25-1

Chapter 25: Molecular Basis of Inheritance

Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

DNA was shown to be the genetic material (rather than proteins) by a simple experiment.

25-2

Fig 25.1

Different parts of the phage were radioactively labeled (shown in red).

Viral DNA is labeled

25-3

Fig 25.1

Viral capsid is labeled

The experiments showed that only the virus DNA entered the bacteria and produced new viruses.

25-4

One pair of bases

DNA is a polynucleotide composed of a phosphate, a sugar, and four nitrogen-containing bases: adenine (A), thymine (T), guanine (G), and cytosine (C).

Purine

Pyrimidine

Fig 25.2

25-5

The structure of DNA was determined by James Watson and Francis Crick in the early 1950’s and they showed that DNA is a double helix in which A is paired with T and G is paired with C.

This is called complementary base pairing because a purine (2 rings) is always paired with a pyrimidine (1 ring).

25-6

DNA double helix

When the DNA double helix untwists, it resembles a ladder:

Sides = sugar+phosphate

Rungs = complementary paired bases.

The two DNA strands are anti-parallel – they run in opposite directions

Fig 25.2

Hydrogen Bond

25-7

Replication of DNA

DNA replication occurs during chromosome duplication; an exact copy of the DNA is produced with the aid of DNA polymerase.

25-8

Overview of DNA replication

Hydrogen bonds between bases break and enzymes “unzip” the molecule.

Each old strand of nucleotides serves as a template for each new strand.

Fig 25.3

25-9

New nucleotides move into complementary positions and are joined by DNA polymerase.

The process is semiconservative. Each new double helix is composed of an old strand and a newly-formed strand.

Fig 25.4

Ladder configuration and DNA replication

New Strands

Old Strands

25-10

Gene Expression

A gene is a segment of DNA that specifies the amino acid sequence of a protein.

Gene expression occurs when gene activity leads to a protein product in the cell.

A gene does not directly control protein synthesis; DNA is transcribed into RNA, RNA is translated in amino acids which are used to make proteins.

25-11

RNA (ribonucleic acid) Three types of RNA:

messenger RNA (mRNA) carries genetic information to the ribosomes, RNA copy of DNA

ribosomal RNA (rRNA) is found in the ribosomes, and

transfer RNA (tRNA) transfers amino acids to the ribosomes, where the protein product is synthesized.

25-12

Structure of RNARNA is a single-stranded nucleic acid in which A pairs with U (uracil) while G pairs with C.

DNA=T-A;G-C RNA=U-A;G-C

Fig 25.5

25-13

Two processes are involved in the synthesis of proteins in the cell:

Transcription makes an RNA molecule complementary to a portion of DNA (a section of DNA instruction is copied).

Translation occurs when the sequence of bases of mRNA directs the sequence of amino acids in a polypeptide (instructions are followed to build a protein).

25-14

The Genetic CodeDNA specifies the synthesis of proteins

because it contains a triplet code: every three bases stand for one amino acid.

Each three-letter unit of an mRNA molecule is called a codon.

The code is nearly universal among living organisms.

25-15

Codons

AATCGGTGCTAGTTAGCCACGATC Double Stranded

DNA

AATCGGTGCTAG

Each group of three bases = one codon

Each codon is the ‘code’ for a specific amino acid.

25-16

Messenger RNA codons

Fig 25.6

123 = amino acid

AUA = isoleucine

CCG = proline

GAU = aspartate

GAC = aspartate

25-17

Central ConceptThe central concept of genetics involves

the DNA-to-protein sequence involving transcription and translation.

DNA has a sequence of bases that is transcribed (copied) into a sequence of bases in mRNA.

Every three bases is a codon that stands for a particular amino acid.

25-18

Overview of gene expression

Fig 25.7

25-19

Transcription and mRNA synthesis

During transcription in the nucleus, a segment of DNA unwinds and unzips, and the DNA serves as a template for mRNA formation.

RNA polymerase joins the RNA nucleotides so that the codons in mRNA are complementary to the triplet code in DNA.

Fig 25.8

25-20

Translation

Translation is the second step by which gene expression leads to protein synthesis.

During translation, the sequence of codons in mRNA specifies the order of amino acids in a protein.

Translation requires several enzymes and two other types of RNA: transfer RNA and ribosomal RNA.

25-21

Transfer RNA

During translation, transfer RNA (tRNA) molecules attach to their own particular amino acid and travel to a ribosome.

Through complementary base pairing between anticodons of tRNA and codons of mRNA, the sequence of tRNAs and their amino acids form the sequence of the polypeptide.

25-22

Transfer RNA: amino acid carrierFig 25.10

25-23

Anticodon

AAUCGGUGCUAG mRNA

UUA

Anticodon for the first codon

Codons

Part of tRNA

25-24

Ribosomal RNA

Ribosomal RNA, also called structural RNA, is made in the nucleolus.

Proteins made in the cytoplasm move into the nucleus and join with ribosomal RNA to form the subunits of ribosomes.

25-25

Translation Requires Three Steps

During translation, the codons of an mRNA base-pair with tRNA anticodons.

Protein translation requires these steps:1) Chain initiation2) Chain elongation3) Chain termination.Enzymes are required for each step, and

the first two steps require energy.

25-26

Chain Initiation

First, a small ribosomal subunit attaches to the mRNA near the start codon.

The anticodon of tRNA, called the initiator RNA, pairs with this codon.

