DNA Barcoding Of Tea DNA Barcoding Of Tea CamelliaCamellia

sinensissinensis(L)Kuntz (L)Kuntz In Sri LankaIn Sri Lanka

E.D.T.S.Wickramasinghe(USJP)Neil D. Fernandopulle(Genetech)

P.L.Hettiarachchi(USJP)

The tea plant Camellia sinensis(L)kuntz is the plant of whose leaves and leaf buds are used to produce tea.

After water, tea is the most widely consumed beverage in the world.

Sri Lanka is world famous for its high quality tea

Today, Sri Lanka is the world's third biggest tea exporter.

The world tea production is dominated by five countries namely India, China, Sri Lanka, Indonesia and Kenya .

2

3

Sri Lankan tea is unique in its diversity in flavor, something that other tea producing countries do not have.

Low quality, non-Sri Lankan tea might be sold in the global market under the name “CEYLON TEA”.

There should be a method to identify all Sri Lankan tea clones.(Both fresh and processed samples).

Heterogeneity of samples can be used to classify them into various clones.

Methods used to identify species or taxa beyond species level by using short, standardized DNA sequence in a well-known gene known as "DNA barcode“ is DNA barcoding.

The DNA barcode sequence includes about 400-800 base-pairs. That is a tiny portion of the billons of base pairs that make up the entire genome of many organisms

4

METHODOLOGYMETHODOLOGY

DNA Extraction from fresh tea leaves

DNA extraction from tea is difficult due to the

presence of high content of polyphenols.. For barcoding, 16 samples of fresh tea leaves

obtained by a Kahawatta plantation were used.

CTAB method described by Doyle and Doyle, 1987 has to be modified to extract DNA.

Extraction protocolHomogenization and Lysis [1.4 M sodium chloride, 1% pvp, 50.0 mM EDTA, 2% CTAB, 2% β -

mercaptoethanol] .

Protein and RNA digestion

Peptide precipitation( 5 M potassium acetate)

Chloroform extraction :- Samples were extracted with equal volume of phenol : CHCl3 : isoamyl alcohol (25:24:1)

NaCl containing PEG was added to increase the DNA yield.

Precipitation of DNA and washing

Obtained pellet was dissolved in 60.0 µl of TE buffer [10 mM Tris (pH 8.0),

0.1 mM EDTA] and stored at 20º C until use.

7

It was not possible to extract DNA from processed tea leaf samples even by using modified CTAB method. Another extraction method described by Hupfer et al., (1998); Hotzel et al., (1999); Meyer et al., (1997); Poms et al., (2001) was used to extract DNA from processed tea leaves.

Processed tea leaves and tea dust were used to extract DNA.

Homogenization

Protein and RNA digestion

Chloroform extraction.

Removal of Contaminants CTAB precipitation solution (5 g/L CTAB, 0.04 M NaCl)

Chloroform extraction

DNA Precipitation and washing

Pellet was dried and re-dissolve in 100.0 µl of sterile deionised water. 8

Extraction protocol

9

Selection of a Barcoding region

The trnH – PsbA spacer (~450 bp) of the plastid was selected as the barcoding region.

This region is one of the most variable and easily amplified across a broad range of land plants.

primer Sequence(5’-3’)

Annealing temperature

(ºC)

Expected Product

Size (bp)

Forward primer

Trn – H

CGCGCATGGTGGATTCACAATCC

50 450Reverse Primer

Psb – A

GTWATGCAYGAACGTAATGCC

10

W for A or TY for C or T

PCR

Agarose gel electrophoresis and gel purification

Sequencing and editing

11

12

450 bp marker

2% agarose gel stained with ethidium bromide showing PCR amplified products of DNA extracted from fresh leaf sample using modified

CTAB method.

13

Lanes 1 – 16. DNA extracted from samplesTRI 3063, TRI 3022, TRI 4006, TRI DN, TRI 4014, TRI 4021, TRI 3015, TRI 3018, TRI 4042, TRI 4052, TRI 2025, TRI 4028, TRI 2043, TRI DG7, TRI 3025, TRI 4046, respectively.

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16

14

15

Sequencing data of sample TRI DG7

Sequencing data of sample TRI2025

16

Alignment of psb-A region of six samples

17

Genetic Distance

Phylogenetic tree obtained for sequenced samples and

Camellia sinensis var. sinensis at NCBI.

18

considerable variation among studied clones were observed.

According to the phylogenetic tree, genetic distances obtained ranged from 0.003 – 0.06, which is acceptable for intra specific taxa.

A very close relationship between Sri Lankan tea cultivars tested and Camellia sinensis var. sinensis was observed in the phylogenetic tree.

This is the first record of a method developed to extract and barcode processed tea samples.

Now, it’s possible to develop a data base of multiple, target DNA regions

To establish sequences unique to Sri Lankan tea

Using this, local tea cultivars can be patented. Finally, the position of Sri Lankan tea in the

global market could be secured.

19

THANK YOU!!THANK YOU!!

20