5. CHAPTER ITI : Estrogen receptor subtype 0.- p- specificity of SERMs and CDR! 99/373 using recombinant ligand binding

domain of estrogen receptor

Chapter III

5.1. Introduction

Estrogen receptors a (ERa) and ~ (ER~) are ligand-inducible transcription factors

that are involved in regulating cell growth, proliferation, differentiation and homeostasis in

various tissues. The two subtypes ofER differ in size, share modest sequence identity (47 %)

and are encoded by different genes (Enmark et al., 1997; Tremblay et ai., 1997) Ligand

binding domain (LBD), which shares second highest similarity (59%) after DNA binding

domain, is localized in the carboxy-terminal portion of the receptor and is considered to be

sufficient for ligand recognition and ligand-dependent transcriptional activation. The

transcriptional response to hormones or antihormones is rooted in conformational changes

induced by specifically bound ligands. The ligand-binding pockets of the subtypes are

similar, but not identical, ER~ being smaller (390 A3) than ERa (490 A3

) and differing in

two residues from ERa: Leu-384 and Met-421 in ERa are replaced by Met-336 and lle-373,

respectively in ER~ (Pike et ai., 1999) and these two substitutions give rise to the selectivity

of ligands for ERa or ER~. Both receptor subtypes are considered to have a similar affinity

for E2. However, many antiestrogens and phytoestrogens, like genistein, display receptor

selective affinity and biological character (Kuiper et ai., 1997). ERa and ER~ have distinct

functions and differential expression in certain tissues. These differences stimulated the

search for ER subtype-selective ligands. Therapeutically, such ligands offer the potential to

target specific tissues or pathways regulated by one receptor subtype without affecting the

other.

Being associated to a broad spectrum of diseases which includes breast cancer,

prostate cancer, endometrial carcinoma, osteoporosis and leukemia, ERa and ER~ are

considered to comprise a very important class of drug targets (Riggs and Hartmann, 2003).

Many of the ER ligands have formed the basis of the therapy for a number of endocrine

disorders. Raloxifene (Delmas et ai., 1997) and toremifene are therapeutically established

anti-estrogens, available for prevention of osteoporosis and treatment of advanced hormone­

sensitive breast cancer. Tamoxifen (Jordan and Morrow, 1999) is preferrably used for the

treatment of breast carcinoma. Another SERM ormeloxifene is a well known anti-

91

Chapter III

implantation agent (Blesson et aI., 2006) while clomifene serves as fertility inducing agent

(Jimenez et aI., 1997).

Traditional drug discovery programs for ER modulators often involve the use of a

receptor-binding assay as a primary screen to identify high-affinity ligands, followed by the

use of in vitro cell based assays, specifically the transcriptional activation assays with

reporter proteins and animal cell proliferation assays (Joyeux et aI., 1997), to determine the

functional activity of a given ligand (McDonnell, 2006). Relatively newer techniques

employed to study various aspects of receptor ligand interaction include hydrogen/deuterium

exchange, mass spectrometry (Yan et aI., 2006; Dai et aI., 2008), and Fluorescent Resonance

Energy Transfer (FRET) between fluorescent protein-tagged ERs in living cells (Bai and

Giguere, 2003; Kim et aI., 2005; Padron et aI., 2007). Tamrazi et aI., (2003) have

demonstrated the changes in protein dynamics during ER modulation These approaches,

however, are generally complex, time-consuming and expensive, and thus not preferred for

the construction of high-throughput screening systems.

The use of mammalian (Kumar and Chambon, 1988), bacterial, yeast (Metzger et

al., 1988) expression systems, vaccinia virus expression system (Mackett et aI., 1984) and

cell-free in vitro translation systems (Lees et aI., 1989a, 1989b; Kuiper et aI., 1997) in the

production of functional recombinant ERs is very well documented in the literature. Apart

from this, the baculovirus system for expression of heterologous proteins in insect cells is

also known to be employed (Obourn et aI., 1993), which utilizes gene transfer by infection

of host cells with a modified virus that acts as excellent tools for gene delivery.

Nevertheless, the use of viral delivery systems may suffer from lengthy construction time

requiring transfection steps, cloning of producer cell lines to generate virus stocks, stock

amplification and purification. It is well documented that many mechanisms involved in

adenovirus infection such as cell membrane adhesion and entry, viral genome replication,

translation and host inflammatory response modulate several host cell signaling pathways

which therefore may interfere with functional mechanisms in study (Suomalainen et al.,

2001).

