhumanairwayepithelialcells.JVirol,81, 34185181-91. 3419

3420Wan,H.,Sorrell,E.M.,Song,H.,Hossain,M.J.,Ramirez-Nieto,G.etal.(2008).Replicationand 3421

transmissionofH9N2 influenza viruses in ferrets: evaluationof pandemicpotential.PLoS 3422One,3,e2923. 3423

3424Wang, J.,Wu,M.,Hong,W.,Fan,X.,Chen,R.etal. (2016). InfectivityandTransmissibilityof 3425

AvianH9N2InfluenzaVirusesinPigs.JVirol,90(7),3506-14. 3426 3427Watson, S. J., Langat, P., Reid, S. M., Lam, T. T., Cotten, M. et al. (2015). Molecular 3428

epidemiologyandevolutionofinfluenzavirusescirculatingwithinEuropeanswinebetween 34292009and2013.JVirol,89,9920-31. 3430

3431Wilker,P.R.,Dinis,J.M.,Starrett,G.,Imai,M.,Hatta,M.etal(2013).Selectionon 3432

haemagglutininimposesabottleneckduringmammaliantransmissionofreassortantH5N1 3433influenzaviruses.NatCommun,4,2636. 3434

3435Yu,H.,Zhou,Y.J.,Li,G.X.,Ma,J.H.,Yan,L.P.etal.(2011).GeneticdiversityofH9N2influenza 3436

virusesfrompigsinChina:apotentialthreattohumanhealth?VetMicrobiol,149,254-61. 3437 3438Zaraket, H., Baranovich, T., Kaplan, B. S., Carter, R., Song, M. S. et al. (2015). Mammalian 3439

adaptation of influenza A(H7N9) virus is limited by a narrow genetic bottleneck. Nat 3440Commun,6,6553. 3441

3442Zhang, Y., Zhang, Q., Gao, Y., He, X., Kong, H. et al. (2012). Key molecular factors in 3443

hemagglutinin and PB2 contribute to efficient transmission of the 2009 H1N1 pandemic 3444influenzavirus.JVirol,86,9666-74. 3445

3446Zhu, H., Wang, D., Kelvin, D. J., Li, L., Zheng, Z. et al. (2013). Infectivity, transmission, and 3447

pathologyofhuman-isolatedH7N9influenzavirusinferretsandpigs.Science,341,183-6. 3448 3449

Page 134: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

123

3450

SUMMARY-SAMENVATTING 34516

Page 135: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Summary-samenvatting

124

Summary 3452

Avian H9N2 influenza viruses with enhanced human receptor-binding affinity have 3453

been recurrently isolated frompigs andhumans since1998. This isolation increased 3454

theirpublichealthconcern.In2009,theemergenceofthe2009pandemicH1N1virus 3455

in swine put the scope on swine as host where novel pandemic viruses could be 3456

generated. The hypothesis that swinemay play a role as intermediate hosts and/or 3457

“mixingvessels”inwhichAIVsmayadapttomammalsincreasingtheirpotentialthreat 3458

togeneratenovelpandemicswasenunciatedmorethan20yearsago.However,ithas 3459

neverbeenprovedandthereareargumentsforandagainstit. 3460

3461

In Chapter 1, a general introduction to influenza A virus taxonomy, structure, 3462

replicationcycleandvirusevolutionisgiven.Inthesecondsectiontheepidemiologyof 3463

avian, human and swine influenza viruses is summarized. The third and the fourth 3464

sectionsdepictthemolecularmechanismsthatdrivethehostrangerestrictionandthe 3465

avianviruseswithhigherpandemicpotential.Later,thefifthandsixthsectionspresent 3466

asummaryofthehypothesizedroleofthepigintheadaptationofAIVstomammals 3467

andtheuseofthepigasresearchmodel. 3468

3469

Chapter2outlinestheaimsofthethesis.ThefirstaimwastoadaptanentireH9N2 3470

AIV to pigs and to contribute to the general understanding of the mechanisms of 3471

