24 April, 2008MGX TUTORIAL MGX © 2007-2008 UMASS BOSTON Load organisms from green house.

24
24 April, 2008 MGX TUTORIAL MGX © 2007-2008 UMASS BOSTON Load organisms from green house.
  • date post

    21-Dec-2015
  • Category

    Documents

  • view

    222
  • download

    6

Transcript of 24 April, 2008MGX TUTORIAL MGX © 2007-2008 UMASS BOSTON Load organisms from green house.

Page 1: 24 April, 2008MGX TUTORIAL MGX © 2007-2008 UMASS BOSTON Load organisms from green house.

24 April, 2008 MGX TUTORIAL MGX © 2007-2008UMASS BOSTON

Load organisms from green house.

Page 2: 24 April, 2008MGX TUTORIAL MGX © 2007-2008 UMASS BOSTON Load organisms from green house.

24 April, 2008 MGX TUTORIAL MGX © 2007-2008UMASS BOSTON

Click “open”

Page 3: 24 April, 2008MGX TUTORIAL MGX © 2007-2008 UMASS BOSTON Load organisms from green house.

24 April, 2008 MGX TUTORIAL MGX © 2007-2008UMASS BOSTON

Page 4: 24 April, 2008MGX TUTORIAL MGX © 2007-2008 UMASS BOSTON Load organisms from green house.

24 April, 2008 MGX TUTORIAL MGX © 2007-2008UMASS BOSTON

Select an organism for self crossfor eg. The Red organism

Then click tab“Self-cross One Organism”

Page 5: 24 April, 2008MGX TUTORIAL MGX © 2007-2008 UMASS BOSTON Load organisms from green house.

24 April, 2008 MGX TUTORIAL MGX © 2007-2008UMASS BOSTON

Resulting offsprings of Red organism.

Then double click on Tray1and click “Send to Lower Panel”

Page 6: 24 April, 2008MGX TUTORIAL MGX © 2007-2008 UMASS BOSTON Load organisms from green house.

24 April, 2008 MGX TUTORIAL MGX © 2007-2008UMASS BOSTON

Select two different organisms(heterozygous)

Then click the tab“Cross Two Organisms”

Page 7: 24 April, 2008MGX TUTORIAL MGX © 2007-2008 UMASS BOSTON Load organisms from green house.

24 April, 2008 MGX TUTORIAL MGX © 2007-2008UMASS BOSTON

Resulting offsprings of Red and Green-1 organism.

Page 8: 24 April, 2008MGX TUTORIAL MGX © 2007-2008 UMASS BOSTON Load organisms from green house.

24 April, 2008 MGX TUTORIAL MGX © 2007-2008UMASS BOSTON

Select two same organisms(homozygous)

Then click the tab“Cross two Organisms”

Page 9: 24 April, 2008MGX TUTORIAL MGX © 2007-2008 UMASS BOSTON Load organisms from green house.

24 April, 2008 MGX TUTORIAL MGX © 2007-2008UMASS BOSTON

Resulting offsprings of Red organism.

Page 10: 24 April, 2008MGX TUTORIAL MGX © 2007-2008 UMASS BOSTON Load organisms from green house.

24 April, 2008 MGX TUTORIAL MGX © 2007-2008UMASS BOSTON

Select an organism

Then click “Mutate One Organism”

Page 11: 24 April, 2008MGX TUTORIAL MGX © 2007-2008 UMASS BOSTON Load organisms from green house.

24 April, 2008 MGX TUTORIAL MGX © 2007-2008UMASS BOSTON

Page 12: 24 April, 2008MGX TUTORIAL MGX © 2007-2008 UMASS BOSTON Load organisms from green house.

24 April, 2008 MGX TUTORIAL MGX © 2007-2008UMASS BOSTON

Mutant versions of Green-2 organism.

Then click the tab“Biochemistry”.