The steroid receptors have been notoriously difficult proteins to express at high

levels in all expression systems (Srinivasan, 1992; Mossakowska, 1998). The ligand binding

pockets of ERs as well as the coactivator binding sites on the surface of LBDs have

significant hydrophobic character. As a result, theses receptors are prone to aggregate during

purification. Such proteins tend to be present in inclusion bodies and are not in their native,

functionally active conformation and biologically active proteins have to be recovered from

92

Chapter III

these inclusion bodies by solubilization using detergents in chaotropic buffer systems,

followed by refolding under dilute protein concentration (Clark, 2001). Bacterial expression

systems utilizing multi-copy plasmids and strong, inducible promoters are most useful for

obtaining high yields of recombinant proteins. However the whole nuclear receptor proteins

cannot attain structural modifications required for structural integrity and functional activity

when expressed in prokaryotic system. The modular structure of these receptor allows the

use of LBD as a convenient model for studying the impact that ligand binding exerts upon

protein higher order structure (Hsieh et aI., 2006). Earlier, overexpressed ERLBD proteins

have been utilized to get the insight of the molecular mechanism of the hormone action and

also to deduce the basis of receptor agonism and antagonism (Brzozowski et aI., 1997).

Earlier other investigators have overexpressed the ER LBDs in E.coli and also confinfirmed

its structural integrity by mass spectroscopy as well as by determining the crystal structure of

expressed LBDs (Witkowska et aI., 1997; Eiler et aI., 2001; Nygaard and Harlow, 2001).

Based on these observations, the bacterially expressed LBDs, if obtained in solubilized form,

could be utilized to develop screening method for ER ligands

In the present study, we have overexpressed the LBDs of human ERa and human

ER~ in E. coli expression host and isolated the recombinant proteins in soluble form (-8-10%

of total cell protein) and the method does not require the use of detergent. Here, we have

developed this system as a method of screening with a view to identify the ERa and ERj3

specific ligands. Both the crude protein preparation as well as the purified protein were

assayed for the purpose. This method appears to be extremely useful in accelerating the lead

identification process by simple in vitro binding assays, and may also help to design and

synthesize the isoforms specific molecules, allowing new drugs to be identified more rapidly

and cost effectively.

5.2. Material and methods

Chemicals

All bacterial culture, cell culture and SDS-P AGE reagents were purchased from

Sigma, USA, unless otherwise stated. Anti-his antibody and vectors pET21b and pET28c

were obtained from Novagen, Germany. Gel extraction kit and miniprep kit was obtained

from QIAgen, USA. Reverse transcriptase PCR kit, PCR master mix, Restriction enzymes,

Prestained molecular weight markers and DNA ladders were purchased from Fermentas,

93

Chapter III

USA. Reagents for western blot and Ni2+-NTA chelating sepharose were obtained from GE

healthcare" UK.

Primers were synthesized from GenoSys Bangalore, India

Raloxifene, 1, 3, 5-Tris (4-Hydroxyphenyl)-4-propyl-1H-pyrazole (PPT), 17~­

Estardiol, Progesterone and Tamoxifen were purchased from Sigma, USA. ICI 182, 780 was

purchased from Tocris, Ellisville, MO, USA. Ormeloxifene was synthesized and kindly

provided by the medicinal chemists of C.D.R.I. Lucknow, India.

[2,4,6,7)H] Oestradiol (Specific activity-89 Cilrnmol) were obtained from GE

healthcare (Amersham), UK.

5.2.1. Cloning of the ligand binding domain of the human estrogen receptor a and P in the pET based bacterial expression vector

For the expression of the ligand binding domain (LBD) of human Estrogen receptor

a and ~, bacterial expression vectors pE121b and pE128c respectively were used. Both of

these vectors allow expression of the proteins and add a carboxy terminal 6XHis tag to them.

The cDNA used to amplify ERa was obtained by RT-PCR amplification of total RNA from

MCF-7 cell line. DNA fragment encoding the LBD of ERa (295 aa) or ER~ (288 aa) was

generated by PCR and were sub cloned into the pE121 b plasmid. PCR amplification was

done using the oligonucleotides with sequences 5' ATGGATCCT AAGAAGAACAGCCTG

3' and 5' TGAATTCTCAGACTGTGGCAGGGAA 3', containing BamHI (underlined

nucleotides) restriction site in forward primer and EcoRl site in reverse primer at their 5'

end. PCR parameters were 30 cycles of predenaturation at 95° C for 2 min, denaturation at

94° C for 1 min, annealing at 61 ° C for 30 sec, and extension at 72° C for 2 min; the last

cycle was delayed for 10 min. LBD of ER~ was sub cloned from the plasmid pSG5-ER~

(kindly gifted by Prof. M.G. Parker, Imperial Cancer Research Fund, London, UK),

encoding full length ER~. Specific primers for LBD were used which contained BamHI and

HindIII sites at 5' end in sense and antisense primers respectively for PCR amplification.