adaptationof theAIVs tomammals.Moreover,our secondaimwas toevaluate the 3472

impactofreassortingthepH1N1backbonewithH9N2AIVonreplicationcapacityand 3473

transmissioninpigs. 3474

3475

Chapter3dealswiththeadaptationofanentireavianH9N2virustopigsbyserialbind 3476

passages. In this chapter,we characterized virus replication in theentire respiratory 3477

tractduringallpassagesandweselectedthebestreplicatingvirustoperformadirect 3478

contact transmission experiment to evaluate if the better performance during the 3479

passages is also correlated with enhanced transmissibility. We also compared 3480

genetically the original material with the virus selected for the transmission 3481

experiment. The original H9N2 virus caused a productive infection in pigs with a 3482

predominant tropism for the nasal mucosa. In contrast, after 4 passages the virus 3483

Page 136: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter6

125

replicated in the entire respiratory tract. Subsequent passageswere associatedwith 3484

reducedvirusreplicationinthelungsandinfectiousviruswaslostatpassage10. The 3485

broader tissue tropism after 4 passages was associatedwith an amino acid residue 3486

substitutionatposition225,withinthereceptor-bindingsiteofthehemagglutinin. In 3487

the direct contact transmission experiment, the passage 4 virus showed enhanced 3488

transmission when compared to the original virus. Nevertheless, it was significantly 3489

lower when compared to that of the pH1N1. Our data demonstrate that serial 3490

passagingofH9N2virusinpigsenhancesitsreplicationandtransmissibility.However, 3491

fulladaptationofanavianH9N2virustopigslikelyrequiresamoredrasticapproach. 3492

3493

InChapter4theeffectofthereassortmentwithpH1N1internalgenescombinedwith 3494

the serial passaging in pigs was examined. In this chapter, we repeated the 3495

experimentalsetupdescribedinChapter3buttheoriginalavianviruswassubstituted 3496

by a reassortant virus containing H9N2 HA and NA protein-genes in the pH1N1 3497

backbone. The aimof this experimentwas to evaluate if the introduction of pH1N1 3498

internal genes offered an advantage for adaptation of H9N2 AIVs in pigs. The viral 3499

replication was increased in contrast to that of the original avian H9N2 virus after 3500

serialpassages.Furthermore,itdidnotloseitsreplicationcapacityafter10passagesin 3501

pigs in comparison to the original avian H9N2 virus. We selected the virus after 7 3502

passages to perform the direct-contact transmission experiment. This virus was 3503

excretedby4outof6animalsat similar rateswhencompared topH1N1.However, 3504

thegeneticanalysisrevealedthattheoriginalviruswascontaminatedandtheinternal 3505

genespresent in theoriginal stockcontainedamixtureofH9N2andpH1N1 internal 3506

genes. Interestingly the serial passaging selected for pH1N1 internal genes and in 3507

passage 7 virus only NP-coding genewas completely of H9N2-origin. The passage 7 3508

virus also contained the HA-D225G substitution described in Chapter 3. Our data 3509

demonstrate that serial passaging of a reassortant H9N2 virus in pigs selected the 3510

samemutationastheoneselectedbythesameexperimentalset-upperformedwith 3511

thewhollyavianvirus.However,itshowsthatadaptationtopigsisacomplexprocess 3512

thatmayrequirethecombinationofreassortmentwithpointmutations. 3513

3514

Page 137: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Summary-samenvatting

126

In Chapter 5, the experimental studies are discussed. In general, our studies 3515

demonstratedthattheadaptationofAIVstopigsisaverycomplexprocessthatneeds 3516

drasticgeneticchangestobeachieved.AdaptationofavianH9N2tomammalscanbe 3517

achievedbythecombinationof reassortmentwithefficientlyadapted internalgenes 3518

andserialpassages.However, it remainsquestionablewhether the resultsdescribed 3519

are extrapolatable to other strains or subtypes and to the possible adaptation to 3520

humans. By setting-up that experimental model we have generated the basis to 3521

generatebetteradaptedvirusandgeneticallycharacterizetheminordertoputlightin 3522

theunderstandingoftheadaptationprocessofAIVs. 3523

3524

Page 138: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter6

127

Samenvatting 3525

Aviaire H9N2-influenzavirussen met verhoogde bindingsaffiniteit voor de menselijke 3526