Then the large ribosomal subunit joins.

Fig 25.12

25-27

Chain ElongationThe ribosome moves forward and the tRNA at the second binding site is now at the first site, a sequence called translocation. The previous tRNA leaves the ribosome and picks up another amino acid before returning.

Fig 25.12

25-28

Chain Termination Fig 25.12

Chain termination occurs when a stop-codon sequence is reached.

The polypeptide is enzymatically cleaved from the last tRNA by a release factor.

A newly synthesized polypeptide may function alone or become part of a protein.

25-29

Fig 25.11

Polyribosome structure and function

Several ribosomes may attach and translate the same mRNA, therefore the name polyribosome.

25-30

Review of Gene ExpressionDNA in the nucleus contains a triplet

code (codons); each group of three bases stands for one amino acid.

During transcription, an mRNA copy of the DNA template is made.

The mRNA joins with a ribosome, where tRNA carries the amino acids into position during translation.

25-31

Gene expression Fig 25.13

25-32

Gene Mutations

A gene mutation is a change in the sequence of bases within a gene.

25-33

Frameshift Mutations

Frameshift mutations involve the addition or removal of a base during the formation of mRNA; these change the genetic message by shifting the “reading frame.”

Codon sequence:

THE CAT ATE THE RAT

If C in cat is removed:

THE ATA TET HER AT

25-34

Point Mutations

Point mutation (3 types) - The change of just one nucleotide causing a codon change

-can cause the wrong amino acid to be inserted in a polypeptide.

1) Silent mutation, change in the codon results in the same amino acid.

CUC and CUA both code for Leucine

25-35

2) Nonsense mutation - If a codon is changed to a stop codon, the resulting protein may be too short

3) Missense mutation - the substitution of a different amino acid, the protein cannot reach its final shape

An example is Hbs which causes sickle-cell disease.

25-36

Sickle-cell disease in humansChain is 146 AA’s long One change in the sixth position

GUA & GUG = Valine

GAA & GAG = glutamate

Fig 25.17

25-37

Cause and Repair of MutationsMutations can be spontaneous or caused

by environmental influences called mutagens.

Mutagens include radiation (X-rays, UV radiation), and organic chemicals (in cigarette smoke and pesticides).

DNA polymerase proofreads the new strand reducing mistakes to one in a billion nucleotide pairs replicated.

25-38

Cancer: A Failure of Genetic Control

Cancer is a genetic disorder resulting in a tumor, an abnormal mass of cells.

‘Unregulated Cell Growth’Carcinogenesis - the development of

cancer.

Cancer cells fail to undergo apoptosis, or programmed cell death.

25-39

Cancer cellsCancer cells lack differentiation, form tumors, undergo angiogenesis and metastasize.

25-40

Angiogenesis (stimulated by cancer cells) is the formation of new blood vessels.

Metastasis is invasion of other tissues by establishment of tumors at new sites.

A patient’s prognosis is dependent on the degree to which the cancer has progressed.

25-41

Origin of Cancer1) Mutations in genes for DNA repair

enzymes can contribute to cancer.

2) Mutations in genes that code for proteins regulating structure of chromatin can promote cancer.

25-42

3) Mutations in Proto-oncogenes or tumor-suppressor genes can prevent normal regulation of the cell cycle.

4) Telomeres are DNA segments at the ends of chromosomes that normally get shorter and signal an end to cell division; cancer cells have an enzyme that keeps telomeres long.

25-43

OncogenesProto-oncogenes – involved with

stimulating cell division

Proto-oncogenes can undergo mutations to become cancer-causing oncogenes.

Oncogenes are responsible for uncontrolled cell growth.

25-44

Tumor-Suppressor Genes

Tumor-suppressor genes – involved with suppressing cell division.

When Tumor-suppressor genes mutate, they stop suppressing the cell cycle and it can occur nonstop.

The balance between stimulatory signals and inhibitory signals determines whether proto-oncogenes or tumor-suppressor genes are active.

25-45

Causes of cancer

25-46

Stop

25-47

Chapter 23:

Know why Gregor Mendel is important

What does homologous, allele, loci, gene, chromosome, genotype, and phenotype mean?

What is the relationship between dominant and recessive alleles. How does inheritance work? How many copies of each allele are found in gametes?

What is a one-trait cross? What are the possible outcomes (genotype & phenotype) based on the parents genotypes/phenotypes. Same questions for two-trait cross.

What is a pedigree chart and what is it used for. Understand how to do a pedigree analysis.

What is an autosome? What is autosomal dominant versus autosomal recessive? Also polygenic traits, incomplete dominance,and codominance.\

Review blood type and sickle cell disease.

25-48

Chapter 24:

Know what karyotyping is and what it can be used for.

Understand how changes in chromosome number, what can happen, and why that is important.

Understand how changes in sex-chromosomes affect a persons phenotype/genotype and associated syndromes.

How can changes in chromosome structure occur?

What is a sex-linked trait and how are they inherited?**

Understand how autosomal and sex-linked inheritance of traits works.

Do the practice problems!!

25-49

Chapter 25:

How was it discovered that DNA was the source of genetic information

What is the structure of DNA? How is it replicated?

What is RNA? How is it different than DNA? What types of RNA are there and why?

What is a codon? What are they used for?

What is gene expression? What are the processes that lead to gene expression.

Understand Translation and Transcription and all steps involved.

What are some types of gene mutations and how do they work.

Understand the mechanisms of cancer growth.