The primers used were 5' TAGGATCCGCAAGGCCAAGAGAAG 3' and 5'

GCTAAGCTTTCACTG AGACTGTGG 3'. The PCR conditions used were: 30 cycles of

predenaturation at 95° C for 3 min, denaturation at 94°C for 1 min, annealing at 66° C for 45

sec, and extension at 72° C for 45 sec and the final extension was done for 10 min at 72° C.

Both sets of primers were designed using the software "oligo". The PCR products of 886 bp

94

Chapter III

(ERa-LBD) and 866 bp (ER~LBD) respectively were subsequently visualized by ethidium

bromide staining. Restriction digestion of amplified PCR products of ERa-LBD and ERfJ-

LBD as well as vectors pET21 b and pET28c (Novagen) was done separately. The digested

products were run on 1 % agarose gel and the specific bands were excised and eluted out

from gel using QIAquick PCR purification kit (Qiagen). Digested ERaLBD and ER~LBD

PCR products were then ligated into pE121 b and pE128c vector respectively. All the

digestion and ligation reactions were carried out as per standard protocol (Sambrook 1989).

The resulting constructs were transformed into Escherichia coli DH5a competent cells and

the transformants were plated on luria bertani (LB) agar plates containing 100 Jlg/ml

ampicillin (for ERaLBD-pE121b) or 50 Jlg/ml kannamycin (ER~LBD-pE128c) and

incubated overnight at 37° C. Integrity of inserts was verified by restriction digestion as well

as by sequencing.

5.2.2. Over-expression of ERa-LBD and ERP-LBD

The recombinant plasmids, ERaLBD-pET21b and ERfJLBD-pET28c were sub cloned

into E. coli strains compatible for the T7-based expression plasmids i.e. C41 (DE3), BL21

(DE3) and Rosetta strain. Overnight cultures from a single colony grown at 37° C with

shaking at 180 rpm in Luria Bertani (LB) medium containing 100 Jlg/ml ampicillin

(ERaLBD) or 50J.Lg/ml kannamycin (ER~LBD) was diluted 1:100 into fresh broth and

growth was continued at 37°C with shaking to an A600 of 0.8. The protein was

overexpressed by adding ImM IPTG (isopropyl-~ -0 thiogalactopyranoside), and grown

for further 4-12 h at three different temperatures viz. 20° C, 30° C and 37° C. The level of

inductions in whole cell lysates were monitored on a 12 % SOS-polyacrylamide

gel(Laemmli et aI., 1976).

5.2.3. Solubility optimization of ERa-LBD and ERP-LBD

To optimize the protein solubility conditions, expression of recombinant proteins in

three different hosts i.e. C41 (OE3), BL21 (OE3) and Rosetta strains of E.coli, grown at

three different temperatures i.e. 20°, 30° and 37° C for 4 to 12 h after induction with

1 mM IPTG and sonicated in different buffers containing 50 mM Tris with varying pH

95

Chapter III

conditions (7.0, 7.S, 8.0) and NaCI concentration (SO mM, ISO mM, 300 mM) and adding S

mM ~-mercaptoethanol was investigated. The IPTG induced cells were harvested, sonicated

in particular buffer and were centrifuged at 14,000 rpm for IS min at 4° C in Sigma

Centrifuge 3K30 (Sigma, USA). The supernatant thus separated was run on a 12% SDS­

PAGE and the protein solubility was checked in different samples prepared and the

solubility conditions were also confirmed by immunoblotting.