receptor werden sinds 1998 herhaaldelijk geïsoleerd uit varkens en mensen. Hun 3527

vondstbrengt een verhoogde risico voorde volksgezondheidmet zichmee. In 2009 3528

benadruktedeopkomstvanhetpandemischH1N1-virusuit2009(pH1N1)bijvarkens 3529

het belang van varkens als gastheer waarin nieuwe pandemische virussen zouden 3530

kunnen ontstaan. De hypothese dat varkens een rol kunnen spelen als 3531

tussengastheren en/of "mengvaten" waarin aviaire influenzavirussen (AIV's) zich 3532

kunnenaanpassenaanzoogdierenenzoeenverhoogdepotentiëlebedreigingvormen 3533

voor het ontstaan van nieuwe pandemieën, werd meer dan twintig jaar geleden 3534

geformuleerd. Ditwerd echter nooit bewezen en er zijn argumenten voor en tegen 3535

dezehypothese. 3536

3537

Inhoofdstuk1wordteenalgemeneintroductiegegevenoverdetaxonomie,structuur, 3538

replicatiecyclus en virusontwikkeling van influenza A-virussen. In de tweede sectie 3539

wordtdeepidemiologievanaviaire,humaneenvarkensinfluenzavirussensamengevat. 3540

De derde en de vierde sectie duiden de moleculaire mechanismen die het 3541

gastheerbereik beperken en beschrijven de aviaire virussen met een hoger 3542

pandemisch potentieel. Vervolgens wordt in de vijfde en zesde sectie een 3543

samenvattinggegevenvandeveronderstelderolvanhetvarkenindeaanpassingvan 3544

AIV's aan zoogdieren en van het gebruik van varkens alsmodel voor het onderzoek 3545

naardezeadaptatie. 3546

3547

Hoofdstuk2schetstdedoelstellingenvanhetproefschrift.Hethoofddoelwasomeen 3548

H9N2AIVaantepassenaanvarkensenombijtedragenaanhetalgemenebegripvan 3549

demechanismenvanaanpassingvandeAIV'saanzoogdieren. 3550

3551

Hoofdstuk3behandeltdeaanpassingvaneenvolledigaviairH9N2-virusaanvarkens 3552

dooropeenvolgendeblindepassages.Indithoofdstukhebbenwedevirusreplicatiein 3553

hethelerespiratoirekanaalgekarakteriseerdtijdensallepassagesenhebbenwehet 3554

best aangepaste virus geselecteerd voor het uitvoeren van een direct-contact 3555

transmissie-experiment om te evalueren of de betere prestaties tijdens de passages 3556

Page 139: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Summary-samenvatting

128

ook gecorreleerd zijnmet verhoogde overdraagbaarheid.We hebben ook genetisch 3557

het startmateriaal vergeleken met het virus dat geselecteerd werd voor het 3558

transmissie-experiment.HetoorspronkelijkeH9N2-virusveroorzaakteeenproductieve 3559

infectiebijvarkensmeteenoverheersendtropismevoordeneusslijmvliezen.Navier 3560

passages repliceerdehetvirusdaarentegen inhethele respiratoirekanaal.Volgende 3561

passageswerdengeassocieerdmetgereduceerdevirusreplicatie inde longenenhet 3562

besmettelijkevirusgingverlorenbijpassagetien.Hetuitgebreiderweefseltropismena 3563

vierpassageswerdgeassocieerdmeteenaminozuursubstitutieoppositie225binnen 3564

de receptorbindingsplaats op het hemagglutinine. In het direct-contact transmissie- 3565

experimentvertoondehetvirusvanpassagevierverbeterdetransmissieinvergelijking 3566

met het oorspronkelijke virus. Desondanks was uitscheiding significant lager in 3567

vergelijkingmet die van pH1N1. Onze gegevens tonen aan dat seriële passages van 3568