Page 13: 24 April, 2008MGX TUTORIAL MGX © 2007-2008 UMASS BOSTON Load organisms from green house.

24 April, 2008 MGX TUTORIAL MGX © 2007-2008UMASS BOSTON

In the Biochemistry addamino acid sequence SSSSSSS here.

Then click“FOLD”

Corresponding phenotype populated when sequence is folded.

The default phenotype

History List is populated with correspondingtemplate and phenotype.-White organism

Page 14: 24 April, 2008MGX TUTORIAL MGX © 2007-2008 UMASS BOSTON Load organisms from green house.

24 April, 2008 MGX TUTORIAL MGX © 2007-2008UMASS BOSTON

Enter another sequenceFFFFFFFand click “FOLD”

Correspondingphenotype(Red)

Heterozygous combined phenotype(Red)

Page 15: 24 April, 2008MGX TUTORIAL MGX © 2007-2008 UMASS BOSTON Load organisms from green house.

24 April, 2008 MGX TUTORIAL MGX © 2007-2008UMASS BOSTON

Enter the same sequence FFFFFFF here and click “FOLD”

Homozygous combined phenotype.(Red )

Page 16: 24 April, 2008MGX TUTORIAL MGX © 2007-2008 UMASS BOSTON Load organisms from green house.

24 April, 2008 MGX TUTORIAL MGX © 2007-2008UMASS BOSTON

Then click tab“Molecular Biology”

Page 17: 24 April, 2008MGX TUTORIAL MGX © 2007-2008 UMASS BOSTON Load organisms from green house.

24 April, 2008 MGX TUTORIAL MGX © 2007-2008UMASS BOSTON

Click the tab“Enter New DNA”

Then enter the DNA sequence-TATAAATGTCTAATCGTCATATTTTATTAGTTTTTTGTCGTCAATAGGGGGG

and click “OK”

Page 18: 24 April, 2008MGX TUTORIAL MGX © 2007-2008 UMASS BOSTON Load organisms from green house.

24 April, 2008 MGX TUTORIAL MGX © 2007-2008UMASS BOSTON

Then click “Fold Protein”

Page 19: 24 April, 2008MGX TUTORIAL MGX © 2007-2008 UMASS BOSTON Load organisms from green house.

24 April, 2008 MGX TUTORIAL MGX © 2007-2008UMASS BOSTON

Resulting Organism -Red

Default Phenotype

Page 20: 24 April, 2008MGX TUTORIAL MGX © 2007-2008 UMASS BOSTON Load organisms from green house.

24 April, 2008 MGX TUTORIAL MGX © 2007-2008UMASS BOSTON

Double click “History List”and select “Send to LowerPanel” orEnter the same DNA byclicking “Enter New DNA” in Lower panel.

Page 21: 24 April, 2008MGX TUTORIAL MGX © 2007-2008 UMASS BOSTON Load organisms from green house.

24 April, 2008 MGX TUTORIAL MGX © 2007-2008UMASS BOSTON

The same two DNA sequencesgive the combined phenotype here(Red) which is homozygous.

Page 22: 24 April, 2008MGX TUTORIAL MGX © 2007-2008 UMASS BOSTON Load organisms from green house.

24 April, 2008 MGX TUTORIAL MGX © 2007-2008UMASS BOSTON

Enter DNA-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTACTGGCGGCAGTAGTAGGGGGCGT

and click “OK”

Page 23: 24 April, 2008MGX TUTORIAL MGX © 2007-2008 UMASS BOSTON Load organisms from green house.

24 April, 2008 MGX TUTORIAL MGX © 2007-2008UMASS BOSTON

Click “Fold Protein”

Page 24: 24 April, 2008MGX TUTORIAL MGX © 2007-2008 UMASS BOSTON Load organisms from green house.

24 April, 2008 MGX TUTORIAL MGX © 2007-2008UMASS BOSTON

Resulting Green-1 organism

The two different DNA sequences gives a Heterozygous combined phenotype which populates here.