5.2.4. Purification of ERa-LBD and ERP-LBD

For purification, 1 L of culture induced with ImM IPTG and grown for additional 12

h, was harvested by centrifugation at 7,000 rpm for 10 min at 4° C, resuspended in the lysis

buffer A (SOmM Tris pH 7.S, SOmM NaCl, IOmM Imidazole, SmM ~-mercaptoethanol) or B

(SOmM Tris pH 7.2, ISOmM NaCl, 10mM Imidazole, S mM ~-mercaptoethanol), and was

sonicated on ice for 8 cycles with a medium-size probe (22 mm) at 20% output power, SO%

pulsar duty cycle for a pulse time of 8 min. Before lysis, protease inhibitor cocktail and 1

mM of the protease inhibitor PMSF was added to the culture. The lysate was cleared from

the cellular debris by centrifugation at 14,000 rpm for 20 min at 4°C. The supernatant was

used for the purification and was applied to a Ni2+-NTA chelating sepharose column (GE

Healthcare) pre-equilibrated with equilibration buffer. The protein was eluted using same

buffer supplemented with a linear gradient of imidazole in a stepwise manner. Fractions

containing protein were pooled after SDS-PAGE (12%) analysis and buffer exchange was

done using a Superdex S-200 (GE Healthcare, UK) gel-filtration column equilibrated with

buffer A or B supplemented with S mM EDTA. The collected protein was then concentrated

using 10 kDa cutoff centricon (Ami con) and the protein concentration was determined using

the Bradford reagent (Bradford, 1976) with bovine serum albumin as a standard. Proteins

remained stable at 4°C without degradation upto 30 days.

5.2.5. Preparation of crude protein extract

Crude cell paste containing the soluble recombinant proteins ERaLBO and ER~LBD

was prepared by culturing the ERaLBO and ER~LBD transformants under optimized

conditions and harvesting them at 7,000 rpm for 10 min at 4° C in centrifuge (Sigma, 3K30).

The cell pellets were subsequently suspended in the binding buffer C (SOmM Tris pH 7.5,

96

Chapter III

10% glycerol, O.lmM butylated hydroxyanisole, 10mM ~-mercaptoethanol) at lOmI buffer/g

of cell paste, as described by (Carlson et al., 1997). ImM PM SF and protease inhibitor

cocktail was added just before use and the cell paste was sonicated on ice in the same

manner as is described above. The lysate was then centrifuged at 30,000 x g for 30 min at 4°

C to remove cellular debris and the supernatant was collected and used as ER LBD source.

5.2.6. Characterization of LBD of human ERa and ERP:

The recombinant proteins were characterized by assessing their ability to bind to

their natural ligand 17~-Estradiol, and also by investigating the binding specificity of these

proteins for different molecules. In addition, saturation ligand binding analysis was done and

the association and dissociation constants of the proteins were determined. All these assays

were conducted using crude as well as purified recombinant protein and the receptor activity

with both forms were compared.

5.2.7. Determination of dissociation constant

The recombinant proteins were over-expressed and purified as described in the

previous section. The protein concentrations in the supernatant were determined using the

Bradford reagent.. Briefly, different concentrations of eH]-E2 (0.5 nM, 1 nM, 2 nM, 4 nM, 8

nM and 16 nM) were incubated with 20 ng of purified ERaLBO or ER~LBD for 16 h at 4°C

after vortexing. Bound and free ligands were separated by adding chilled dextran coated

charcoal (DCC) and centrifuging 3,000 rpm for 15 min at 4° C. The radioactivity was

determined in the bound fraction with a Multi Purpose Scintillation Counter, (Beckman

Coulter, USA). All the incubations were performed in duplicates. Reactions for determining

non-specific binding were also set by adding 100 times unlabelled estradiol in excess.

Specific bound radioligand was calculated by subtracting nonspecifically bound cpm from

total bound cpm. Bound and free radioactivity was estimated and the total eH]-E2 added

versus specifically bound 3H-E2 was plotted to get the saturation curve. Saturation curve was

plotted with the crude protein preparation (10 Ilg/ reaction) as well. The dissociation constant

(Kd) of each purified protein was calculated from the Scatchard plot of specific binding data

by determining the slope (Scatchard G 1949).

97

Chapter III

5.2.8. Assessment of ligand binding specificity

The ligand specificity of the recombinant proteins, both in purified as well as crude

extract was determined using competitive binding method. 3H-E2 was allowed to compete

with the unlabelled ligands in the presence of either the crude protein preparation or purified

proteins Compounds viz. raloxifene, tamoxifen, ormeloxifene, PPT (ERa agonist), ICI 182,

780 and progesterone were included in the reaction to test their affinity towards specific

subtype of ER. The compounds were dissolved in dimethyl formamide (DMF) for making

stock solution of ImM and a series of dilutions were prepared in TEAB (10 mM Tris-HCl,

pH 7.2,1.5 mM EDTA, 0.02 % sodium azide, 0.01 % BSA): DMF (1:1) of each compound.