H9N2-virusbijvarkensdereplicatieenoverdraagbaarheidverbetert.Echter,volledige 3569

aanpassing van een aviair H9N2-virus aan varkens vereist waarschijnlijk een 3570

drastischereaanpak. 3571

3572

Inhoofdstuk4werdheteffect van reassorteringvandeaviaire influenzaH9N2met 3573

internegenenvanpH1N1opdereplicatiecapaciteitinvarkensonderzochtdoormiddel 3574

van seriële passages. In dit hoofdstuk herhaalden we de proefopzet beschreven in 3575

hoofdstuk 3, maar het oorspronkelijke virus werd vervangen door een reassortant 3576

virusdatdeHA-enNA-eiwitgenenvanhetH9N2-virusende internegenenvanhet 3577

pH1N1-virus bevat. De bedoeling van dit experiment was om te evalueren of de 3578

introductievanpH1N1internegeneneenvoordeelbetekendevoordeaanpassingvan 3579

H9N2AIV's aan varkens.Dit virus presteerdebeter danhet oorspronkelijke virus na 3580

tienpassageswerdnogsteedsinfectieusvirusgedetecteerd.Wehebbenhetvirusna 3581

zeven passages geselecteerd om een direct-contact transmissie experiment uit te 3582

voeren.Dit viruswerd uitgescheidendoor vier van de zes dieren aan hoeveelheden 3583

vergelijkbaarmet deze voor pH1N1. Echter, uit de genetische analyse bleek dat het 3584

oorspronkelijke virus gecontamineerd was en dat de interne genen aanwezig in de 3585

oorspronkelijke stock een mengsel van H9N2 en pH1N1 interne genen bevatte. 3586

InteressantisdatdeseriëlepassagesselecteerdenvoorpH1N1internegeneneninhet 3587

virusvanpassagezevenwasenkelhetNP-coderendgenvolledigvanH9N2-oorsprong. 3588

Page 140: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter6

129

Het virus van passage zeven bevat ook de substitutie HA-D225G beschreven in 3589

hoofdstuk 3. Onze gegevens tonen aan dat opeenvolgende passages van een 3590

reassortant H9N2-virus bij varkens dezelfde mutatie geselecteerd heeft als die 3591

geselecteerd door dezelfde experimentele opstelling uitgevoerd met het volledig 3592

aviairevirus.Hetblijktechterdataanpassingaanvarkenseencomplexproces isdat 3593

mogelijkdecombinatievanreassorteringmetpuntmutatiesvereist. 3594

3595

In hoofdstuk 5 worden de experimentele studies besproken. Over het algemeen 3596

hebben onze studies aangetoond dat de aanpassing vanAIV's aan varkens een zeer 3597

complex proces is dat drastische genetische veranderingen vereist. Aanpassing van 3598

aviairH9N2aanzoogdierenkanwordenbereiktdoordecombinatievanreassortering 3599

metefficiëntaangepasteinternegenenenseriëlepassages.Echter,hetblijftonzeker 3600

of de resultaten die hier beschreven worden geëxtrapoleerd kunnen worden naar 3601

andere stammenof subtypesennaardemogelijke adaptatie aanmensen.Doorhet 3602

experimentelemodelop tezetten,hebbenwedebasisgelegdombeteraangepaste 3603

virussen tegenererenenomdezevirussengenetisch tekarakteriseren,metalsdoel 3604

lichttewerpenophetbegrijpenvanhetadaptatieprocesvanAIV’s. 3605

3606

Page 141: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

3607

3608

3609

Page 142: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

131

3610

CURRICULUMVITAE 36117

Page 143: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

CurriculumVitae

132

Personalia 3612JoseCarlosManceraGraciawasborninZaragoza,SpainonJanuary111986.In2004 3613

hecompletedhissecondaryeducationattheInstitutoPabloGargalloinZaragozaand 3614

started the study of veterinary medicine at the Faculty of Veterinary Medicine, 3615

ZaragozaUniversity,fromwhichhegraduatedin2011.InAugust2011hewasgranted 3616

withaLeonardodaVincischolarshipandhestartedaninternshipattheNutrecoB.V. 3617

Swine Research Centre in Boxmeer (theNetherlands). In September 2012 he joined 3618

theLaboratoryofVirology,FacultyofVeterinaryMedicine,GhentUniversitywherehe 3619

studied the possibilities of adaptation of avian H9N2 influenza viruses to swine. His 3620

PhD studieswere funded by the European Commission FLUPIG FP7 project (FP7-GA 3621