100 Jll of protein prepearation (containing O.IJlg protein) was incubated with 3.5 nM of 3H­

E2 in the absence or presence of various concentrations of compounds, for 18 h at 4° C.

Different concentrations of various compounds were incubated with either ERaLBO or

ER~LBD for 18 h at 4° C. The bound and unbound 3H-E2 were separated using DCC at 4° C

as described above. The radioactivity was determined in the bound fraction with a Multi

Purpose Scintillation Counter, (Beckman Coulter, USA). All the incubations were performed

in duplicates. Percent 3H-E2 binding activity was plotted against log values of molar

concentrations of competitor. The relative binding affinity (RBA) was then calculated as the

ratio of concentration of unlabelled estradiol required for 50% 3H -E2 binding to the

concentration of test compound required for 50% 3H-E2 binding and expressed as percentage

of estradiol-17~.

5.3. Results

5.3.1. Cloning and over-expression of ERaLBD and ERPLBD:

ERaLBD and ER~LBD were cloned in vector pE121b and pE128c respectively,

both of which add a hexahistidine tag at the carboxy terminal (Fig. 5.1A and B). Of the

gradient of IPTG concentration used (0.3 mM to 1 mM) for induction, at 1 mM IPTG

concentration expression of both ERaLBD and ER~LBD was highest (Fig. 5.2A and

B) irrespective of the expression host (C41, BL21 and Rosetta) and temperature (20°

C, 30° C and 37° C) examined.

98

Chapter III

A B M 1 2 3 4 Mil 2 3 4 56M2

Fig.5.l. Cloning of ERaLBD (A) and ER~LBD (B) in pET expression vectors. 1% agarose gel stained with ethedium bromide is shown. (A) Lane l-BamHI and EeaR! digested vector pET21 b, Lane 2- BamHI and EeaR! digested amplified insert ERaLBD and Lane 3, 4- BamHI and EeaR! digested ERaLBD-pET21b (B) Lane I-Amplified insert ER~LBD, Lane 2- BamHI and HindIII digested vector pET28e, Lane 3-BamHI and HindIII digested vector pET28c, Lane 4-undigested vector pET28e, Lane 5-BamHI and HindIII digested ERfJLBD-pET28c, Lane 6- BamHI and HindIII digested ERfJLBD-pET28e. MI-IOO bp DNA ladder, M2-lkb DNA ladder.

A B UI I M(kDa) UI M (kDa)

.~= ~ .-~= 7lkDa

'~

_ 4S1<Da

t1';{t 35kDa

---

Fig. 5.2. SDS-PAGE analysis of over-expressed LBD peptides of ERa and ER~. A 12% polyacrylamide gel stained with Coomassie Blue is shown: Lyastes of whole cells from an overnight culture of E. eali harboring ERaLBD-pET21 b (A) and ERfJLBD-pET28e (B) expression plasmid were run on gel; UI-Uninduced whole cell lysate from an overnight culture, 1- whole cell lysate from an overnight culture following induction with 1 mM isopropyl-l-thio-~-D-galactopyranoside (IPTG); M- Prestained protein molecular weight marker.

99

Chapter III

5.3.2. Solubility of ERa-LBD and ERP-LBD:

ERa-LBD and ER~-LBD were found to be most soluble when transformed into the

BL21 (DES) strain of E. coli and grown for 12 h after induction with 1 mM IPTG at 20° C.

ERaLBD was optimally soluble (-10%) in buffer A under these conditions and a prominent ~

38 kDa polypeptide was detected by SDS-P AGE in soluble fraction of IPTG induced bacteria

The solubility ofER~LBD was found to be optimum (~1O%) in the buffer B (Fig. 5.3). These

polypeptides were not detected in uninduced samples or when bacteria transformed with

plasmids (PET21 b or pET2 Be) alone were induced with IPTG.

2 3 4 5 6

ERaLBD

ER~LBD .-.~~~.~~ 37kDa

Fig. 5.3. Solubility analysis of over-expressed peptides of ERaLBD and ER~LBD as determined by immunoblotting. E.coli BL21 cells expressing either ERaLBD or ER~LBD peptides were grown for 12 h at 20° C (Lanes 1,2),30° C (Lanes 3, 4) or 37 0 C (Lanes 5,6) after induction with 1 mM IPTG. Respective pellets (Lanes 2, 4, 6) and supernatants (Lanes 1, 3, 5) were separately analyzed by western blotting using anti-his antibody.

5.3.3. Purification of ERa-LBD and ERp-LBD

Purification of the over-expressed proteins was done by the Ni affinity

chromatography and gel filtration chromatography. A linear gradient of imidazole was used

to elute protein from the Ni2+-NTA chelating sepharose column. 300 mM imidazole was

optimized for elution of ERaLBD while ER~LBD was eluted at 400 mM imidazole. Size

exclusion chromatography depicted the presence of both the proteins in dimeric form when

compared with the standards. Purity of proteins was confirmed by 12% SDS-P AGE which

showed that the preparation was essentially homogenous with respect to the ~ 38 kDa

(ERaLBD) and ~ 37 kDa (ER~LBD) polypeptide (Fig. 5.4). A single intact signal was

detected in case of both the recombinant proteins by western blot analysis using anti-his

antibody.

The recombinant proteins ERaLBD and ER~LBD were also looked for their expression

in soluble form and use of these proteins as crude preparation. Prominent presence of the

recombinant proteins ERaLBQ and ER~LBD was detected on SDS-PAGE analysis of the

100

Chapter III

(crude) supernatant. (Fig. 5.5 A and B) Protein was diluted with the dilution buffer F (Buffer

C + 0.05 % yeast extract) to the required concentration used for the activity assay.

Fig. 5.4. SDS-PAGE analysis of purified ERaLBD and ER~LBD peptides. A 12% polyacrylamide gel stained with Coomassie Blue is shown. E.coli BL21 cells expressing either ERaLBD or ER~LBD peptides were grown for 12 h at 20° C after induction with 1 mM IPTG. The soluble proteins were purified by Ni NT A column and subsequently were subjected to size exclusion chromatography. Lane 1-Ni affinity purified ERaLBD, Lane 2-Ni affinity purified ER~LBD, Lane 3-ERaLBD after size exclusion chromatography, Lane 4-ER~LBD after size exclusion chromatography, M- Prestained protein molecular weight marker.

A

til I

-

M(kDa)

~124 ~ I~n

-. 35

- to

B

55

+-30

20

Fig. 5.5. SDS-PAGE analysis of crude preparation of ERaLBD and ER~LBD peptides. A 12% polyacrylamide gel stained with Coomassie Blue is shown. E.coli BL21 cells expressing individual LBD peptide were grown for 12 h at 20° C after induction with 1 mM IPTG. Protein was isolated as

described in Materials and Methods, ERaLBD (A) and ERPLBD (B) peptide samples were separated on 12 % gel and stained. UI-Soluble protein from uninduced culture, 1- Soluble protein from culture following induction with 1 mM IPTG; M- Prestained protein molecular weight marker.

101

Chapter III

5.3.4. Characterization of LBD of human ERa and ERP

The functional integrity of the ligand binding domain was confirmed by investigating

its binding affinity towards 17~-Estradiol, its natural ligand. Measurements of the

equilibrium binding of the radio ligand in the presence of different concentrations of

unlabeled competitors provide readily interpretable information about the affinities of the

latter.

Linear transformation of saturation data (Fig. 5.6 and 5.7) revealed a single

population of binding sites for 17~-estradiol with a K.d (dissociation constant) of 4.20xlO-9

molesll for the ERaLBD and of 2.2xlO-9 molesll for ER~LBD, values comparable to as

described by (Parker et aI., 2000). These constants for ERaLBD and ER~LBD proteins did

not differ much when the saturation binding analyses were done using crude protein

preparations (data not shown).

4 -T8 -NS8 -S8

10 15 20

3HE2 concentration (nM)

Fig. 5.6. Scatchard analysis for estradiol binding to the purified ERaLBD peptide. A radioreceptor assay was perfonned using a range of concentration of 3HE217~-Estradiol in the presence of purified ERaLBD peptides and incubated in the presence of 100-fold excess of Ez for 18 h at 4° C. Unbound radio ligand was removed and specific bound radio ligand was calculated by subtracting nonspecific bound cpm from total bound cpm. Details given in 'Materials and Methods' section. Inset, Scatchard plot analysis of specific binding giving a Kd of 4.2 nM for ERaLBD protein.