258084). 3622

3623

Publications 3624

Publicationsininternationalscientificpeer-reviewedjournals 3625

ManceraGracia, J. C., Van denHoecke, S., Richt, J. A.,Ma,W., Saelens, X. and Van 3626

Reeth,K.(2017).AreassortantH9N2influenzaviruscontaining2009pandemicH1N1 3627

internal-proteingenesacquiredenhancedpig-to-pigtransmissionafterserialpassages 3628

inswine.Scientificreports,7,1323. 3629

3630

VanReeth,K.,ManceraGracia,J.C.,Trus,I.,Sys,L.,Claes,G.,Versnaeyen,H.,Cox,E., 3631

Krammer, F., Qiu, Y. (2017). Hetereologous prime-boost vaccination with H3N2 3632

influenza viruses of swine favors cross-clade antibody responses and protection.npj 3633

Vaccines,2,11. 3634

3635

ManceraGracia,J.C.,VandenHoecke,S.,Saelens,X.andVanReeth,K.(2017).Effect 3636

of serial pig passages on the adaptation of an avian H9N2 influenza virus to swine. 3637

PLoSOne,12,e0175267. 3638

3639

Conferenceabstracts 3640

Mancera Gracia, J. C. and Van Reeth, K. (2016). Could avian H9N2 influenza viruses 3641

becomeathreattoswine?:lessonsfromexperimentalstudiesinthepig.Proceedings 3642

ofthe24thIPVSCongress,Dublin,Ireland,p.158. 3643

Page 144: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter7

133

ManceraGracia,J.C.andVanReeth,K.(2015).Enhancedpig-to-pigtransmissionofa 3644

reassortant H9N2 influenza virus containing 2009 pandemic H1N1 internal genes by 3645

serial passaging in pigs. Third annual meeting of the Belgian Society for Virology, 3646

Brussels,Belgium. 3647

3648

ManceraGracia, J.C.andVanReeth,K. (2015).Aroleforswine intheadaptationof 3649

avian H9N2 influenza viruses to humans?: lessons from serial passages and 3650

transmissionstudiesinpigs.ProceedingsoftheOxfordInfluenzaConference,Influenza 3651

2015:oneinfluenza,oneworld,onehealth,Oxford,UnitedKingdom. 3652

3653

Qiu,Y.,ManceraGracia,J.C.,Li,Y.,Trus,I.,Nguyen,VanUt.,Cox,E.andVanReeth,K. 3654

(2014). Prior infection of pigs with a European H3N2 SIV confers partial protection 3655

againstaNorthAmerican swine-originH3N2v influenzavirus.The5thESWI influenza 3656

conference,Riga,Latvia,p114. 3657

3658

Qiu,Y.,ManceraGracia,J.C.,Li,Y.,Trus,I.,Nguyen.,VanUt,Cox,EandVanReeth,K. 3659

(2014).Cross-protectionstudiesinpigswiththeEuropeanH3N2swineinfluenzavirus 3660

andtheNorthAmericanswine-originH3N2‘variant’,avirusofpublichealthconcern. 3661

TheannualBelgiumImmunologicalSocietymeeting,Ghent,Belgium,p41. 3662

3663

Qiu, Y., Claes, G., Mancera Gracia, J. C. and Van Reeth, K. (2015). Cross-lineage 3664

antibodyresponsesandprotectionuponvaccinationwithinactivatedswineinfluenza 3665

virus vaccines. 3rd International SymposiumonNeglected InfluenzaViruses, Athens, 3666

USA,p46. 3667

3668

Oralpresentations 3669

Mancera Gracia, J. C. and Van Reeth, K. (2016). Could avian H9N2 influenza viruses 3670

becomeathreattoswine?:lessonsfromexperimentalstudiesinthepig.Proceedings 3671

ofthe24thIPVSCongress,Dublin,Ireland,p.158. 3672

3673

3674

Page 145: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

CurriculumVitae

134

ManceraGracia,J.C.andVanReeth,K.(2015).Enhancedpig-to-pigtransmissionofa 3675

reassortant H9N2 influenza virus containing 2009 pandemic H1N1 internal genes by 3676

serial passaging in pigs. Third annual meeting of the Belgian Society for Virology, 3677