102

0.15 -:iii c: - 0.10

0.05

0.00 -----• •

o 5 10 15

3HE2 Concentration (nM)

-TB -NSB -SB

I':~) ~ lU'j • ",.] . tJ ~ • t~¥-"'·--.--.--·,.. 4.1' tJ .. U U 1 --­""' 20

Chapter III

Fig. 5.7. Scatchard analysis for estradiol binding to the purified ER~LBD peptide. A radioreceptor assay was performed using a range of concentration of 3HE2l7~-Estradiol in the presence of purified peptides ER~LBD and incubated in the presence of lOO-fold excess of~ for 18 hat 4° C. Unbound radio ligand was removed and specific bound radio ligand was calculated by subtracting nonspecific bound cpm from total bound cpm. Details given in 'Materials and Methods' section. Inset, Scatchard plot analysis of specific binding giving a Kd of 2.22 nM for ER~LBD protein

Another relevant aspect of the receptor, the ligand binding specificity, was perfonned

and expressed as the relative binding affinity (RBA) with relation to 17~-Estradiol. RBA of

five anti estrogenic molecules were detennined and it was observed that both the proteins

displayed excellent ligand specificity and were comparable to that of reported previously

(Fig. 5.8A and 5.9A). RBA of a pure anti estrogen leI 182, 780 was also very high,

comparable with 17~-Estradiol, with both the ER subtypes it showed RBA of 76% and 83%

for ERaLBD and ER~LBD respectiVely. Raloxifene, a SERM showed high RBA of 66 with

ERaLBD but 10 with ER~LBD which is in agreement with the previous values as reported

(Kuiper et aI., 1998; Sibonga et aI., 1998). Onneloxifene showed almost same binding

affinity with both receptor subtypes. PPT, which is a well known ERa- specific ligand,

showed excellent binding affinity with ERaLBD, its RBA being near to 52 %. Its affinity

towards ERaLBD was more than 50 folds as compared to that with ER~. The Ki for PPT for

ERaLBD was 35 times less as compared to that for ER~LBD. Progesterone serving as a

negative control did not bind to any of the over-expressed proteins. RBA values were

determined using crude protein preparations and no significant difference was observed with

the purified peptides (Fig. 5.8B and 5.9B).

103

Chapter III

A B --E2 150 150 --Rat

--ICI182.780

~ 7 --PPT ~ --Onn .... .... -- Progesterone

0) 0) C 100 c 100 ;; ;; c c iii iii tfi 50 N 50 W 1: 1:

f'J f'J

0 100 10' 1()2 105 1()4 1Q$ 10' 10-1 10° 101 1()2 10~ 10' 10! 10'

Concentration (nM) Concentration (nM)

Fig. 5.8. Competitive binding curves for the ERaLBD peptide. Competitors in a range of concentration were incubated with purified (A) or crude preparation (B) of ERaLBD in the presence

of 3.5 oM 3HEzI7~-Estradiol for 18 h at 4° C. Bound and unbound radioligand was separated and radioactivity was determined in bound fraction. Details given in 'Materials and Methods' section. The data shown represent the average of two experiments performed in duplicate.

A

-'/. .... CD c :r; c iii N W J:

I')

150

10{}

50

{}+-~--.-.--.~~~~ 10-' 1~ 1~ 102 1~ 1~ 1~ 1~

Concentration (nM)

B 150 --E2

--Ral ~

---ICl182,780 --PPT 0 -<>-Onn 0) ---Progesterone c 100 :r;

c iii N W 50 J:

f'J

Concentration (nM)

Fig. 5.9. Competitive binding curves for the ER~LBD peptide. Competitors in a range of

concentration were incubated with purified (A) or crude preparation (B) of ER~LBD in the presence

of 3.5 oM 3HEzI7~-Estradiol for 18 h at 4° C. Bound and unbound radioligand was separated and radioactivity was determined in bound fraction. Details given in 'Materials and Methods' section. The data shown represent the average of two experiments performed in duplicate.

104

Chapter III

The relative binding affinity and the Ki values of various competitors for ERLBD and

ERLBD are tabulated in Table 5.1

Table 5.1. ICso and Kj values of compounds for purified estrogen receptor subtypes a and P LBDs:

ERa-LBD ERfJ-LBD Competitor

ICso RBAa Kt ICso (nM) RBAa Kjb(nM)

(nM) (nM)

l7~-Estradiol 50 100 50 100 Raloxifene 75 66 13 500 10 60

Ormeloxifene 5000 1 892 10000 0.5 1200 PPT 98 52 17 5000 1 600 ICI182,780 65 76 11 60 83 1 Progesterone ND ND ND ND ND ND

a-RBA is expressed as percent of estradiol-17P b-Ki was calculated by (Cheng and Prusoff, 1973) formula modified for receptor-mediated response by (Craig, 1993). ND-Not Detectable

5.4. Discussion

The existence of two ER subtypes provides, at least in part, an explanation for the

selective actions of estrogens in different target tissues. In fact, the high degree of

interspecies conservation of the individual ER subtypes throughout vertebrate evolution

could suggest that the basis for the selective effects of estrogens resides in the control of

different subsets of estrogen-responsive promoters by the two ER subtypes. This would

implicate differential expression of the ER subtypes in target tissues. The two subtypes have

distinct functions and are differentially expressed in certain tissues. These differences have

prompted the search for subtype-specific ligands that can elicit tissue- or cell-specific ER

activity. In particular, the dominance of ERa expression in the breast and uterus suggests

that ERp-selective ligands may offer some of the benefits of hormone replacement therapy

such as a decrease in the risk of colorectal cancer without increasing the risk of breast or

uterine cancer.

105

Chapter III

Due to strong hydrophobicity in the ligand binding pockets, the proteins tend to form

aggregates (Clark, 2001) and can be recovered only using detergents which may interfere

with the receptor activity. In our study, the yield of soluble LBD peptide obtained (~ 6-8

mglliter of culture) is significantly greater than previously reported (Wooge et aI., 1992),

that can be used for a variety of biophysical studies. Although some of the hormone-binding

domains from steroid receptors have been expressed to adequate levels in E. coli, most of

these have been expressed the as inclusion bodies (Seielstad et aI., 1995). There are only a

few reports of ligand-binding domains being expressed as soluble proteins or soluble fusion

proteins in the literature (Vasina and Baneyx, 1997; Mossakowska, 1998). Our method is

especially useful as no detergent was used in order to get protein in soluble fraction. The

solubility of the over-expressed protein was also confirmed by performing the western blot

using anti-his antibody directed against the hexahistidine tag present at the carboxy terminal

of both the recombinant proteins which revealed the presence of single band in both the cell

pellet and the soluble form (Fig. 5.3A and B). Size exclusion data depicted the presence of

both LBD peptides in dimeric state. This finding has been reported by Brandt and Vickery,

(1997) who suggested that the dimer formation in isolated LBD does not require ligand

binding. In addition, RXR-a HBD peptide crystallized as a dimer (Bourguet et aI., 1995).

In this report, we have used LBD of ER subtypes, overexpressed in bacteria, for

examining the ligand binding affinity and to check whether the isolated LBD could be used

for the purpose. We observed that the LBD preparations were able to bind the ER ligands

specifically and displayed the binding affinity with different ligands comparable to that with

the previous reports (Kuiper et al., 1997; Kuiper et aI., 1998). This observation is in

accordance with the study done by Eilers et aI., (1989) who described that the chimeric

constructs containing ER fragments display hormonal regulation suggesting that, even when

removed from its normal environment, the LBD is" not only capable of specific ligand

binding, but may also retain the capacity to undergo the conformational changes that

normally regulate the function of the receptor. Both the proteins showed high affinity low

capacity binding to estradiol. In competitive binding assay, ICI 182, 780 showed maximum

RBA followed by raloxifene by both ERaLBD and ER~LBD peptides. High affinity binding

of ERa specific ligand, PPT was observed with ERaLBD which showed almost 50 times

less affinity with ER~LBD. Our receptor binding data correlated well with that reported in

literature, thereby validating the structural integrity and functionality of the recombinant

106

Chapter III

proteins being expressed (Kuiper et aI., 1997; Kuiper et aI., 1998; Sibonga et aI., 1998;

Parker et aI., 2000).

In conclusion, we have demonstrated a method in which the LBDs of ER were

produced in E.coli where they were present in the soluble fraction. Since, both the crude

protein preparation as well as the purified protein was examined for any difference in

activity and no significant difference was observed between the two, it is possible to conduct

the screening procedure with the crude protein preparation also, thereby saving time. After

harvesting, the cells over-expressing the recombinant proteins can be stored at _200 C for

about a month and at _800 C for much longer period without loss in activity of the protein.

Purified recombinant protein can also be stored frozen in -800 C without any detectable

alterations in in vitro assays. For storage particularly at _200 C, stabilizing excipient like

glycerol was included in the buffer. These excipients provide protection against damage to

the protein that can occur during freeze-thaw cycles. The isolated protein was also stable at

these temperatures for a month. Furthermore, this procedure does not require the use of

denaturants. We suggest the use of these proteins for routine screening of novel molecules

and is well suited for the purpose as both purification as well as the assay can be performed

in two days. The final product is active in in vitro assays which confirms that the process is

capable of preserving the receptor integrity.

107