Brussels,Belgium. 3678

3679

ManceraGracia, J.C.andVanReeth,K. (2015).Aroleforswine intheadaptationof 3680

avian H9N2 influenza viruses to humans?: lessons from serial passages and 3681

transmissionstudiesinpigs.ProceedingsoftheOxfordInfluenzaConference,Influenza 3682

2015:oneinfluenza,oneworld,onehealth,Oxford,UnitedKingdom. 3683

3684

Page 146: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

135

3685

AKNOWLEDGEMENTS 36868

Page 147: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Acknowledgements

136

If Iamwriting thesewords it isbecausemyPh.D.degreestudiesare reaching their 3687

end.Atthismoment,Iwouldliketoexpressmysinceregratitudetoallthepeoplewho 3688

accompaniedmeduringthisadventureinFlanders. 3689

My very first thanks go to my promoter Prof. Dr. Kristien Van Reeth. I am really 3690

grateful because you provided me the opportunity to join your research group to 3691

explorethemechanismsofadaptationofavianinfluenzaviruses.Workingunderyour 3692

supervision has been very challenging and allowed me to grow as person and as 3693

researcher.Iwouldalsoliketothankmyco-promoterProf.Dr.XavierSaelens.Thank 3694

youXavierforyoursupportandyourvaluablepointofviewonourresearch. 3695

I highly appreciate the contribution of my Guidance and Examination Committee 3696

members:Prof.Dr.HansNauwynck,Prof.Dr.MikhailMatrosovich,Prof.Dr.Dominiek 3697

Maes, Dr. Karen van derMeulen, Dr. Annebel de Vleeschauwer and Dr. Sebastiaan 3698

Theuns.Thanksforyourtime,interests,andthecarefulreviewofmythesis. 3699

Mydeepestthanksgotoallmycolleaguesatthedepartment,thanksforyourhelpand 3700

your support. Day by day it was very nice toworkwith you. Firstly, I would like to 3701

thank those who left the Lab, Yu, Gerwin, Sjoucke, Amy, Charlie, Kevin, Vishi, Ilias, 3702

Laura,….IwouldalsoliketothankDr.ConstantinosKyriakis,althoughwedidnotmeet 3703

inBelgiumyougavemeverynicetipsaboutpost-PhDlife. 3704

Lieve, Nele and Melanie thanks one thousand times for your patience and your 3705

excellentassistanceintheLab. Ithasbeenapleasuretosharethelaminarflowwith 3706

you,eachdaywasamasterclass.Ofcourse, IwouldalsoliketothankZegerforyour 3707

helpinanimalexperimentsandforthosetripstothefarms.ThanksalsotoGertforhis 3708

valuable help with the administrative work and Dr. Nathalie Vanderheijden for her 3709

helpwiththeprojectissues.IamalsospeciallygratefultoCarolineandAnaforthose 3710

never-endingtalkstryingtofixtheworld.Elien,SharonandAnnaIamhappytohave 3711

metyouandIwishyouthebestforyourfutureresearch. Iwouldalsoliketohavea 3712

wordforDr.SilvieVanDenHoecke,thanksforyourhelpwiththepublicationsandthe 3713

clearexplanationsonthegeneticanalysisoftheviruses. 3714

TambiénquieroagradeceraRobertoBautista,EmilioMagallónylagentedeIngafood. 3715

Vosotrosmemetisteiselgusanillodelporcinoenlacabezaygraciasavosotrostuvela 3716

granoportunidaddedarelsaltoaHolandaparaseguirformándome.Iwouldalsolike 3717

toacknowledgeDr.SandraParedes,HubértvanHees,JanLamersandthepeoplethatI 3718

Page 148: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Chapter7

137

metduringmy timeatBoxmeerbecause theygaveme thevery firstopportunity to 3719

workonresearch.Ireallymissthosegooddays. 3720

AlthoughduringmyPh.D.Iinvestedalotoftimeonresearch,Ialsohadtimetomeet 3721

verynicepeople.Thankstothe“LostinGhent”forthegoodmoments. 3722

To the “Eluners”, that used tomeet every Friday for oneor twoafterworkbeers to 3723

releasethestressoftheweek.Joao,graciasati,aElijayalasniñasporlascervezas, 3724

las catas de vinos, las comilonas con la familia y por ser como sois.Miguelito estoy 3725

muycontentodequehayasvenidodeBrasil sóloparamidefensaJ graciaspor las 3726

nochesenelkaraoke,Lyon,elviajeaBrasilypordescubrirmeelCabraliego.Alfonso, 3727

gracias por tu ayuda siempre que ha hecho falta y por, junto con Evelien,Niklaas y 3728

Fien,hacermesentirpartedevuestrafamilia.Ademásdeporlosbuenosconsejospara 3729

lasentrevistasdetrabajo.Trompi,atiquetevoyadecir,siemprequehetenidouna 3730

dudadecerdos lahasresuelto,conpermisodeAlfonso,eresuncrackysiemprehas 3731

sidoungranreferenteparamí.Además,graciasatiyaVíctorCarreteroporllevarme 3732

devezencuandoa“morir”conlabicicleta. 3733

I would also like to thank Amparo, Minerva, Ana Rafael, Ana (Manu), Michelle, 3734

Gonzalo, Francesco, Mercedes, Alessio, Raffa, Eva, Pedro, Mike, Kevin, Edita, Anna 3735

Kuchmiy,Laura,DomenicoandIamsurethatIforgotsomeone… 3736

Tambiénquierodarlasgraciasamisamigosdel“Insti”:Ari,Lobe,Miri,Perdi,Barneyy 3737

Laura porque 12 años después de nuestra primera visita a Flandes volvisteis a 3738

visitarmeyverquetodoestabaensusitio.AmisamigosRubénGil,Edu,JorgeMaz, 3739

DaniyEnriqueporqueaunqueyallevo5añosfueradeZaragozacadavezqueosveo 3740

escomosinohubierapasadoeltiempoyporelesfuerzoquehacéisporseguirsiendo 3741

misamigos. 3742

Gracias también a mi familia en Gante. Alfonso, Nerea, Dani, Tere y Olga podría 3743

escribirun libroenterodándoos lasgracias,pero lovoyaresumirJ.Graciaspor las 3744

cenas, los viajes, las “Klokkes”, las noches en el video, las risas y las no tan risas. 3745

Durante estos años habéis sido amigos, compañeros de piso, colegas y uno de los 3746

soportesenmiestanciaaquí. 3747

También quiero acordarme demi familia biológica. Demis padres, a vosotros os lo 3748

debotodo.Séquenuncalodigoperosialgunavezsoypadremegustaríaserlamitad 3749

debuenoquevosotros.Demihermana,quesiempreseacuerdaysepreocupapormí, 3750

Page 149: 7 Novel insights in the adaptation of avian H9N2 influenza … · 7 Novel insights in the adaptation of avian H9N2 influenza viruses to swine LABORATORY OF VIROLOGY ... GHENT UNIVERSITY

Acknowledgements  

 138  

de  Jesús  que  lleva  ya  más  de  10  años  siendo  parte  de  los  Mancera  Gracia  y  de  Leyre,  la   3751  

pequeña   de   la   familia   que   es   una   motivación   para   viajar   a   casa   más   a   menudo.   3752  

También  quiero  agradecer  su  apoyo  a  mis  primos  y  tíos.  Especialmente  a  la  tía  Mary,   3753  

que  siempre  está  pendiente  de  que  todos  los  sobrinos  estemos  bien.     3754  

L´ultimo  ma   non  meno   importante   ringraziamento   va   a   Giorgia   Rocatello.   You   have   3755  

been  my  main  support  during  the  last  2  years,  and  since  the  last  year  you  are  dealing   3756  

with  me  every  day.   I  would   like  to  thank  you  for  your  patience,  for  your  support,   for   3757  

your  help  at  any  moment,  but  mostly  for  your  smile  in  the  worst  situations.  As  Antonio   3758  

Flores  would  say:  “Eres  la  flor  que  siempre  quise  en  mi  jardín”.   3759  

  3760  

Gracias/Grazie/Thank  you/Dank  je  wel!!!   3761  

  3762  

José  Carlos  Mancera  Gracia   3763  

Ghent,  30/06/2017   3764  

  3765